CN101422608A - Preparation method of PRRSV ORF5 gene nucleic acid vaccine containing CpG sequence - Google Patents
Preparation method of PRRSV ORF5 gene nucleic acid vaccine containing CpG sequence Download PDFInfo
- Publication number
- CN101422608A CN101422608A CNA2008100140618A CN200810014061A CN101422608A CN 101422608 A CN101422608 A CN 101422608A CN A2008100140618 A CNA2008100140618 A CN A2008100140618A CN 200810014061 A CN200810014061 A CN 200810014061A CN 101422608 A CN101422608 A CN 101422608A
- Authority
- CN
- China
- Prior art keywords
- orf5
- pvax1
- group
- cpg
- plasmid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention relates to a preparation method of a DNA vaccine containing CpG-ODN and genes expressing porcine reproductive and respiratory syndrome virus (PRRSV) ORF5. The reorganization plasmid is transfected with COS-7 cells after the enzyme digestion and sequence measurement by constructing eucaryon reorganization expression plasmid CpG-pVAX1-ORF5 containing CpG ITAMs and PRRSV ORF5, and CpG-pVAX1-ORF5 can express PRRSV GP5 proteins by IFAT. The specific antibody titer, the spleen T lymphocyte subgroup number (CD4+ and CD8+) and the lymphocyte breeder reaction (MTT method) of immune SPF rats and pigs can be detected. Test results prove that the eucaryon reorganization expression plasmid CpG-pVAX1-ORF5 containing the CpG ITAMs can induce the rats and pigs to produce the humoral immunity and cell immunity to PRRSV, thus increasing the gene immunity effect of porcine reproductive and respiratory syndrome virus (PRRSV) effectively.
Description
1, technical field
The present invention relates to adjuvant and its preparation method that gene vaccine uses, specifically is a kind of PRRSV ORF5 gene nucleic acid vaccine of the CpG of containing sequence.
2, background technology
Since the twenties in last century, many materials are attempted as immunological adjuvant, but have only the aluminium glue adjuvant to obtain the permission of human vaccine, and are used for pig vaccine in a large number.It is as antigenic storage vault and carrier, thereby slowly released antigen prolongs the humoral immune reaction of inducing body, but shortcoming is only to induce the Th2 humoral immune reaction, and antibody is based on the IgG1 type, and no TCL reacts.Though oil adjuvant and Freund's complete adjuvant can obviously improve the immunne response ability, often occur untoward reaction in actual applications, as injection site swelling, pain, fever, or allergy etc. takes place, only for being used for the laboratory animal test.206 adjuvants are at present commercial efficient animal vaccine oil adjuvants, have been widely used in the animal vaccine, and it is reliable, effective and safe that practice confirms, but needs import, and price is higher.
Gene vaccine (gene vaccine) is the third generation vaccine that grows up along with gene therapy in recent years.It is after the coding proteic exogenous gene of a certain specific protective antigen and carrier for expression of eukaryon are recombinated; directly import in the animal body; utilize immunogen gene in host, to give expression to the immunne response that antigen protein causes body, to reach the purpose of prevention and treatment disease.Compare with conventional vaccine, gene vaccine has following advantage: good immune effect; It is malicious, pollution-free not loose; The protective immunity longer duration; Method is easy, cheap; Nucleic acid vaccine has identical physicochemical property, for combined immunization provides possibility; Be convenient to storage and transportation; Be not subjected to the influence of individual existing immunoreation (as maternal antibody).
The structural protein of ORF2 in the PRRSV genome～7 coding virus, wherein be used for the research of genetic immunization aspect more be ORF5, ORF3 and ORF4.It is reported that ORF5 has 6 antigenic determinants, one of them is in the serotype specificity linearity and determinant, can be in the infectivity of external neutralization virus, and this explanation ORF5 can induce the generation neutralizing antibody.Recently, Patrick etc.
[20]The neutralization and the anti-GP5 titre of proof virus are remarkable dependency again, in addition, Pirzadeh etc. report, carry out dna immunization with the plasmid that contains the ORF5 that encodes, can make the inoculation pig produce the specificity neutralizing antibody of anti-ORF5, the inoculation pig avoids general viremia and the pulmonary lesion that strong virus attack causes, and interstitial pneumonia and a gas, pipe alveolitis are obviously alleviated.Meulenberg etc. have identified a neutral zone in LV strain ORF4 encoded protein GP4, show that this protein induced antibody has neutralization.American scholar Molitor etc. prove again by experiment can carry out genetic immunization with the gene constructed genetic immunization plasmid that contains ORF5, ORF3.Because be used at present preventing the inactivated vaccine of system PRRS and the defective of the equal various degrees of attenuated vaccine, therefore utilizing biotechnology means development of new vaccine has been imperative to replace used conventional vaccine.New generation vaccine is to be core with the recombinant vaccine, mainly comprises nucleic acid vaccine, subunit vaccine, gene-deleted vaccine, live vector vaccine, synthetic peptide vaccine and anti-idiotype antibody vaccine etc.Though the gene order of PRRS virus is all measured, but the function of its pathogenesis and virus structural protein is still not fully aware of, so this has brought numerous difficulties for the development of primary disease new generation vaccine undoubtedly, however, external now existing many scholars are devoted to the research of this respect, meanwhile, domestic scholars also over against its be in try to explore among.The immune effect that how further to improve traditional vaccine is the direction of effort from now on.The application of efficient immunostimulant can improve the whole immune level of body comprehensively, strengthens disease-resistant defence and immunne response ability, improves the vaccine protective rate.Wherein, the research of CpG-ODN (CpG oligodeoxynucleotide) is focus wherein.The CpG sequence has been proved can be as the efficient immunostimulant of vaccine, uses properly can increase substantially the immune protective rate of vaccine and the immune level of body.Recently a large amount of immunologys studies confirm that: the dna molecular that contains the CpG sequence has following immune effect: (1) induces B cell proliferation, differentiation, maturation and immunoglobulin,exocrine; (2) the anti-apoptosis that induces; (3) induce mononuclear cell secretion IL-12 and other cytokines; (4) lytic activity of activation NKT (NK) cell and interferon (IFN-γ) secretion.
