CN102247606B - DNA (deoxyribonucleic acid) level-based highly pathogenic blue-eared pig disease JEV (Japanese encephalitis virus) replicon vaccine and application thereof - Google Patents

Abstract

The invention discloses a DNA (deoxyribonucleic acid) level-based highly pathogenic blue-eared pig disease JEV (Japanese encephalitis virus) replicon vaccine and an application thereof. In the invention, primer amplification is carried out to obtain GP5 and M genes of a highly pathogenic blue-eared pig disease virus XH strain, an FMDV-2A sequence is inserted between the two genes by utilizing a fusion PCR (polymer chain reaction) method to obtain a G-2A-M segment, and finally the G-2A-M segment is cloned into pJEV-REP by utilizing two restriction enzyme cutting sites SpeI and SalI; besides, an IRES (internal ribosome entry site) sequence (G-2A-M-IRES) is inserted into the downstream of the G-2A-M segment, thus M protein can produce a real N terminal; and the G-2A-M-IRES segment is inserted into the pJEV-REP by utilizing two restriction enzyme cutting sites SalI-HF and SpeI, and finally a highly pathogenic blue-eared pig disease vaccine which is based on a JEV replicon and can express GP5 and M proteins is constructed.

Description

A kind of high-pathogenicity porcine reproductive and respiratory syndrome virus JEV replicon vaccine and application thereof based on DNA level

Technical field

The present invention relates to gene engineering technology field, be specifically related to a kind of high-pathogenicity porcine reproductive and respiratory syndrome virus JEV replicon vaccine and application thereof based on DNA level.

Background technology

The PRRS vaccine of clinical practice at present has inactivated vaccine and attenuated live vaccine.Because inactivated vaccine immune effect is undesirable, and attenuated live vaccine exists virulence to return strong probability.

Oneself becomes one of serious infectious diseases of serious harm pig industry current PRRS, and the immunity inoculation of vaccine is still prevention and controls the effective measures of PRRS.Be mainly weak malicious Seedling and inactivated vaccine for preventing the commercialized vaccine of PRRS at present, but because there being the poor defect of potential safety hazard or immune effect, can not provide desirable immunoprotection.That the gene of certain antigen protein of coding is placed under the control of Eukaryotic expressing element and be described as " vaccine revolution for the third time " DNA vaccination, form recombinant expression plasmid DNA, it is directly imported in animal body, process synthetic antigen molecule by host cell expression, thereby induction host produces the immunne response to this antigen protein.Although DNA vaccination possesses many advantages, but because dosage of inoculation is large and the potential safety hazard of existence and host genome restructuring is subject to a lot of restrictions in development.Therefore, study safer, effective novel vaccine carrier to prevention and control the generation of PRRS and popular significant.

Summary of the invention

The object of the invention is to according to the deficiencies in the prior art, a kind of high-pathogenicity porcine reproductive and respiratory syndrome virus JEV replicon vaccine based on DNA level is provided.

Another object of the present invention is to provide the construction method of the above-mentioned high-pathogenicity porcine reproductive and respiratory syndrome virus JEV replicon vaccine based on DNA level.

A further object of the invention is to provide the application of the above-mentioned high-pathogenicity porcine reproductive and respiratory syndrome virus JEV replicon vaccine based on DNA level.

Above-mentioned purpose of the present invention is achieved by the following technical programs:

A high-pathogenicity porcine reproductive and respiratory syndrome virus JEV replicon vaccine based on DNA level, is based upon on JEV replicon (pJEV-REP).Described JEV Replicate Sub-system is taking transformed low copy plasmid pOKM as skeleton, in the most structural gene of disappearance (165-2402 nucleotide) in the situation that, build the JEV replicon carrier system based on DNA level of signal peptide (E25), all non-structural proteins, 3 ' UTR, ribozyme (HDVr) and the polyA sequence of the NS1 albumen of front 23 aminoacid (C23), the E PROTEIN C end that comprise CMV promoter, 5 ' UTR, C albumen n end.

The construction method of above-mentioned JEV Replicate Sub-system, comprises the steps: to design primer, its sequence as shown in SEQ ID NO:1 ~ 18, amplified fragments A from plasmid pWF-GFP, then amplify fragment B, C, D and fragment from the geneome RNA of JEV , then taking Segment A and B as template, amplify fragment by the method that merges PCR ; Taking fragment C and D as template, merge pcr amplification and go out fragment , by fragment , with directed cloning, in low copy plasmid, obtains the encephalitis b virus replicon carrier system based on DNA level.

