CN102247606A

CN102247606A - DNA (deoxyribonucleic acid) level-based highly pathogenic blue-eared pig disease JEV (Japanese encephalitis virus) replicon vaccine and application thereof

Info

Publication number: CN102247606A
Application number: CN2011101356908A
Authority: CN
Inventors: 廖明; 陈孝明; 亓文宝; 臧富玉; 李红梅
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2011-05-25
Filing date: 2011-05-25
Publication date: 2011-11-23
Anticipated expiration: 2031-05-25
Also published as: CN102247606B

Abstract

The invention discloses a DNA (deoxyribonucleic acid) level-based highly pathogenic blue-eared pig disease JEV (Japanese encephalitis virus) replicon vaccine and an application thereof. In the invention, primer amplification is carried out to obtain GP5 and M genes of a highly pathogenic blue-eared pig disease virus XH strain, an FMDV-2A sequence is inserted between the two genes by utilizing a fusion PCR (polymer chain reaction) method to obtain a G-2A-M segment, and finally the G-2A-M segment is cloned into pJEV-REP by utilizing two restriction enzyme cutting sites SpeI and SalI; besides, an IRES (internal ribosome entry site) sequence (G-2A-M-IRES) is inserted into the downstream of the G-2A-M segment, thus M protein can produce a real N terminal; and the G-2A-M-IRES segment is inserted into the pJEV-REP by utilizing two restriction enzyme cutting sites SalI-HF and SpeI, and finally a highly pathogenic blue-eared pig disease vaccine which is based on a JEV replicon and can express GP5 and M proteins is constructed.

Description

A kind of high-pathogenicity porcine reproductive and respiratory syndrome virus JEV replicon vaccine and application thereof based on dna level

Technical field

The present invention relates to gene engineering technology field, be specifically related to a kind of high-pathogenicity porcine reproductive and respiratory syndrome virus JEV replicon vaccine and application thereof based on dna level.

Background technology

The PRRS vaccine of clinical practice at present has inactivated vaccine and attenuated live vaccine.Because the inactivated vaccine immune effect is undesirable, and attenuated live vaccine exists virulence to return strong probability.

Oneself becomes one of serious infectious diseases of serious harm pig industry current PRRS, and the immunity inoculation of vaccine is still prevention and the effective measures of control PRRS.Being used at present prevent the commercialized vaccine of PRRS mainly is weak malicious Seedling and inactivated vaccine, but because of there being the defective of potential safety hazard or immune effect difference, can not provide ideal immunoprotection.And be described as " vaccine revolution for the third time " dna vaccination be with the coding certain antigen protein gene place under the control of eukaryotic expression element, constitute recombinant expression plasmid DNA, directly import it in animal body, by host cell expression processing synthetic antigen molecule, thereby induce the host to produce immunne response to this antigen protein.Though dna vaccination possesses many advantages, potential safety hazard but big because of dosage of inoculation and existence and host genome reorganization is subjected to a lot of restrictions in development.Therefore, safer, the effective novel vaccine carrier of research is to prevention and the control generation of PRRS and popular significant.

Summary of the invention

The objective of the invention is to according to the deficiencies in the prior art, a kind of high-pathogenicity porcine reproductive and respiratory syndrome virus JEV replicon vaccine based on dna level is provided.

Another purpose of the present invention is to provide the construction method of above-mentioned high-pathogenicity porcine reproductive and respiratory syndrome virus JEV replicon vaccine based on dna level.

A further object of the invention is to provide the application of above-mentioned high-pathogenicity porcine reproductive and respiratory syndrome virus JEV replicon vaccine based on dna level.

Above-mentioned purpose of the present invention is achieved by the following technical programs:

A kind of high-pathogenicity porcine reproductive and respiratory syndrome virus JEV replicon vaccine based on dna level is based upon on the JEV replicon (pJEV-REP).Described JEV replicon system is to be skeleton with transformed low copy plasmid pOKM, under the situation of the most structural genes of disappearance (165-2402 nucleotide), make up the JEV replicon carrier system based on dna level of the proteic signal peptide of NS1 (E25), all non-structural proteins, 3 ' UTR, ribozyme (HDVr) and the polyA sequence of preceding 23 aminoacid (C23) comprise CMV promoter, 5 ' UTR, C albumen n end, E PROTEIN C end.