The great eqpidemic disease of current pig industry take place and popular more sophisticated situation---old complaint does not eliminate, new disease rises again, epidemic situation is continuous, this just requires us must use new scientific theory and production technology to develop pig with the prevention of safety, efficient vaccine with control the generation of various eqpidemic diseases and popular, and the adjuvant development is the key component of vaccine research.
3, summary of the invention
The preparation method that the purpose of this invention is to provide a kind of new gene adjuvant for the use of pig immune vaccine, promptly a kind of preparation method that contains the PRRSV ORF5 gene nucleic acid vaccine of CpG sequence.
The superiority of gene adjuvant of the present invention has: 1) at the needed dna molecular of host's expression in vivo, near the natural molecule structure, active unaffected on conformation; 2) once give to hang down scale for a long time on a small quantity and reach, need not multiple dosing; 3) preparation is simple, and quality is easy to control, and easily large-scale production is with low cost, is easy to storage and transport; 4) safety is good.Cytokine is the immune modulatory molecules that itself exists in the body, and human body is had no side effect, and also is subjected to the control of immunity of organism regulating networks simultaneously; 5) be easy to make up and transform.Utilize the operation of Protocols in Molecular Biology, realize desired immune response strength and type at gene level.
Show that through relevant experiment gene adjuvant of the present invention has can make low replying or no response and reply infull vaccine and produce effective immunoreactive effect.
The preparation method of the PRRSV ORF5 gene nucleic acid vaccine of the CpG of containing sequence of the present invention comprises the steps:
(1) selects the CpG-ODN aligning primer for use
A：5’-CTCAT
CGATCCTAT
CGATCCTAT
CGATCCTAT
CGATCCTAT
CGATCCTAT
CGATGGGCC-3’
B：5’-CATCGATAGGATCGATAGGATCGATAGGATCGATAGGATCGATAGGATCGATGAGGGCC-3’
(annotate: 1, Apa I restriction endonuclease sites is contained at two ends, connects for the clone and uses; The line part needs thio-modification; 2, A and B are synthetic with the primer form, more than the synthetic PAGE 2.0OD)
(2) adopt the genetic engineering recombinant technique, select the suitable restriction enzyme site that contains, genes of interest and CpG-ODN sequence clone are gone into eukaryotic expression vector pVAX1;
(3) recombinant plasmid vector with step (2) gained transforms the prokaryotic hosts bacterium, selects positive colony, and order-checking is carried out amplification cultivation after identifying again;
(4) recombinant plasmid dna of a large amount of extractions and purification genes of interest.
(5) immunogenic detection
(6) animal experiment
Concrete steps are as follows:
1) pcr amplification ORF5 gene
The primer of design amplification ORF5 gene is:
P5s：5’-AATCTA
GCTAGCCGCCACCATGTTGGA-3’，
P5r：5’-GC
GCGGCCGCTCACTGGCGTGTAG-3’。
For ease of the clone, Nhe I restriction enzyme site and Not I restriction enzyme site in forward primer and downstream primer, have been added respectively.
With plasmid pIRES-ORF5ORF6 is amplification template, amplification ORF5 gene, and reaction system is as follows: 10 * PCR buffer, 5 μ l; DNTP Mixture 4 μ l; P5s 2 μ l; P5r 2 μ l; Template 2 μ l; Ex Taq E 0.5 μ l; Use ddH
2O mends to 50 μ l.Amplification condition: pre-degeneration: 95 ℃ of 5min; Degeneration: 94 ℃ of 1min annealing: 50 ℃ of 1min extend: 72 ℃ of 1min are the final 72 ℃ of 10min of extension of totally 30 Cycles.
2) structure of pVAX1-ORF5 carrier
With restricted enzyme NotI/Nhe I digestion PCR purified product and pVAX1, obtain ORF5 genetic fragment and linear carrier pVAX1 respectively, with product 10g/L agarose gel electrophoresis, give birth to worker's glue recovery test kit description according to Shanghai and carry out.Connect, transform, choose bacterium, upgrading grain, identify with restricted enzyme NotI/NheI.