High-pathogenicity porcine reproductive and respiratory syndrome virus JEV replicon vaccine based on DNA level of the present invention is that the structural gene GP5 of reproductive and respiratory syndrome and M albumen are inserted in the JEV replicon (pJEV-REP) based on DNA level, comprises signal peptide, all non-structural proteins coding region, 3 ' UTR, ribozyme, polyA sequence, the GP5 protein-coding region of the NS1 albumen of front 23 aminoacid (C23), the E PROTEIN C end of CMV promoter, 5 ' UTR, C albumen n end, sequence and the M protein-coding region of FMDV-2A.

The construction method of the above-mentioned high-pathogenicity porcine reproductive and respiratory syndrome virus JEV replicon vaccine based on DNA level comprises the steps: to design primer, its sequence is as shown in SEQ ID NO:19 ~ 28, amplify GP5 and the M gene of high-pathogenicity porcine reproductive and respiratory syndrome virus XH strain, utilize the method that merges PCR, in the middle of two genes, insert the sequence of FMDV-2A, thereby obtain G-2A-M fragment, be finally cloned into JpJEV-REP by SpeI and two restriction enzyme sites of SalI; In addition, in order to make M albumen can produce real N-terminal, IRES sequence (G-2A-M-IRES) has been inserted in the downstream of G-2A-M fragment, finally utilize two restriction enzyme sites of SalI-HF and SpeI to be inserted in pJEV-REP, finally build based on JEV replicon and can express GP5 and the high-pathogenicity blue ear disease vaccine of M albumen.

The nucleotide sequence of IRES is as shown in SEQ ID NO:29.

The nucleotide sequence of G-2A-M fragment is as shown in SEQ ID NO:30.

The above-mentioned high-pathogenicity porcine reproductive and respiratory syndrome virus JEV replicon energy effective expression based on DNA level of the present invention also can bring out specific antibody and cell immune response, can be used as a kind of novel gene engineered vaccine of prevention highly pathogenic PRRS.

Compared with prior art, the present invention has following beneficial effect:

The ubiquitous blue-ear disease vaccine attenuated vaccine of existing market, but the shortcoming of attenuated live vaccine maximum is to exist virulence to return strong probability, and traditional recombinant vaccine expressing quantity is low, the poor deficiency that waits of immunogenicity.And there is not live virus in the replicon vaccine of the present invention's research and development, therefore do not exist virus virulence to return strong probability, in addition, the present invention also proved compared with traditional DNA vaccination, and vaccine of the present invention can produce higher antibody and stronger lymphproliferation response.

Brief description of the drawings

Fig. 1 is the design of graphics of the pig high-pathogenicity blue ear disease vaccine based on JEV replicon carrier, and wherein, A is JEV-REP-G-2A-M-IRES; B is pJEV-REP-G-2A-M;

Fig. 2 is GP5 gene, M gene and the amplified production that merges PCR thereof; Wherein, 1 is DNA Marker DL2,000; 2 is GP5 gene PCR fragment; 3 is M gene PCR fragment; 4 is G-2A-M fragment; 5 is G-2A-MR fragment; 6 is IRES sequence PCR fragment; 7 is G-2A-M-IRES fragment;

Fig. 3 is the enzyme action qualification of each recombiant plasmid; Wherein, 1 is λ-EcoT14 I digest Marker; 2 is DNA Marker DL2,000; 3 is pJEV-REP-G-2A-M-IRES(SalI/SpeI); 4 is pJEV-REP-G-2A-M(SalI/SpeI); 5 is pJEV-REP-GFP(SalI/SpeI); 6 is pJEV-REP-IRES(SalI/SpeI); 7 is pCAGGS-GM(EcoRI and XhoI);

Fig. 4 is the Western blot testing result of expressing three groups of recombiant plasmid of GP5/M albumen; Wherein, 1 is pageRuler Prestained Protein Ladder; 2 is pJEV-REP-G-2A-M-IRES; 3 is pJEV-REP-G-2A-M; 4 is pCAGGS-GM; 5 is 293T cell;

Fig. 5 is the IFA result (× 400) of three groups of pJEV-REP Transfected Recombinant Plasmid 293T cell 48h; Wherein, A is pJEV-REP-G-2A-M-IRES transfection 293T cell; B is pJEV-REP-IRES transfection 293T cell; C is pJEV-REP-G-2A-M transfection 293T cell; D is 293T cell;

Fig. 6 is the growth curve of immune serum antibody;

Fig. 7 is the spleen lymphocyte specificity multiplication reaction of different vaccine immune mouses.

