CN112646840B

CN112646840B - Method for preparing bovine viral diarrhea virus E2 protein by using baculovirus expression system and application

Info

Publication number: CN112646840B
Application number: CN202011565641.3A
Authority: CN
Inventors: 陈创夫; 何金科; 邓肖玉; 王勇; 何延华
Original assignee: Shihezi University
Current assignee: Shihezi University
Priority date: 2020-12-25
Filing date: 2020-12-25
Publication date: 2022-11-18
Anticipated expiration: 2040-12-25
Also published as: CN112646840A

Abstract

The invention belongs to the technical field of biological products for livestock, and particularly relates to a method for preparing bovine viral diarrhea virus E2 protein by using a baculovirus expression system and application thereof. Connecting the E2 gene of the BVDV-LC strain to a pFastBac1 recombinant baculovirus transfer vector, obtaining a recombinant baculovirus vector rBacmid-E2 in escherichia coli through homologous recombination, obtaining a first generation recombinant baculovirus P1 after transfecting Sf9 insect cells, continuously infecting the Sf9 insect cells with P1 generation viruses to obtain a second generation recombinant baculovirus P2 with high infection capacity, carrying out amplification culture on the P2 generation viruses, and purifying to obtain an E2 protein. The E2 protein prepared by the invention can show better advantages when being used as a diagnostic antigen and a subunit vaccine, and can be used as a candidate antigen for developing vaccines and ELISA kits.

Description

Method for preparing bovine viral diarrhea virus E2 protein by using baculovirus expression system and application

Technical Field

The invention belongs to the technical field of biological products for livestock, and particularly relates to a method for preparing bovine viral diarrhea virus E2 protein by using a baculovirus expression system and application thereof.

Background

Bovine Viral Diarrhea (BVD) is a complex, multi-clinical type of disease caused by Bovine Viral Diarrhea Virus (BVDV). The disease is a contact infectious disease mainly characterized by fever, diarrhea, mucosal erosion and ulcer, leukopenia, immune tolerance and persistent infection, immunosuppression, congenital defect, cough, abortion of pregnant cow, stillbirth or abnormal fetus. While the stock raising industry in China is rapidly developed, the breeding scale and the breeding quantity are sharply increased, and the trade across areas is more frequent, so that the morbidity of cattle and sheep is continuously improved. The bovine viral diarrhea mucosal disease has great harm to the health and production of cattle, and causes serious economic loss to the cattle industry. Currently, the most effective method for preventing and treating the disease is to screen out diseased cattle and perform vaccination on other cattle, but most common commercial vaccines are inactivated vaccines, multiple immunizations are required (one month after one immunization needs secondary immunizations), the protection period is short (only 4 months after two immunizations), the price is high, and natural infection and vaccine immunizations cannot be distinguished. Moreover, the commercial diagnostic kit for diseases comes from IDEXX company in the United states, and is expensive, so that the kit cannot meet the requirement of BVDV prevention and treatment.

Baculovirus-insect cell expression systems have been widely used in the development and production of vaccines and diagnostics due to their appropriate post-translational modifications and their biological safety advantages. Vaccines produced by various baculovirus-insect cell systems are currently in use, such as human papillomavirus vaccines, human parvovirus HPVB19, porcine circovirus vaccines, classical swine fever virus E2 protein vaccines and the like. BVDV has 4 structural proteins, wherein E ^rns And E2 is the major protective antigen capable of inducing virus neutralizing antibodies and protecting cattle from BVDV challenge, while E ^rns The protein has unique RNase activity, can degrade single-stranded and double-stranded RNA, is important for limiting the innate immune response of a host to the double-stranded RNA, and helps BVDV escape from the innate immunity to establish persistent infection in the host.

The invention selects E2 protein, utilizes baculovirus-insect cell expression system to assemble protein with good reactogenicity in insect cells, and further researches the application of the protein in the aspects of vaccine and diagnosis.

Disclosure of Invention

Aiming at the problems in the prior art, the invention provides a method for preparing bovine viral diarrhea virus E2 protein by using a baculovirus expression system and application thereof, and aims to solve part of problems in the prior art or at least alleviate part of problems in the prior art.

The invention is realized in such a way that a method for preparing bovine viral diarrhea virus E2 protein by a baculovirus expression system comprises the following steps:

adding a His label to the front end of a BVDV-LC E2 gene sequence, and connecting to a pFastBac1 plasmid to obtain a recombinant transfer vector;

transformation of the recombinant transfer vector into E.coli DH10Bac ^TM Obtaining recombinant bacmid;

transfecting Sf9 insect cells with recombinant bacmid to obtain P1 generation recombinant baculovirus;

continuously infecting Sf9 insect cells with the P1 generation virus to obtain a second generation recombinant baculovirus P2 with high infection capacity;

and performing amplification culture on the P2 generation virus, and purifying to obtain the E2 protein.

Furthermore, the BVDV-LC E2 gene sequence is shown in SEQ ID NO. 1.

Further, the recombinant transfer vector was transformed into e.coli DH10Bac by homologous recombination method ^TM In (1).