3) CpG-pVAX1-ORF5 construction of recombinant plasmid
Synthetic two CpG aligning primer A, B are pressed 1: 1 mixed in 95 ℃ of heating 5min, be placed on the room temperature cooling, annealing 2h obtains CpG-ODN weak point sequence.With restriction enzyme A paI digested plasmid pVAX1-ORF5, with pVAX1-ORF5 and CpG-ODN in 1: 3 ratio be connected, transform, choose bacterium, plasmid is carried for a short time, is identified with restricted enzyme NotI/NheI.The bacterium sample that will contain the CpG-pVAX1-ORF5 recombiant plasmid is sent to associating gene company limited biotech firm, carries out sequencing with the full-automatic sequenator of Thermol Cyling.
4) purification of recombiant plasmid and transfectional cell
The a large amount of preparations and the purification of plasmid carry out according to a conventional method, are dissolved among the TE (pH 8.0), measure plasmid DNA purity, are stored in-20 ℃.Plasmid DNA quantitatively: with TE (pH 8.0) be blank, and the nucleic acid solution optical density (OD) of measuring wavelength 260nm and 280nm with the TZK-800Z ultraviolet spectrophotometer is worth.With the MEM culture medium that contains 10% calf serum, at 37 ℃, cultivate the COS-7 cell under the condition of 5%CO2, treat that cell grows to exponential phase plasmid transfection cell.Adopt liposome method: by specification carries out, and sets up the empty carrier matched group.
5) RT-PCR detects ORF5 gene transcription situation: collect the cell of screening back stably express, extract cell total rna according to a conventional method, use primer P5s and P5r amplification after reverse transcription.
6) indirect immunofluorescence experiment (IFA)
Plasmid transfection there is on the slide of 70%COS-7 cell monolayer 5%CO to long
2, 37 ℃ cultivate after three days, take out slide, with PBS liquid flushing three times, 100% cold acetone is fixed 15～30min, reuse PBS liquid washing three times; With containing 5%BSA sealing 2h, wash each 5min three times; Add one anti-(the anti-PRRSV serum of pig), behind 37 ℃ of effect 2h, wash 3 times; Add two anti-(the anti-pig IgGs of fluorescein isothiocyanate labelled goat), room temperature lucifuge effect 1h washes 3 times; Blot, Dropwise 5 0% glycerine water solution is inverted on the microscope slide, and fluorescence microscope is observed down.
7) immune animal
6 the week ages female SPF kunming mice, body weight 18～26g purchases the Experimental Animal Center in Qingdao medicine inspecting institute.Immunity female SPF kunming mice in 6 age in week is got quantity and lymphocyte transformation experiment that splenocyte detects the t lymphocyte subset group.Adopt indirect ELISA method to measure the variation of anti-PRRSV antibody horizontal in the mice serum respectively.Whole serum are all done 1: 40 times of dilution, survey the OD value at last.
4 ages in week, long white piglet detected its PRRS negative antibody through ELISA.Be divided into 5 groups at random, 5 every group, press following five groups of immunity: (A) normal control group (injecting normal saline); (B) empty carrier PVAX1 group; (C) PVAX1-E group; (D) CpG-pVAX1-E group; (E) inactivated vaccine group; B, C, D experimental group dosage only are 800ug/, use preceding mix homogeneously, intramuscular injection, immunity three times, 21 days at interval; Normal control group injection 1ml normal saline, the inoculation of inactivated vaccine group (E group) by specification.Around behind back 10 days of each immunity and the counteracting toxic substances, take a blood sample, separation of serum ,-20 ℃ of preservations are standby.
8) animal experiment:
Carry out lymphocyte transformation test (mtt assay) respectively, detect pig peripheral blood antibody horizontal with the IDEXX test kit, detect the content of IL-2 with the detection by quantitative test kit of IL-2, the RT-PCR of PRRSV detects in the pig body, 4 weeks were slaughtered pig behind the counteracting toxic substances, got histoorgans such as lungs, liver, spleen, tonsil, inguinal lymph nodes, mesenteric lymph node, shoulder ALN, heart, kidney, cerebral tissue, duodenum and observed pathological change.
9) result of the test:
1) become the CpG-pVAX1-ORF5 recombiant plasmid by design construction cleverly, correct through checking order.In order to detect the immunogenicity of recombiant plasmid, with recombiant plasmid transfection COS-7 cell.The Cell sheet glass of handling well is placed observation under the fluorescence microscope, find to change on the Cell sheet glass that recombiant plasmid plasmid pVAX1-ORF5, CpG-pVAX1-ORF5 are arranged tangible yellow-green fluorescence is arranged, the position is in cytoplasm, and plasmid pVAX1 and the contrast of blank cell then do not have specificity fluorescent and occur.The specific amplification that cell by extracting the transfection plasmid and the total RNA of control cells carry out RT-PCR ORF5 genes of interest.The result shows, changes the ORF5 fragment that about 700bp that increases in plasmid pVAX1-ORF5 and the CpG-pVAX1-ORF5 cell is arranged, and amplified band do not occur with normal cell and change in the cell that pVAX1 is arranged, and proves that genes of interest transcribes in eukaryotic cell.