Detailed description of the invention

Further explain the present invention below in conjunction with embodiment, but embodiment does not limit in any form to the present invention.

Material: PRRSV-XH strain is awarded and is so kind as to give by the Zhang Gui Red Sect of Lamaism of Field of Animal Epidemic Disease Control emphasis open laboratory of the Ministry of Agriculture; Mac145 cell is provided by Field of Animal Epidemic Disease Control emphasis open laboratory of the Ministry of Agriculture; The SPF level BALB/c female mice in 8 week age is purchased from Guangdong Province's Experimental Animal Center.

embodiment 1 build pig high-pathogenicity blue ear disease replicon vaccine

1. build the design (structure chart is as Fig. 1) of pig high-pathogenicity blue ear disease replicon vaccine

By the primer (as shown in SEQ ID NO:19 ~ 29) of designed, designed, taking the reverse transcription product of HP PRRS gene RNA as template, primer GP5F and GP5R-FMDV2A-R can amplify the complete coding region of GP5 gene and front 45 bases of 2A sequence, and result amplifies size for 648bp specific fragment; Primer MF-FMDVF2A-F and MR-SalI can amplify rear 45 bases of 2A sequence and the complete coding region of M gene, amplify 570bp.In addition, primer GP5F and MR-SalI amplify approximately 1, the G-2A-M fragment of 200bp by the method that merges PCR.Simultaneously taking G-2A-M fragment as template, go out approximately 1 taking GP5F and MR as primer amplification, the G-2A-MR fragment of 200bp, then taking IRES1F and IRES-588R as primer, go out the IRES sequence of 588bp taking pIRES1-neo as template amplification.Then utilize G-2A-MR fragment and IRES for template, as merging, primer amplifies approximately 1 taking GP5F and IRES-588R, the G-2A-M-IRES specific fragment of 800bp, finally utilize two restriction enzyme sites of SalI-HF and SpeI to be inserted in pJEV-REP, finally build based on JEV replicon and can express GP5 and the high-pathogenicity blue ear disease vaccine of M albumen (as Fig. 2).

2. the structure of eukaryon expression plasmid

Taking GP5-EcoRI and MR-XhoI as primer, amplify G-2A-M-EX fragment taking plasmid pJEV-REP-G-2A-M as template by the method for PCR.Then G-2A-M-EX fragment and carrier for expression of eukaryon pCAGGS are digested and are connected product and are directly used in and transform and the acquisition of recombiant plasmid with restricted enzyme EcoRI and XhoI respectively, called after pCAGGS-GM(is as Fig. 2).

3. the enzyme action of each recombiant plasmid qualification

Recombiant plasmid pCAGGS-GM carries out enzyme action qualification with EcoRI and XhoI, and tri-recombiant plasmid of pJEV-REP-G-2A-M-IRES, pJEV-REP-G-2A-M and pJEV-REP-IRES all carry out enzyme action qualification (as Fig. 3) with SalI and SpeI.

embodiment 2 chemiluminescence Western-blot detect GP5 albumen and M protein expression