The construction method of above-mentioned JEV replicon system comprises the steps: to design primer, and its sequence is shown in SEQ ID NO:1 ~ 18, and amplified fragments A from plasmid pWF-GFP amplifies fragment B, C, D and fragment again from the geneome RNA of JEV

, be template with Segment A and B again, amplify fragment by the method that merges PCR

With fragment C and D is template, merges pcr amplification and goes out fragment

, with fragment , With

Directed cloning obtains the encephalitis b virus replicon carrier system based on dna level in low copy plasmid.

High-pathogenicity porcine reproductive and respiratory syndrome virus JEV replicon vaccine based on dna level of the present invention is that the structural gene GP5 of reproductive and respiratory syndrome and M albumen are inserted in the JEV replicon (pJEV-REP) based on dna level, comprises the proteic signal peptide of NS1, all non-structural protein coding regions, 3 ' UTR, ribozyme, polyA sequence, the GP5 protein-coding region of preceding 23 aminoacid (C23), the E PROTEIN C end of CMV promoter, 5 ' UTR, C albumen n end, sequence and the M protein-coding region of FMDV-2A.

The construction method of above-mentioned high-pathogenicity porcine reproductive and respiratory syndrome virus JEV replicon vaccine based on dna level comprises the steps: to design primer, its sequence is shown in SEQ ID NO:19 ~ 28, amplify the GP5 and the M gene of high-pathogenicity porcine reproductive and respiratory syndrome virus XH strain, utilize the method that merges PCR, in the middle of two genes, insert the sequence of FMDV-2A, thereby obtain the G-2A-M fragment, be cloned into JpJEV-REP by SpeI and two restriction enzyme sites of SalI at last; In addition, in order to make M albumen can produce real N-terminal, G-2A-M has inserted in segmental downstream IRES sequence (G-2A-M-IRES), utilize two restriction enzyme sites of SalI-HF and SpeI to be inserted among the pJEV-REP at last, finally make up based on the JEV replicon and can express GP5 and the proteic high-pathogenicity blue ear disease vaccine of M.

The nucleotide sequence of IRES is shown in SEQ ID NO:29.

The segmental nucleotide sequence of G-2A-M is shown in SEQ ID NO:30.

The above-mentioned high-pathogenicity porcine reproductive and respiratory syndrome virus JEV replicon based on dna level of the present invention can also can bring out specific antibody and cell immune response by effective expression, can be used as a kind of novel gene engineered vaccine of prevention highly pathogenic PRRS.

Compared with prior art, the present invention has following beneficial effect:

The ubiquitous blue-ear disease vaccine attenuated vaccine of existing market, but the shortcoming of attenuated live vaccine maximum is to exist virulence to return strong probability, and traditional recombinant vaccine expressing quantity is low, the relatively poor deficiency that waits of immunogenicity.And there is not live virus in the replicon vaccine of the present invention's research and development, therefore do not exist virus virulence to return strong probability, in addition, the present invention has proved also with traditional dna vaccination and has compared that vaccine of the present invention can produce higher antibody and stronger lymphproliferation response.

Description of drawings

Fig. 1 is the design of graphics based on the pig high-pathogenicity blue ear disease vaccine of JEV replicon carrier, and wherein, A is JEV-REP-G-2A-M-IRES; B is pJEV-REP-G-2A-M;

Fig. 2 is GP5 gene, M gene and the amplified production that merges PCR thereof; Wherein, 1 is DNA Marker DL2,000; 2 is GP5 gene PCR fragment; 3 is M gene PCR fragment; 4 is the G-2A-M fragment; 5 is the G-2A-MR fragment; 6 is IRES sequence PCR fragment; 7 is the G-2A-M-IRES fragment;

Fig. 3 is that the enzyme action of each recombiant plasmid is identified; Wherein, 1 is λ-EcoT14 I digest Marker; 2 is DNA Marker DL2,000; 3 is pJEV-REP-G-2A-M-IRES(SalI/SpeI); 4 is pJEV-REP-G-2A-M(SalI/SpeI); 5 is pJEV-REP-GFP(SalI/SpeI); 6 is pJEV-REP-IRES(SalI/SpeI); 7 is pCAGGS-GM(EcoRI and XhoI);