2) immunity female SPF kunming mice in 6 age in week is got quantity and lymphocyte transformation experiment that splenocyte detects the t lymphocyte subset group.Adopt indirect ELISA method to measure the variation of anti-PRRSV antibody horizontal in the mice serum respectively.Whole serum are all done 1: 40 times of dilution, survey the OD value at last.Its result shows: recombinant dna vaccine can induce body to produce the specificity anti antibody, and antibody horizontal is apparently higher than PBS group and pVAX1 group, significant difference, and pVAX1-ORF5 group and the resulting OD value of CpG-pVAX1-E experimental group are higher, some value can reach more than 0.1, and can obtain the highest OD value can reach 0.121 clearly also to find to exempt from the back blood sampling by experiment immunization group CpG-pVAX1-ORF5 group mice three simultaneously.
Detect 10000 cells with flow cytometer, the gained data are carried out statistical analysis (x ± SD is adopted in the description of data, relatively adopts non-paired t test between group).The result shows: compare with PBS matched group and empty plasmid pVAX1 matched group, significantly improve (p＜0.05) with t lymphocyte subset class CD4+ of each test group mice of constructed recombinant expression plasmid pVAX1-ORF5, CpG-pVAX1-ORF5 immunity and the quantity of CD8+, matched group CD4+ is up to 23.42, experimental group CD4+ is minimum then to reach 37.05, and matched group CD8+ is up to 11.98, and experimental group CD8+ is minimum to reach 15.09.And the spleen t lymphocyte subset class quantity with the CpG-pVAX1-ORF5 immune group in the experimental group is more, and CD4+ is 40.8, and CD8+ is 20.18.
Lymphocyte transformation description of test pVAX1-ORF5 group and CpG-pVAX1-E all can be in various degree the lymphocytic propagation of stimulation, but two group differences are not remarkable.Two exempt from the lymphocyte competence for added value and the matched group significant difference of back 10d pVAX1-ORF5 group and CpG-pVAX1-E group; The OD value of CpG-pVAX1-E group increases to some extent than the OD value of pVAX1-ORF5 group, but difference is not remarkable.Three exempt from lymphocyte competence for added value and the matched group and the pVAX1-ORF5 significant difference of back 10d CpG-pVAX1-E group, prove that CpG-ODN all can effectively stimulate lymphopoiesis as adjuvant.
Show by above mouse immune experimental result, behind the constructed CpG-pVAX1-ORF5 experimental group expression of nucleic acid plasmid inoculation mice, all can induce body to produce humoral immunization and cellular immunization in various degree.
3) for the CpG-ODN that the checks insertion immunological enhancement to pig, we have selected 25 of long white piglets in 4 ages in week, detect its PRRS negative antibody through ELISA.Be divided into 5 groups at random, 5 every group, press following five groups of immunity: (A) normal control group (injecting normal saline); (B) empty carrier PVAX1 group; (C) PVAX1-E group; (D) CpG-pVAX1-ORF5 group; (E) inactivated vaccine group; B, C, D experimental group dosage only are 800ug/, use preceding mix homogeneously, intramuscular injection, immunity three times, 21d at interval; Normal control group injection 1mL normal saline, the inoculation of inactivated vaccine group (E group) by specification.Around behind each immunity back 10d and the counteracting toxic substances, take a blood sample, separation of serum ,-20 ℃ of preservations are standby.In three exempt from 2 weeks of back to hog snout in inoculation PRRSVSD1 cytotoxic T CID
50=10
-5.5, dosage is every pig 2mL.Observe the clinical manifestation of pig behind the counteracting toxic substances.
Carry out lymphocyte transformation test (mtt assay) respectively, detect pig peripheral blood antibody horizontal with the IDEXX test kit, detect the content of IL-2 with the detection by quantitative test kit of IL-2, the RT-PCR of PRRSV detects in the pig body, 4 weeks were slaughtered pig behind the counteracting toxic substances, got histoorgans such as lungs, liver, spleen, tonsil, inguinal lymph nodes, mesenteric lymph node, shoulder ALN, heart, kidney, cerebral tissue, duodenum and observed pathological change.
The pig lymphocyte conversion test is the result show:
Respectively organize lymphocyte competence for added value difference not significantly (P〉0.05 time with) before the immunity; One immunity back 10dC group, D group, E group OD value all raise, OD value apparently higher than matched group, and significant difference (P＜0.05 time with), the lymphocytic increment of stimulation that CpG-pVAX1-ORF5 group, inactivated vaccine group all can be in various degree is described, but vaccine group and CpG-pVAX1-ORF5 group difference are not remarkable.The lymphocyte competence for added value and the matched group significant difference of CpG-pVAX1-ORF5 group and vaccine group; Two, three to exempt from the lymphocyte competence for added value difference of back CpG-pVAX1-ORF5 group and vaccine group not remarkable, but with matched group and pVAX1-ORF5 significant difference, thereby proof CpG-pVAX1-ORF5 all can effectively stimulate the lymphocyte increment as adjuvant.10d respectively organizes the OD value behind the counteracting toxic substances all in various degree decline, and the lymphocyte competence for added value difference of CpG-pVAX1-ORF5 group and vaccine group is not remarkable, but with matched group and pVAX1-ORF5 significant difference, show that CpG-ODN can prolong the protection period of vaccine; The CpG-ODN of CpG-pVAX1-ORF5 group is comparatively remarkable to the influence of lymphocyte competence for added value.