By the plasmid of the GP5 of coexpression PRRSV and M albumen (pJEV-REP-G-2A-M and pJEV-REP-G-2A-M-IRES) and eukaryon expression plasmid (pCAGGS-GM) transfection 293T cell respectively, collecting cell after transfection 48h, after Transfected Recombinant Plasmid 48h, harvesting, PBS washes 2 times, appropriate PBS is resuspended, adds 2 × SDS sample-loading buffer, boiling water bath effect 10min.Prepare 12% SDS-polyacrylamide gel (PAGE), by every hole 20 μ l point samples, and under 80V/0.5h and 120V/1.5h condition electrophoresis.After electrophoresis finishes, on half-dried electric transfer printing instrument under 17V/10min condition by protein delivery to nitrocellulose membrane.After completing, transfer washes film 5min with 1 × PBS, 5% 37 DEG C of skimmed milks sealing 1h.By anti-GP5 albumen and 4 DEG C of chambers of anti-M protein-specific monoclonal antibody overnight incubation, PBST washes 3 times, every all over 5min, by anti-the sheep anti mouse fluorescence two of the IRDye 800 labellings 1:7 that does, after 500 dilutions, add together, on room temperature shaking table, hatch 1h, PBST washes film 3 times, each 5min, scan with Odyssey Infrared fluorescence scanning imaging system, found that, three kinds of transfections the 293T cell of plasmid all there is specific band at 43KD, the expression that shows GP5 and M albumen is to have (see figure 4) with the form of GP5/M heterodimer, show that these several recombiant plasmid all can correction destination protein after transfectional cell.

the expression of embodiment 3 indirect immunofluorescene assay JEV non-structural proteins

By the JEV replicon plasmid (pJEV-REP-G-2A-M and pJEV-REP-G-2A-M-IRES) of the GP5 of coexpression PRRSV and M albumen and vehicle Control plasmid (pJEV-REP-IRES) respectively after transfection 293T cell 48h, detect that by IIF method three kinds of JEV replicon recombiant plasmid all can express JEV NS1 albumen (see figure 5).

the detection of embodiment 4 immune serum specific antibodies

The SPF level BALB/c female mice in 60 8 week ages is divided into 5 groups, every group 12, immune pJEV-REP-G-2A-M-IRES, pJEV-REP-IRES, pJEV-REP-G-2A-M, pCAGGS-GM and PBS respectively, immunizing dose is 100 μ L/, the each 50 μ L of every side, immunity 3 times altogether, every immunity in 3 weeks once.

Gather the immune serum of 0,2,4,6,8 and 10 week after immunity, detect (ELIAS secondary antibody that wherein ELIAS secondary antibody of pig is replaced by mice) by pig blue-ear disease ELISA detection kit.Key step is as follows: 1:100 dilutes mice serum to be checked, gets pre-coated plate, and every hole adds 100 μ L serum to be checked, puts 37 DEG C of incubation 30min; 300 μ L/ hole cleaning mixture are washed plate 4 times, leave standstill 3min at every turn; Mus ELIAS secondary antibody (1:7,500 dilutions) the 100 μ L of Mei Kongjia NBL company, put 37 DEG C of incubation 60min; Wash 4 times, method is the same; Every hole adds substrate A liquid and the each 50 μ L of B liquid, room temperature lucifuge colour developing 10min; Every hole adds stop buffer 50 μ L, measures the OD value (see figure 6) in each hole in 10 min with microplate reader 630nm wavelength.As can be seen from the figure immune group starts to detect specific antibody one for two weeks after exempting from, two exempt from rear pJEV-REP-G-2A-M compare with pJEV-REP-G-2A-M-IRES immune group matched group antibody horizontal start increase, and three exempt from after two weeks (8 weeks) three groups of vaccine group all reach the peak of antibody, now pJEV-REP-G-2A-M(OD630=0.73 ± 0.09) and pJEV-REP-G-2A-M-IRES(OD630=0.71 ± 0.08) immune group is than pCAGGS-GM(OD630=0.59 ± 0.11) DNA vaccination immune group produces higher antibody.Result shows that replicon vaccine can produce higher antibody horizontal than DNA vaccination.