Fig. 4 is for expressing the Western blot testing result of the proteic three groups of recombiant plasmid of GP5/M; Wherein, 1 is pageRuler Prestained Protein Ladder; 2 is pJEV-REP-G-2A-M-IRES; 3 is pJEV-REP-G-2A-M; 4 is pCAGGS-GM; 5 is the 293T cell;

Fig. 5 is the IFA result (* 400) of three groups of pJEV-REP recombiant plasmid transfection 293T cell 48h; Wherein, A is a pJEV-REP-G-2A-M-IRES transfection 293T cell; B is a pJEV-REP-IRES transfection 293T cell; C is a pJEV-REP-G-2A-M transfection 293T cell; D is the 293T cell;

Fig. 6 is the growth curve of immune serum antibody;

Fig. 7 is the spleen lymphocyte specificity multiplication reaction of different vaccine immune mouses.

The specific embodiment

Further explain the present invention below in conjunction with embodiment, but embodiment does not do any type of qualification to the present invention.

Material: the PRRSV-XH strain is opened the osmanthus Red Sect of Lamaism by Ministry of Agriculture animal epidemic prevention and control emphasis open laboratory and is awarded and be so kind as to give; The Mac145 cell is provided by Ministry of Agriculture animal epidemic prevention and control emphasis open laboratory; The SPF level BALB/c female mice in 8 ages in week is available from Guangdong Province's Experimental Animal Center.

Embodiment 1 Make up pig high-pathogenicity blue ear disease replicon vaccine

1. make up the design (structure chart such as Fig. 1) of pig high-pathogenicity blue ear disease replicon vaccine

By the primer (shown in SEQ ID NO:19 ~ 29) that designs voluntarily, reverse transcription product with HP PRRS gene RNA is a template, primer GP5F and GP5R-FMDV2A-R can amplify the complete coding region of GP5 gene and preceding 45 bases of 2A sequence, and the result amplifies size and is the 648bp specific fragment; Primer MF-FMDVF2A-F and MR-SalI then can amplify back 45 bases of 2A sequence and the complete coding region of M gene, amplify 570bp.In addition, primer GP5F and MR-SalI amplify about 1 by the method that merges PCR, the G-2A-M fragment of 200bp.Be template with the G-2A-M fragment simultaneously, it is about 1 to be with GP5F and MR that primer amplification goes out, and the G-2A-MR fragment of 200bp is a primer with IRES1F and IRES-588R again, is the IRES sequence that template amplification goes out 588bp with pIRES1-neo.Then utilize G-2A-MR fragment and IRES to be template, with GP5F and IRES-588R is that the primer fusion amplifies about 1, the G-2A-M-IRES specific fragment of 800bp, utilize two restriction enzyme sites of SalI-HF and SpeI to be inserted among the pJEV-REP at last, finally make up based on the JEV replicon and can express GP5 and the proteic high-pathogenicity blue ear disease vaccine of M (as Fig. 2).

2. the structure of eukaryon expression plasmid

With GP5-EcoRI and MR-XhoI is primer, and the method that is template by PCR with plasmid pJEV-REP-G-2A-M amplifies the G-2A-M-EX fragment.Then the G-2A-M-EX fragment is digested with restricted enzyme EcoRI and XhoI respectively with carrier for expression of eukaryon pCAGGS and be connected the acquisition that product is directly used in conversion and recombiant plasmid, called after pCAGGS-GM(such as Fig. 2).

3. the enzyme action of each recombiant plasmid is identified

Recombiant plasmid pCAGGS-GM carries out enzyme action with EcoRI and XhoI to be identified, three recombiant plasmid of pJEV-REP-G-2A-M-IRES, pJEV-REP-G-2A-M and pJEV-REP-IRES then all carry out enzyme action with SalI and SpeI and identify (as Fig. 3).