The immunity front and back are venous blood collection according to a conventional method, separation of serum, and the testing result of the antibody effect level of serum shows:
It is all negative respectively to organize antibody horizontal before exempting from, and difference is (P〉0.05 time with) not significantly, the Pass Test requirement.One exempt from, two exempt from the antibody horizontals of back 10d PVAX1-E group, CpG-pVAX1-ORF5 group, inactivated vaccine group apparently higher than normal control group (injecting normal saline), empty carrier PVAX1 group; CpG-pVAX1-ORF5 group, inactivated vaccine group and empty carrier pVAX1 matched group, normal saline normal control group antibody horizontal significant difference (P＜0.05 time same); Antibody horizontal difference between CpG-pVAX1-ORF5 group, inactivated vaccine group is not remarkable.Three exempt from back 10d respectively organizes the equal decrease to some degree of antibody horizontal, but the antibody horizontal of vaccine group is faster than CpG-pVAX1-ORF5 group decrease speed, with the matched group significant difference; CpG-pVAX1-ORF5 group and empty carrier PVAX1 group antibody horizontal significant difference, and not remarkable with inactivated vaccine group vaccine+CpG1 group difference.10d behind the counteracting toxic substances, the antibody horizontal of PVAX1-ORF5 group, CpG-pVAX1-ORF5 group, inactivated vaccine group descends, and the downward trend of inactivated vaccine group proves that faster than CpG-pVAX1-ORF5 the CpG among the CpG-pVAX1-ORF5 can delay the reduction of antibody horizontal.
Testing result to IL-2 concentration shows: one exempt from, two exempt from the IL-2 levels of back 10d PVAX1-E group, CpG-pVAX1-ORF5 group, inactivated vaccine group apparently higher than normal control group (injecting normal saline), empty carrier PVAX1 group; CpG-pVAX1-ORF5 group, inactivated vaccine group and empty carrier pVAX1 matched group, normal saline normal control group IL-2 level difference be (P＜0.05 time same) significantly; IL-2 level difference between CpG-pVAX1-ORF5 group, inactivated vaccine group is not remarkable.
The serum in 4 weeks behind 2 weeks and the counteracting toxic substances before getting counteracting toxic substances, behind the counteracting toxic substances uses primer at PRRSV SD1 strain ORF5 to carrying out RT-PCR, detects the viremia in the serum.Testing result shows: the RT-PCR of all porcine blood serums reaction is all negative before the counteracting toxic substances.Normal control group (injecting normal saline) behind the counteracting toxic substances, empty carrier PVAX1 group are all positive, and reaction is stronger; The CpG-pVAX1-ORF5 group had 1 pig RT-PCR result negative behind counteracting toxic substances in 4 weeks, and the accumulative total positive rate of viremia is 20%, has reduced 20% than pPVAX1-ORF5 recombiant plasmid group; Vaccine group is 4 all pigs performance RT-PCR reacting positives behind counteracting toxic substances, and the accumulative total positive rate of viremia is 40%, but a little less than the reaction.The detection that 4 weeks carried out behind 2 weeks and counteracting toxic substances behind the counteracting toxic substances of all the other pigs is all positive.Testing result shows that CpG-pVAX1-ORF5 can partly suppress the appearance of viremia.
The pathological change in 4 weeks behind the immune swine counteracting toxic substances: counteracting toxic substances after 3 immunity, and behind counteracting toxic substances, 4 weeks pig was slaughtered.Cut open inspection and find, behind the counteracting toxic substances, immune swine attacks that slight bleeding (1/5) appears in lungs, mesenteric lymph node is hemorrhage and extremely enlargement (1/5), inguinal lymph nodes hemorrhage (3/5) and kidney hemorrhage (1/5); Shoulder ALN of normal saline group hemorrhage (3/5) and duodenal hemorrhage (2/5); PVAX1-E group group shoulder ALN hemorrhage (1/5); CpG-pVAX1-ORF5 group organize no abnormality seen.The result shows, after the DNA recombiant plasmid immunity of eukaryon expression plasmid CpG-pVAX1-ORF5 group, the pathological change of pig is alleviated.Result of study shows that also inoculation PRRSV SD1CpG-pVAX1-ORF5 group can resist the per nasal counteracting toxic substances effectively, can protect the slight viremia of pig, does not also show clinical symptoms, can provide the part protection to the infringement of lung.The adding of CpG can make the pathological changes of immune swine alleviate or disappear.