the specificity lymphopoiesis level of embodiment 5 immune mouses

Three exempt from the rear lymphocyte proliferation assay that carries out for two weeks.First put to death mice with eyeball blood collection method, be soaked in 75% ethanol; In super-clean bench, take out mouse spleen and be placed in 35mm culture dish, note sterile working; In culture dish, add 4-5 mL lymphocyte separation medium.With syringe, spleen is chosen into fragment, then under 200 object screen clothes, grind with the piston of syringe, then blow and beat into individual cells suspension; Then there is the separating medium of spleen cell to transfer to immediately in 15mL centrifuge tube outstanding, cover 1640 culture medium of 200-500 μ L, keep liquid level boundary obviously; Room temperature, the centrifugal 30min of 800g; Next sucking-off buffy coat, then add 10 mL1640 culture medium, put upside down washing.Room temperature, the centrifugal 10min collecting cell of 250g; Finally topple over supernatant, with 1640 culture medium re-suspended cells, cell counting, then use 1640 complete mediums by cell dilution to 1 × 10 ⁶individual/mL.After centrifugal the lymphocyte suspension of above-mentioned preparation, be suspended to RPMI1640 complete medium, be then added to the 96 flat Tissue Culture Plates in hole (1 × 105/hole), every hole adds the cell suspension of 100 μ L.Add again same volume PRRSV (1 μ g), Mac145 ghost contrast or RPMI1640 complete medium.Culture plate is cultivated after 84h at 37 DEG C of constant incubators containing 5% CO2, and every hole adds 10 μ L CCK-8 reagent, mixes rear continuation and cultivates 3h, and then detecting wavelength by microplate reader is the optical density value of 450 nm.Each sample is established three repetitions, calculates stimulation index (Stimulation Index, SI).SI=PRRSV stimulates the average optical degree value OD450nm/Mac145 ghost control wells density degree value OD450nm in hole.Splenocyte adds PRRSV to stimulate after cultivation 80h, adds WST-8 solution, judges living cells quantity.The amount of living cells shows by the OD450nm of sample, calculate stimulation index (Stimulation Index, SI) according to the OD450nm of PRRSV stimulating group and ghost matched group thus judge propagation level.Experimental result shows that the SI of (see figure 7) pJEV-REP-G-2A-M (SI=1.804 ± 0.175) and pJEV-REP-G-2A-M-IRES (SI=1.853 ± 0.254) immune group is apparently higher than pJEV-REP-IRES(SI=1.155 ± 0.037) empty carrier immune group (p<0.01); DNA vaccination group (pCAGGS-GM) SI index (SI=1.54 ± 0.10) is also apparently higher than PBS matched group (p<0.01), but propagation level is lower than other two groups of replicon vaccine group.

SEQUENCE LISTING

<110> Agricultural University Of South China

Mono-kind of <120> high-pathogenicity porcine reproductive and respiratory syndrome virus JEV replicon vaccine and the application thereof based on DNA level