Embodiment 2 chemiluminescence method Western-blot detect GP5 albumen and M protein expression

GP5 and proteic plasmid of M (pJEV-REP-G-2A-M and pJEV-REP-G-2A-M-IRES) and eukaryon expression plasmid (pCAGGS-GM) difference transfection 293T cell with coexpression PRRSV, collecting cell behind the transfection 48h, behind the recombiant plasmid transfection 48h, harvesting, PBS washes 2 times, an amount of PBS is resuspended, adds 2 * SDS sample-loading buffer, boiling water bath effect 10min.Prepare 12% SDS-polyacrylamide gel (PAGE), by every hole 20 μ l point samples, and under 80V/0.5h and 120V/1.5h condition electrophoresis.Electrophoresis is transferred to albumen on the nitrocellulose membrane under the 17V/10min condition on half-dried electric transfer printing instrument after finishing.After finishing, transfer washes film 5min, 37 ℃ of sealings of 5% skimmed milk 1h with 1 * PBS.With 4 ℃ of overnight incubation of anti-GP5 albumen and anti-M protein-specific monoclonal antibody chamber, PBST washes 3 times, every all over 5min, the sheep anti mouse fluorescence two anti-1:7 that do with IRDye 800 labellings, add together after 500 dilutions, hatch 1h on the room temperature shaking table, PBST washes film 3 times, each 5min, scan with Odyssey Infrared fluorescence scanning imaging system, found that, three kinds of transfections the 293T cell of plasmid at 43KD specific band appears all, show that the proteic expression of GP5 and M is that form with the GP5/M heterodimer exists (see figure 4), show that these several recombiant plasmid all can correctly express destination protein behind transfectional cell.

Embodiment 3 indirect immunofluorescences detect the expression of JEV non-structural protein

Behind the GP5 and the proteic JEV replicon of M plasmid (pJEV-REP-G-2A-M and pJEV-REP-G-2A-M-IRES) and vehicle Control plasmid (pJEV-REP-IRES) difference transfection 293T cell 48h with coexpression PRRSV, detect three kinds of JEV replicon recombiant plasmid with IIF method and all can express JEV NS1 albumen (see figure 5).

The detection of embodiment 4 immune serum specific antibodies

The SPF level BALB/c female mice in 60 8 ages in week is divided into 5 groups, every group 12, difference immune pJEV-REP-G-2A-M-IRES, pJEV-REP-IRES, pJEV-REP-G-2A-M, pCAGGS-GM and PBS, immunizing dose is 100 μ L/, each 50 μ L of every side, immunity is 3 times altogether, every 3 all immunity once.

Gather the immunity immune serum in 0,2,4,6,8 and 10 weeks of back, detect (ELIAS secondary antibody of wherein ELIAS secondary antibody of pig being replaced by mice) with pig blue-ear disease ELISA detection kit.Key step is as follows: 1:100 dilutes mice serum to be checked, gets the plate of pre-bag quilt, and every hole adds 100 μ L serum to be checked, puts 37 ℃ of incubation 30min; 300 μ L/ hole cleaning mixture are washed plate 4 times, leave standstill 3min at every turn; Mus ELIAS secondary antibody (1:7,500 dilutions) the 100 μ L that every hole adds NBL company put 37 ℃ of incubation 60min; Wash 4 times, method is the same; Every hole adds substrate A liquid and each 50 μ L of B liquid, room temperature lucifuge colour developing 10min; Every hole adds stop buffer 50 μ L, measures the OD value (see figure 6) in each hole in 10 min with microplate reader 630nm wavelength.As can be seen from the figure immune group is exempted from then two weeks to begin to detect specific antibody one, two exempt from back pJEV-REP-G-2A-M compares the matched group antibody horizontal and begins to increase with the pJEV-REP-G-2A-M-IRES immune group, and exempt from back two weeks (8 week) three groups of vaccine group three and all reach the peak of antibody, this moment pJEV-REP-G-2A-M(OD630=0.73 ± 0.09) and pJEV-REP-G-2A-M-IRES(OD630=0.71 ± 0.08) immune group is than pCAGGS-GM(OD630=0.59 ± 0.11) the higher antibody of dna vaccination immune group generation.The result shows that the replicon vaccine can produce higher antibody horizontal than dna vaccination.