Insertion sequencing fragment result in the CpG-pVAX1-ORF5 recombiant plasmid is as follows:
TTTAACTTAAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCTGCAGATATCC
AGCACAGTGGCGGCCGCGCCACAACCCGGGATCC
GCTAGCCGCCACCATGTTGGAGAAATGCTT
GACCGCGGGCCGTTGCTCGCGATTGCTTTCTTTGTGGTGTATCGTGCCGTTCTGTTTTGCTGTGCT
CGCCAACGCCAGCAACGACAGCAGCTCCCATCTACAGCTGATTTACAACTTGACGCTATGTGAGC
TGAATGGCACAGATTGGCTGGCTAACAAATTTGATTGGGCAGTGGAGAGTTTTGTCATCTTTCCCG
TTTTGACTCACATTGTCTCCTATGGTGCCCTCACTACCAGCCATTTCCTTGACACAGTCGCTTTAGT
CACTGTGTCTACCGCCGGGTTTGTTCACGGGCGGTATGTCCTAAGTAGCATCTACGCGGTCTGTG
CCCTGGCTGCGTTGACTTGCTTCGTCATTAGGTTTGCAAAGAATTGCATGTCCTGGCGCTACGCGT
GTACCAGATATACCAACTTTCTTCTGGACACTAAGGGCGGACTCTATCGTTGGCGGTCGCCTGTCA
TCATAGAGAAAAGGGGCAAAGTTGAGGTCGAAGGTCATCTGATCGACCTCAAAAGAGTTGTGCTT
GATGGTTCCGTGGCAACCCCTATAACCAGAGTTTCAGCGGAACAATGGGGTCGTCCTTAGATGAC
TTCTGTCATGATAGCACGGCTCCACAAAAGGTGCTTTTGGCGTTTTCTATTACC
TACACGCCAGTG
AGCGGCCGGTTCCCTTTAGTGAGTCGAGTCTAGAGGGCC
CTCATCGATCCTATCGATCCTATCGA
TCCTATCGATCCTATCGATCCTATCGATGGGCCCGTTTAAACCCGCTGATCAGCCTCGACTGTGCC
TTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCAC
TCCCACTGTCCTT
Mark line letter is the upstream and downstream primer of ORF5 gene, is O RF5 gene order between the primer; Italic line letter part
The testing result of antibody titer is as follows:
Annotate: the not remarkable P of expression difference that has same letter 0.05; Expression significant difference P＜0.05 that has different letters
SEQUENCE?LISTING
＜110〉Institute of Animal Science and Veterinary Medicine, Shandong Academy of Agricul
＜120〉a kind of preparation method that contains the PRRSV ORF5 gene nucleic acid vaccine of CpG sequence
<160>5
<170>PatentIn?version?3.3
<210>1
<211>59
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>1
<210>2
<211>59
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>2
<210>3
<211>27
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>3
<210>4
<211>24
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>4
<210>5
<211>997
<212>DNA
＜213〉artificial sequence
<220>
＜223〉recombiant plasmid
<400>5
Claims (1)
1, a kind of preparation method that contains the PRRSV ORF5 gene nucleic acid vaccine of CpG sequence is characterized in that preparation process is as follows:
1) selects the CpG-ODN aligning primer for use
A：5’-CTCAT
CGATCCTAT
CGATCCAT
CGATCCTAT
CGATCCTAT
CGATCCTAT
CGATGGGCC-3’
B：5’-CATCGATAGGATCGATAGGATCGATAGGATCGATAGGATCGATAGGATCGATGAGGGCC-3’
2) pcr amplification ORF5 gene
The primer of design amplification ORF5 gene is:
P5s：5’-AATCTA
GCTAGCCGCCACCATGTTGGA-3’，
P5r：5’-GC
GCGGCCGCTCACTGGCGTGTAG-3’；
For ease of the clone, NheI restriction enzyme site and NotI restriction enzyme site in forward primer and downstream primer, have been added respectively;
With plasmid pIRES-ORF5ORF6 is amplification template, amplification ORF5 gene, and reaction system is as follows: 10 * PCR buffer, 5 μ l; DNTP Mixture4 μ l; P5s 2 μ l; P5r 2 μ l; Template 2 μ l; Ex Taq E 0.5 μ l; Use ddH
2O mends to 50 μ l; Amplification condition: pre-degeneration: 95 ℃ of 5min; Degeneration: 94 ℃ of 1min annealing: 50 ℃ of 1min extend: 72 ℃ of 1min are the final 72 ℃ of 10min of extension of totally 30 Cycles;
3) structure of pVAX1-ORF5 carrier
With restricted enzyme NotI/Nhe I digestion PCR purified product and pVAX1, obtain ORF5 genetic fragment and linear carrier pVAX1 respectively, with product 10g/L agarose gel electrophoresis, give birth to worker's glue recovery test kit description according to Shanghai and carry out; Connect, transform, choose bacterium, upgrading grain, identify with restricted enzyme NotI/NheI;
4) CpG-pVAX1-ORF5 construction of recombinant plasmid
Synthetic two CpG aligning primer A, B are pressed the 1:1 mixed in 95 ℃ of heating 5min, be placed on the room temperature cooling, annealing 2h obtains the short sequence of CpG-ODN; With restriction enzyme A paI digested plasmid pVAX1-ORF5, with pVAX1-ORF5 and CpG-ODN in 1: 3 ratio be connected, transform, choose bacterium, plasmid is carried for a short time, is identified with restricted enzyme NotI/Nhe I; The bacterium sample that will contain the CpG-pVAX1-ORF5 recombiant plasmid is sent to associating gene company limited biotech firm, carries out sequencing with the full-automatic sequenator of Thermol Cyling;
5) purification of recombiant plasmid and transfectional cell