<130>

<160> 29

<170> PatentIn version 3.2

<210> 1

<211> 40

<212> DNA

<213> PCMVp1

<400> 1

tttttggcgg ccgctagtta ttaatagtaa tcaattacgg 40

<210> 2

<211> 44

<212> DNA

<213> PCMVP1L

<400> 2

tttttggcgg ccgctagtta ttaatagtaa tcaattacgg ggtc 44

<210> 3

<211> 47

<212> DNA

<213> PJEV164olR

<400> 3

ctcggtcgac ggtggtaaca ctagtgcggg gtaggccgcg tttcagc 47

<210> 4

<211> 43

<212> DNA

<213> PJEV2403olF

<400> 4

actagtgtta ccaccgtcga ccgagaccga tcaattgctt tgg 43

<210> 5

<211> 20

<212> DNA

<213> PJEVC5706R

<400> 5

ttacgctcgc cacaaaccac 20

<210> 6

<211> 20

<212> DNA

<213> CJEV-5557F

<400> 6

cgaccccgcc tggaaccacg 20

<210> 7

<211> 25

<212> DNA

<213> CJEV-9155R

<400> 7

gaaccccaaa gcttcaaact ctaga 25

<210> 8

<211> 25

<212> DNA

<213> pJEV9117F

<400> 8

cttggagcac ggtatctaga gtttg 25

<210> 9

<211> 24

<212> DNA

<213> pJEV10976R

<400> 9

agatcctgtg ttcttcctca ccac 24

<210> 10

<211> 25

<212> DNA

<213> pJEV10395F

<400> 10

tgtgatttaa ggtagaaaag tagac 25

<210> 11

<211> 36

<212> DNA

<213> SPAP2L

<400> 11

cgaggtacct accacatttg tagaggtttt acttgc 36

<210> 12

<211> 29

<212> DNA

<213> GFP1F

<400> 12

ccgcactagt atggtgagca agggcgagg 29

<210> 13

<211> 30

<212> DNA

<213> GFP717R

<400> 13

ctcggtcgac cttgtacagc tcgtccatgc 30

<210> 14

<211> 42

<212> DNA

<213> EGFP720Rol

<400> 14

gggggaggga gaggggcgtt acttgtacag ctcgtccatg cc 42

<210> 15

<211> 18

<212> DNA

<213> IRES 1F

<400> 15

cgcccctctc cctccccc 18

<210> 16

<211> 38

<212> DNA

<213> IRES 588R

<400> 16

ctcggtcgac catgttgtgg caagcttatc atcgtgtt 38

<210> 17

<211> 22

<212> DNA

<213> 2403F

<400> 17

cgagaccgat caattgcttt gg 22

<210> 18

<211> 27

<212> DNA

<213> 2609R

<400> 18

cttcgctagg gatctgggcg tttctgg 27

<210> 19

<211> 35

<212> DNA

<213> GP5F

<400> 19

ccgcactagt atgttgggga agtgcttgac cgcgt 35

<210> 20

<211> 67

<212> DNA

<213> GP5R-FMDV2A-R

<400> 20

ctcaacgtct cccgccaact tgaggaggtc gaagttcaga agctggagac gaccccattg 60

ttctgct 67

<210> 21

<211> 65

<212> DNA

<213> MF-FMDVF2A-F

<400> 21

gacctcctca agttggcggg agacgttgag tccaaccctg ggcctatggg gtcgtctcta 60

gacga 65

<210> 22

<211> 49

<212> DNA

<213> MR

<400> 22

gggggaggga gaggggcgtt atttggcata tttaacaagg tttaccact 49

<210> 23

<211> 39

<212> DNA

<213> MR-SalI

<400> 23

cctttgtcga ctttggcata tttaacaagg tttaccact 39

<210> 24

<211> 18

<212> DNA

<213> IRES 1F

<400> 24

cgcccctctc cctccccc 18

<210> 25

<211> 38

<212> DNA

<213> IRES 588R

<400> 25

ctcggtcgac catgttgtgg caagcttatc atcgtgtt 38

<210> 26

<211> 36

<212> DNA

<213> GP5F-EcoRI

<400> 26

cctttgaatt catgttgggg aagtgcttga ccgcgt 36

<210> 27

<211> 42

<212> DNA

<213> MR-XhoI

<400> 27

cctttctcga gttatttggc atatttaaca aggtttacca ct 42

<210> 28

<211> 31

<212> DNA

<213> IRES-1F-SpeI-TAA

<400> 28

ccgcactagt taacgcccct ctccctcccc c 31

<210> 29

<211> 588

<212> DNA

<213> IRES

<400> 29

cgcccctctc cctccccccc ccctaacgtt actggccgaa gccgcttgga ataaggccgg 60

tgtgcgtttg tctatatgtg attttccacc atattgccgt cttttggcaa tgtgagggcc 120

cggaaacctg gccctgtctt cttgacgagc attcctaggg gtctttcccc tctcgccaaa 180

ggaatgcaag gtctgttgaa tgtcgtgaag gaagcagttc ctctggaagc ttcttgaaga 240

caaacaacgt ctgtagcgac cctttgcagg cagcggaacc ccccacctgg cgacaggtgc 300

ctctgcggcc aaaagccacg tgtataagat acacctgcaa aggcggcaca accccagtgc 360

cacgttgtga gttggatagt tgtggaaaga gtcaaatggc tctcctcaag cgtattcaac 420

aaggggctga aggatgccca gaaggtaccc cattgtatgg gatctgatct ggggcctcgg 480