The specificity lymphopoiesis level of embodiment 5 immune mouses

Three exempt from the back carried out lymphocyte proliferation assay in two weeks.At first put to death mice, be soaked in 75% the ethanol with the eyeball blood collection method; In super-clean bench, take out mouse spleen and place the 35mm culture dish, note the sterile working; In culture dish, add 4-5 mL lymphocyte separation medium.With syringe spleen is chosen into fragment, grind with the piston of syringe down in 200 purpose screen clothes then, blow and beat into the individual cells suspension then; There is the separating medium of spleen cell to transfer to immediately in the 15mL centrifuge tube outstanding then, covers 1640 culture medium of 200-500 μ L, keep the liquid level boundary obviously; Room temperature, the centrifugal 30min of 800g; Next the sucking-off buffy coat adds 10 mL1640 culture medium again, puts upside down washing.Room temperature, the centrifugal 10min collecting cell of 250g; Topple over supernatant at last,, use 1640 complete mediums then cell dilution to 1 * 10 with 1640 culture medium re-suspended cells, cell counting ⁶Individual/mL.The lymphocyte suspension of above-mentioned preparation is suspended to the RPMI1640 complete medium after centrifugal, is added to the flat Tissue Culture Plate in 96 holes (1 * 105/hole) then, every hole adds the cell suspension of 100 μ L.The PRRSV (1 μ g), the contrast of Mac145 ghost or the RPMI1640 complete medium that add equal volume again.Culture plate is after 37 ℃ of constant incubators that contain 5% CO2 are cultivated 84h, and every hole adds 10 μ L CCK-8 reagent, continues to cultivate 3h behind the mixing, and detecting wavelength with microplate reader then is the optical density value of 450 nm.Each sample is established three repetitions, and the calculating stimulation index (Stimulation Index, SI).SI=PRRSV stimulates the average optical degree value OD450nm/Mac145 ghost control wells density degree value OD450nm in hole.Splenocyte adds WST-8 solution after adding PRRSV stimulation cultivation 80h, judges living cells quantity.The amount of living cells shows by the OD450nm of sample, according to the OD450nm of PRRSV stimulating group and ghost matched group calculate stimulation index (Stimulation Index, thus SI) judge the propagation level.Experimental result shows that the SI of (see figure 7) pJEV-REP-G-2A-M (SI=1.804 ± 0.175) and pJEV-REP-G-2A-M-IRES (SI=1.853 ± 0.254) immune group is apparently higher than pJEV-REP-IRES(SI=1.155 ± 0.037) empty carrier immune group (p＜0.01); Dna vaccination group (pCAGGS-GM) SI index (SI=1.54 ± 0.10) is also apparently higher than PBS matched group (p＜0.01), but the propagation level is lower than other two groups of replicon vaccine group.

SEQUENCE?LISTING

＜110〉Agricultural University Of South China

＜120〉a kind of high-pathogenicity porcine reproductive and respiratory syndrome virus JEV replicon vaccine and application thereof based on dna level