The a large amount of preparations and the purification of plasmid carry out according to a conventional method, are dissolved among the TE (pH8.0), measure plasmid DNA purity, are stored in-20 ℃; Plasmid DNA quantitatively: with TE (pH8.0) is blank, measure nucleic acid solution optical density (OD) value of wavelength 260nm and 280nm with the TZK-800Z ultraviolet spectrophotometer, with the MEM culture medium that contains 10% calf serum, at 37 ℃, cultivate the COS-7 cell under the condition of 5%CO2, treat that cell grows to exponential phase plasmid transfection cell; Adopt liposome method: by specification carries out, and sets up the empty carrier matched group;
6) RT-PCR detects ORF5 gene transcription situation: collect the cell of screening back stably express, extract cell total rna according to a conventional method, use primer P5s and P5r amplification after reverse transcription;
7) indirect immunofluorescence experiment (IFA)
Plasmid transfection there is on the slide of 70%COS-7 cell monolayer 5%CO to long
2, 37 ℃ cultivate after three days, take out slide, with PBS liquid flushing three times, 100% cold acetone is fixed 15～30min, reuse PBS liquid washing three times; With containing 5%BSA sealing 2h, wash each 5min three times; Add one anti-(the anti-PRRSV serum of pig), behind 37 ℃ of effect 2h, wash 3 times; Add two anti-(the anti-pig IgGs of fluorescein isothiocyanate labelled goat), room temperature lucifuge effect 1h washes 3 times; Blot, Dropwise 5 0% glycerine water solution is inverted on the microscope slide, and fluorescence microscope is observed down;
8) animal immune
6 the week ages female SPF kunming mice, body weight 18～26g purchases the Experimental Animal Center in Qingdao medicine inspecting institute; Immunity female SPF kunming mice in 6 age in week is got quantity and lymphocyte transformation experiment that splenocyte detects the t lymphocyte subset group; Adopt indirect ELISA method to measure the variation of anti-PRRSV antibody horizontal in the mice serum respectively; Whole serum are all done 1: 40 times of dilution, survey the OD value at last;
4 ages in week, long white piglet detected its PRRS negative antibody through ELISA; Be divided into 5 groups at random, 5 every group, press following five groups of immunity: (A) normal control group (injecting normal saline); (B) empty carrier PVAX1 group; (C) PVAX1-E group; (D) CpG-pVAX1-E group; (E) inactivated vaccine group; B, C, D experimental group dosage only are 800ug/, use preceding mix homogeneously, intramuscular injection, immunity three times, 21 days at interval; Normal control group injection 1ml normal saline, the inoculation of inactivated vaccine group (E group) by specification; Around behind back 10 days of each immunity and the counteracting toxic substances, take a blood sample, separation of serum ,-20 ℃ of preservations are standby;
9) animal experiment:
Carry out lymphocyte transformation test (mtt assay) respectively, detect pig peripheral blood antibody horizontal with the IDEXX test kit, detect the content of IL-2 with the detection by quantitative test kit of IL-2, the RT-PCR of PRRSV detects in the pig body, 4 weeks were slaughtered pig behind the counteracting toxic substances, got histoorgans such as lungs, liver, spleen, tonsil, inguinal lymph nodes, mesenteric lymph node, shoulder ALN, heart, kidney, cerebral tissue, duodenum and observed pathological change.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008100140618A CN101422608A (en) | 2008-01-23 | 2008-01-23 | Preparation method of PRRSV ORF5 gene nucleic acid vaccine containing CpG sequence |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008100140618A CN101422608A (en) | 2008-01-23 | 2008-01-23 | Preparation method of PRRSV ORF5 gene nucleic acid vaccine containing CpG sequence |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101422608A true CN101422608A (en) | 2009-05-06 |
Family
ID=40613639
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2008100140618A Pending CN101422608A (en) | 2008-01-23 | 2008-01-23 | Preparation method of PRRSV ORF5 gene nucleic acid vaccine containing CpG sequence |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101422608A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101846683A (en) * | 2010-06-22 | 2010-09-29 | 洛阳普莱柯生物工程有限公司 | Method for testing efficacy of swine fever live vaccine |
| CN102175853A (en) * | 2011-01-07 | 2011-09-07 | 北京大北农科技集团股份有限公司 | ELISA (enzyme linked immunosorbent assay) kit for detecting pig progenitive and respiratory syndrome (PRRS) antibody |
| CN112410344A (en) * | 2020-10-26 | 2021-02-26 | 中国科学院昆明动物研究所 | CpG-ODN with specific immunostimulation effect on PRRSV and application thereof |