tgcacatgct ttacatgtgt ttagtcgagg ttaaaaaaac gtctaggccc cccgaaccac 540

ggggacgtgg ttttcctttg aaaaacacga tgataagctt gccacaac 588

<210> 30

<211> 588

<212> DNA

<213> G-2A-M

<400> 30

ATGTTGGGGAAGTGCTTGACCGCGTGCTGTTGCTCGCGATCGCTTTTTTtGTGGTGTATCGTGCCGTTCTATCTTGCTGT

GCTCGTCAACGCCAGCAACAACAACAGCTCTCATATTCAGTTGATTTATAACTTAACGCTATGtGAGCTGAATGGCACAG

ATTGGCTGGCACAAAAATTTGACTGGGCAGTGGAGACTTTTGTCATCTTCCCCGTGTTGACTCACATTGTTTCCTATGGG

GCACTCACCACCAGCCATTTCCTTGACACAGTTGGTCTGGCCACTGTGTCCACCGCCGGATATTATCACGGGCGGTATGT

CTTGAGCAGCATTTACGCAGTCTGTGCTCTGGCTGCGCTGATTTGCTTTGTCATTAGGCTTGCGAAGAACTGCATGTCCT

GGCGCTACTCTTGTACCAGATATACCAACTTCCTTCTGGACACTAAGGGCAGACTCTATCGTTGGCGGTCGCCCGTCATT

GTGGAGAAAGGGGGTAAGGTTGAGGTCGAAGGTCACCTGATCGACCTCAAGAGAGTTGTGCTTGATGGTTCCGCGGCAAC

CCCTTTAACCAGAGTTTCAGCAGAACAATGGGGTCGTCTCCAGCTTCTGAACTTCGACCTCCTCAAGTTGGCGGGAGACG

TTGAGTCCAACCCTGGGCCTATGGGGTCGTCTCTAGACGACTTCTGCAATGATAGCACAGCTCCACAGAAGGTGCTTTTG

GCGTTTTCCATTACCTACACGCCAGTGATGATATATGCTCTAAAGGTAAGTCGCGGCCGACTGCTAGGGCTTCTGCACCT

TTTGATCTTTCTGAATTGTGCTTTTACCTTCGGGTACATGACATTCGTGCACTTTGAGAGCACAAATAGGGTCGCGCTCA

CTATGGGAGCAGTAGTTGCACTTCTTTGGGGAGTGTACTCaGCCATAGAAACCTGGAAATTCATCACCTCCAGATGCCGT

TTGTGCTTGCTAGGCCGCAAGTACATTCTGGCCCCTGCCCACCACGTCGAAAGTGCCGCGGGCTTTCATCCGATTGCGGC

AAATGATAACCACGCATTTGTCGTCCGGCGTCCCGGCTCCACTACGGTCAACGGCACATTGGTGCCCGGGTTGAAAAGCC

TCGTGTTGGGTGGCAGAAAAGCTGTCAAGCAGGGAGTGGTAAACCTTGTTAAATATGCCAAA 1182

Claims (2)

1. the high-pathogenicity porcine reproductive and respiratory syndrome virus JEV replicon vaccine based on DNA level, it is characterized in that the structural gene GP5 of reproductive and respiratory syndrome and M albumen to be inserted into the JEV replicon pJEV-REP based on DNA level, described JEV replicon comprises signal peptide, all non-structural proteins coding region, 3 ' UTR, ribozyme, polyA sequence, the GP5 protein-coding region of the NS1 albumen of front 23 aminoacid C23, the E PROTEIN C end of CMV promoter, 5 ' UTR, C albumen n end, sequence and the M protein-coding region of FMDV-2A; The construction method of the described high-pathogenicity porcine reproductive and respiratory syndrome virus JEV replicon vaccine based on DNA level comprises the steps: to design primer, its sequence is as shown in SEQ ID NO:19 ~ 28, amplify GP5 and the M gene of high-pathogenicity porcine reproductive and respiratory syndrome virus XH strain, utilize the method that merges PCR, in the middle of two genes, insert the sequence of FMDV-2A, thereby obtain G-2A-M fragment, be finally cloned into JpJEV-REP by SpeI and two restriction enzyme sites of SalI; In addition, in order to make M albumen can produce real N-terminal, IRES sequence G-2A-M-IRES has been inserted in the downstream of G-2A-M fragment, finally utilize two restriction enzyme sites of SalI-HF and SpeI to be inserted in pJEV-REP, finally build based on JEV replicon and can express GP5 and the high-pathogenicity blue ear disease vaccine of M albumen; The nucleotide sequence of described IRES is as shown in SEQ ID NO:29; The nucleotide sequence of described G-2A-M fragment is as shown in SEQ ID NO:30; The sequence of described FMDV-2A be reverse transcription product taking HP PRRS gene RNA as template, primer MF-FMDVF2A-F and MR-SalI amplify rear 45 bases of 2A sequence and the complete coding region of M gene.

Described in claim 1 the high-pathogenicity porcine reproductive and respiratory syndrome virus JEV replicon vaccine based on DNA level in the application of preparing in biological product.