<130>

<160> 29

<170> PatentIn?version?3.2

<210> 1

<211> 40

<212> DNA

<213> PCMVp1

<400> 1

tttttggcgg?ccgctagtta?ttaatagtaa?tcaattacgg 40

<210> 2

<211> 44

<212> DNA

<213> PCMVP1L

<400> 2

tttttggcgg?ccgctagtta?ttaatagtaa?tcaattacgg?ggtc 44

<210> 3

<211> 47

<212> DNA

<213> PJEV164olR

<400> 3

ctcggtcgac?ggtggtaaca?ctagtgcggg?gtaggccgcg?tttcagc 47

<210> 4

<211> 43

<212> DNA

<213> PJEV2403olF

<400> 4

actagtgtta?ccaccgtcga?ccgagaccga?tcaattgctt?tgg 43

<210> 5

<211> 20

<212> DNA

<213> PJEVC5706R

<400> 5

ttacgctcgc?cacaaaccac 20

<210> 6

<211> 20

<212> DNA

<213> CJEV-5557F

<400> 6

cgaccccgcc?tggaaccacg 20

<210> 7

<211> 25

<212> DNA

<213> CJEV-9155R

<400> 7

gaaccccaaa?gcttcaaact?ctaga 25

<210> 8

<211> 25

<212> DNA

<213> pJEV9117F

<400> 8

cttggagcac?ggtatctaga?gtttg 25

<210> 9

<211> 24

<212> DNA

<213> pJEV10976R

<400> 9

agatcctgtg?ttcttcctca?ccac 24

<210> 10

<211> 25

<212> DNA

<213> pJEV10395F

<400> 10

tgtgatttaa?ggtagaaaag?tagac 25

<210> 11

<211> 36

<212> DNA

<213> SPAP2L

<400> 11

cgaggtacct?accacatttg?tagaggtttt?acttgc 36

<210> 12

<211> 29

<212> DNA

<213> GFP1F

<400> 12

ccgcactagt?atggtgagca?agggcgagg 29

<210> 13

<211> 30

<212> DNA

<213> GFP717R

<400> 13

ctcggtcgac?cttgtacagc?tcgtccatgc 30

<210> 14

<211> 42

<212> DNA

<213> EGFP720Rol

<400> 14

gggggaggga?gaggggcgtt?acttgtacag?ctcgtccatg?cc 42

<210> 15

<211> 18

<212> DNA

<213> IRES?1F

<400> 15

cgcccctctc?cctccccc 18

<210> 16

<211> 38

<212> DNA

<213> IRES?588R

<400> 16

ctcggtcgac?catgttgtgg?caagcttatc?atcgtgtt 38

<210> 17

<211> 22

<212> DNA

<213> 2403F

<400> 17

cgagaccgat?caattgcttt?gg 22

<210> 18

<211> 27

<212> DNA

<213> 2609R

<400> 18

cttcgctagg?gatctgggcg?tttctgg 27

<210> 19

<211> 35

<212> DNA

<213> GP5F

<400> 19

ccgcactagt?atgttgggga?agtgcttgac?cgcgt 35

<210> 20

<211> 67

<212> DNA

<213> GP5R-FMDV2A-R

<400> 20

ctcaacgtct?cccgccaact?tgaggaggtc?gaagttcaga?agctggagac?gaccccattg 60

ttctgct 67

<210> 21

<211> 65

<212> DNA

<213> MF-FMDVF2A-F

<400> 21

gacctcctca?agttggcggg?agacgttgag?tccaaccctg?ggcctatggg?gtcgtctcta 60

gacga 65

<210> 22

<211> 49

<212> DNA

<213> MR

<400> 22

gggggaggga?gaggggcgtt?atttggcata?tttaacaagg?tttaccact 49

<210> 23

<211> 39

<212> DNA

<213> MR-SalI

<400> 23

cctttgtcga?ctttggcata?tttaacaagg?tttaccact 39

<210> 24

<211> 18

<212> DNA

<213> IRES?1F

<400> 24

cgcccctctc?cctccccc 18

<210> 25

<211> 38

<212> DNA

<213> IRES?588R

<400> 25

ctcggtcgac?catgttgtgg?caagcttatc?atcgtgtt 38

<210> 26

<211> 36

<212> DNA

<213> GP5F-EcoRI

<400> 26

cctttgaatt?catgttgggg?aagtgcttga?ccgcgt 36

<210> 27

<211> 42

<212> DNA

<213> MR-XhoI

<400> 27

cctttctcga?gttatttggc?atatttaaca?aggtttacca?ct 42

<210> 28

<211> 31

<212> DNA

<213> IRES-1F-SpeI-TAA

<400> 28

ccgcactagt?taacgcccct?ctccctcccc?c 31

<210> 29

<211> 588

<212> DNA

<213> IRES

<400> 29

cgcccctctc?cctccccccc?ccctaacgtt?actggccgaa?gccgcttgga?ataaggccgg 60

tgtgcgtttg?tctatatgtg?attttccacc?atattgccgt?cttttggcaa?tgtgagggcc 120

cggaaacctg?gccctgtctt?cttgacgagc?attcctaggg?gtctttcccc?tctcgccaaa 180

ggaatgcaag?gtctgttgaa?tgtcgtgaag?gaagcagttc?ctctggaagc?ttcttgaaga 240

caaacaacgt?ctgtagcgac?cctttgcagg?cagcggaacc?ccccacctgg?cgacaggtgc 300

ctctgcggcc?aaaagccacg?tgtataagat?acacctgcaa?aggcggcaca?accccagtgc 360