| CN112891523A (en) * | 2021-03-25 | 2021-06-04 | 遵义医科大学 | Preparation and identification method of taenia solium Ts14-3-3.3 DNA vaccine |
-
2008
- 2008-01-23 CN CNA2008100140618A patent/CN101422608A/en active Pending
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101846683A (en) * | 2010-06-22 | 2010-09-29 | 洛阳普莱柯生物工程有限公司 | Method for testing efficacy of swine fever live vaccine |
| CN101846683B (en) * | 2010-06-22 | 2014-08-06 | 普莱柯生物工程股份有限公司 | Method for testing efficacy of swine fever live vaccine |
| CN102175853A (en) * | 2011-01-07 | 2011-09-07 | 北京大北农科技集团股份有限公司 | ELISA (enzyme linked immunosorbent assay) kit for detecting pig progenitive and respiratory syndrome (PRRS) antibody |
| CN112410344A (en) * | 2020-10-26 | 2021-02-26 | 中国科学院昆明动物研究所 | CpG-ODN with specific immunostimulation effect on PRRSV and application thereof |
| CN112410344B (en) * | 2020-10-26 | 2021-06-15 | 中国科学院昆明动物研究所 | CpG-ODN with specific immunostimulation effect on PRRSV and application thereof |
| CN112891523A (en) * | 2021-03-25 | 2021-06-04 | 遵义医科大学 | Preparation and identification method of taenia solium Ts14-3-3.3 DNA vaccine |
| CN112891523B (en) * | 2021-03-25 | 2023-07-04 | 遵义医科大学 | Preparation and identification method of taenia suis Ts14-3-3.3DNA vaccine |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103266091B (en) | A type foot-and-mouth disease recombinant vaccine strains and preparation method and application thereof | |
| Lee et al. | Omicron-specific mRNA vaccine induced potent neutralizing antibody against Omicron but not other SARS-CoV-2 variants | |
| CN107432930B (en) | Group I4 avian adenovirus DNA vaccine and preparation method and application thereof | |
| CN107184969A (en) | A kind of A types Sai Nika paddy viral inactivation vaccines and its preparation method and application | |
| Zhao et al. | Immersion vaccination of Mandarin fish Siniperca chuatsi against infectious spleen and kidney necrosis virus with a SWCNTs-based subunit vaccine | |
| Reyes et al. | A novel “in-feed” delivery platform applied for oral DNA vaccination against IPNV enables high protection in Atlantic salmon (Salmon salar) | |
| WO2022071513A1 (en) | IMPROVED DNA VACCINE FOR SARS-CoV-2 | |
| Zou et al. | Live attenuated vaccine based on duck enteritis virus against duck hepatitis A virus types 1 and 3 | |
| Bande et al. | Development and immunogenic potentials of chitosan-saponin encapsulated DNA vaccine against avian infectious bronchitis coronavirus | |
| Roque-Resendiz et al. | MVA ROP2 vaccinia virus recombinant as a vaccine candidate for toxoplasmosis | |
| CN105274142B (en) | 55 type adenovirus vector of science recombined human and its preparation method and application | |
| Wang et al. | Immune responses in mice vaccinated with a suicidal DNA vaccine expressing the hemagglutinin glycoprotein from the peste des petits ruminants virus | |
| CN101422608A (en) | Preparation method of PRRSV ORF5 gene nucleic acid vaccine containing CpG sequence | |
| Sun et al. | DNA immunization against very virulent infectious bursal disease virus with VP2‐4‐3 gene and chicken IL‐6 gene | |
| CN101392261B (en) | Modified highly pathogenic porcine reproductive and respiratory syndrome virus ORF5 gene and application | |
| CN106916832B (en) | O-type foot-and-mouth disease virus recombinant nucleic acid, recombinant vaccine strain, preparation method and application thereof | |
| CN105497885B (en) | A kind of subunit vaccine and its preparation method and application | |
| CN107029231A (en) | Recombined foot-and-mouth disease bivalent inactivated vaccine and its preparation method and application | |
| Yin et al. | Assembly of pseudorabies virus genome-based transfer vehicle carrying major antigen sites of S gene of transmissible gastroenteritis virus: potential perspective for developing live vector vaccines | |
| CN109517044B (en) | Porcine epidemic diarrhea virus genetic engineering antigen and antibody | |
| EP2571519B1 (en) | Marker vaccine for classical swine fever | |
| CN107041951A (en) | Recombined foot-and-mouth disease tervalence inactivated vaccine and its preparation method and application | |
| KR20130058706A (en) | Parapoxvirus expressing the vp60 major capsid protein of the rabbit haemorrhagic disease virus | |
| CN102247606A (en) | DNA (deoxyribonucleic acid) level-based highly pathogenic blue-eared pig disease JEV (Japanese encephalitis virus) replicon vaccine and application thereof | |
| CN116024244B (en) | Fusion protein gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20090506 |