cacgttgtga?gttggatagt?tgtggaaaga?gtcaaatggc?tctcctcaag?cgtattcaac 420

aaggggctga?aggatgccca?gaaggtaccc?cattgtatgg?gatctgatct?ggggcctcgg 480

tgcacatgct?ttacatgtgt?ttagtcgagg?ttaaaaaaac?gtctaggccc?cccgaaccac 540

ggggacgtgg?ttttcctttg?aaaaacacga?tgataagctt?gccacaac 588

<210> 30

<211> 588

<212> DNA

<213> G-2A-M

<400> 30

ATGTTGGGGAAGTGCTTGACCGCGTGCTGTTGCTCGCGATCGCTTTTTTtGTGGTGTATCGTGCCGTTCTATCTTGCTGT

GCTCGTCAACGCCAGCAACAACAACAGCTCTCATATTCAGTTGATTTATAACTTAACGCTATGtGAGCTGAATGGCACAG

ATTGGCTGGCACAAAAATTTGACTGGGCAGTGGAGACTTTTGTCATCTTCCCCGTGTTGACTCACATTGTTTCCTATGGG

GCACTCACCACCAGCCATTTCCTTGACACAGTTGGTCTGGCCACTGTGTCCACCGCCGGATATTATCACGGGCGGTATGT

CTTGAGCAGCATTTACGCAGTCTGTGCTCTGGCTGCGCTGATTTGCTTTGTCATTAGGCTTGCGAAGAACTGCATGTCCT

GGCGCTACTCTTGTACCAGATATACCAACTTCCTTCTGGACACTAAGGGCAGACTCTATCGTTGGCGGTCGCCCGTCATT

GTGGAGAAAGGGGGTAAGGTTGAGGTCGAAGGTCACCTGATCGACCTCAAGAGAGTTGTGCTTGATGGTTCCGCGGCAAC

CCCTTTAACCAGAGTTTCAGCAGAACAATGGGGTCGTCTCCAGCTTCTGAACTTCGACCTCCTCAAGTTGGCGGGAGACG

TTGAGTCCAACCCTGGGCCTATGGGGTCGTCTCTAGACGACTTCTGCAATGATAGCACAGCTCCACAGAAGGTGCTTTTG

GCGTTTTCCATTACCTACACGCCAGTGATGATATATGCTCTAAAGGTAAGTCGCGGCCGACTGCTAGGGCTTCTGCACCT

TTTGATCTTTCTGAATTGTGCTTTTACCTTCGGGTACATGACATTCGTGCACTTTGAGAGCACAAATAGGGTCGCGCTCA

CTATGGGAGCAGTAGTTGCACTTCTTTGGGGAGTGTACTCaGCCATAGAAACCTGGAAATTCATCACCTCCAGATGCCGT

TTGTGCTTGCTAGGCCGCAAGTACATTCTGGCCCCTGCCCACCACGTCGAAAGTGCCGCGGGCTTTCATCCGATTGCGGC

AAATGATAACCACGCATTTGTCGTCCGGCGTCCCGGCTCCACTACGGTCAACGGCACATTGGTGCCCGGGTTGAAAAGCC

TCGTGTTGGGTGGCAGAAAAGCTGTCAAGCAGGGAGTGGTAAACCTTGTTAAATATGCCAAA 1182

Claims

1. high-pathogenicity porcine reproductive and respiratory syndrome virus JEV replicon vaccine based on dna level, it is characterized in that the structural gene GP5 of reproductive and respiratory syndrome and M albumen are inserted in the JEV replicon (pJEV-REP) based on dna level, comprise the proteic signal peptide of NS1, all non-structural protein coding regions, 3 ' UTR, ribozyme, polyA sequence, the GP5 protein-coding region of preceding 23 aminoacid (C23), the E PROTEIN C end of CMV promoter, 5 ' UTR, C albumen n end, sequence and the M protein-coding region of FMDV-2A.

2. the construction method of the described high-pathogenicity porcine reproductive and respiratory syndrome virus JEV replicon vaccine based on dna level of claim 1, it is characterized in that comprising the steps: to design primer, its sequence is shown in SEQ ID NO:19 ~ 28, amplify the GP5 and the M gene of high-pathogenicity porcine reproductive and respiratory syndrome virus XH strain, utilize the method that merges PCR, in the middle of two genes, insert the sequence of FMDV-2A, thereby obtain the G-2A-M fragment, be cloned into JpJEV-REP by SpeI and two restriction enzyme sites of SalI at last; In addition, in order to make M albumen can produce real N-terminal, G-2A-M has inserted in segmental downstream IRES sequence (G-2A-M-IRES), utilize two restriction enzyme sites of SalI-HF and SpeI to be inserted among the pJEV-REP at last, finally make up based on the JEV replicon and can express GP5 and the proteic high-pathogenicity blue ear disease vaccine of M.

3. claim 1 or the 2 described application of high-pathogenicity porcine reproductive and respiratory syndrome virus JEV replicon vaccine in the preparation biological product based on dna level.