Further, the culture conditions of Sf9 insect cells were 27 ℃.

The invention also discloses the bovine viral diarrhea virus E2 protein prepared by the method.

The invention also discloses application of the E2 protein in preparing a vaccine or a preparation for treating bovine viral diarrhea.

The invention also discloses application of the E2 protein in preparation of a BVDV ELISA detection kit.

The invention also discloses the application of the E2 protein in an indirect ELISA detection method of the E2 protein for non-diagnostic purposes.

Further, in the indirect ELISA detection method, the optimal coating concentration of the E2 protein is 5 μ g/mL, the optimal dilution concentration of the primary antibody is 1; the optimal coating condition of the E2 protein is 4 ℃ overnight coating; the optimal sealing liquid is 5% of skimmed milk powder; the optimal reaction time is 60min; the optimal reaction time of the secondary antibody is also 60min; the optimal action time of the substrate is 10min.

The invention provides a preparation method of His-tagged bovine viral diarrhea virus E2 protein and application thereof in vaccine and diagnosis, belonging to the technical field of biological products for livestock. Adding the E2 gene of the BVDV-LC strainAdding His tag sequence, connecting to pFastBac1 recombinant baculovirus transfer vector, and performing E.coli DH10Bac ^TM In the method, a recombinant baculovirus vector rBacmid-E2 is obtained through homologous recombination, a first generation recombinant baculovirus P1 is obtained after Sf9 insect cells are transfected, a P1 generation virus continuously infects the Sf9 insect cells to obtain a second generation recombinant baculovirus P2 with high infectivity, and then the P2 generation virus is subjected to amplification culture and then is purified to obtain an E2 protein.

In summary, the advantages and positive effects of the invention are as follows:

1. the invention successfully constructs a pFB-E2 recombinant transfer vector and an rBacmid-E2 recombinant bacmid by using a bacillus virus-insect cell expression system.

2. The invention successfully obtains P1 generation and P2 generation recombinant baculovirus by transfecting Sf9 insect cells with rBacmid-E2 recombinant bacmid.

3. The recombinant baculovirus constructed by the invention successfully assembles the E2 protein in Sf9 insect cells, and the purified E2 protein is found to be granular through electron microscope observation and has a shape similar to a natural virus antigen.

4. The E2 protein purified by the invention can have strong specific reaction with BVDV positive serum.

5. After the E2 protein constructed by the invention is used for immunizing a mouse, a high-level specific antibody can be generated, and the immune effect on the mouse is better compared with a commercial vaccine.

6. The E2 protein constructed by the invention can generate high-level neutralizing antibody on a mouse model, and is even slightly higher than commercial vaccine.

7. Under the stimulation of ConA, the proliferation level of the E2 protein constructed by the invention on mouse lymphocytes is remarkably increased. Under the stimulation of BVDV virus, the proliferation level of E2 protein on mouse spleen lymphocytes is obviously higher than that of the commercial vaccine.

8. The invention utilizes purified E2 protein particles to establish an E2 protein indirect ELISA detection method, and utilizes a chessboard method to screen out the following components of the E2 protein, wherein the optimal coating concentration is 5 mug/mL, the optimal primary antibody dilution concentration is 1, and the optimal secondary antibody dilution concentration is 1.

9. The optimal conditions of the indirect ELISA detection method for screening the E2 protein are 4 ℃ overnight coating and 5% skimmed milk powder sealing, the optimal incubation time of the primary antibody and the secondary antibody is 60min, and the optimal color development time of a substrate is 10min.

10. The invention utilizes 56 negative serum to determine the positive critical value to be 0.296, and utilizes 240 clinical serum samples to determine the sample coincidence rate to be 89.58%.

11. The indirect ELISA detection method for the E2 protein constructed by the invention has good repeatability, strong specificity and high sensitivity, and can be used as a preferential antigen of the BVDV ELISA detection kit.

The E2 protein obtained by the invention can be directly purified by a His-labeled nickel column without fussy sucrose density gradient centrifugation, and can be used for large-scale production. And the purified E2 protein is granular, has a shape similar to that of a natural virus antigen, and can be better combined with an adjuvant. The E2 protein prepared by the invention is used as a subunit vaccine, can stimulate a mouse to generate a high-level specific antibody, has good neutralizing activity on BVDV, obviously improves the proliferation level of lymphocytes, has the advantages of high purification speed, strong immunogenicity, high safety and the like, can distinguish vaccine immunity from natural infection, and can be used as a candidate vaccine for further research. The E2 protein prepared by the invention is used as a diagnostic antigen, has the advantages of strong specificity, good repeatability, high sensitivity, convenient operation, no need of special training personnel and the like when detecting the antibody in the bovine serum, and can be used as a candidate antigen for developing an ELISA kit.

Drawings

FIG. 1 is a pFastBac1 plasmid map;

FIG. 2 is a double restriction map of the recombinant transfer vector; 1: a plasmid; 2: plasmid double digested with Xho I and Kpn I; m: DNA marking;

FIG. 3 is a PCR identification map of recombinant rBacmid-E2 bacmid; m: DL5000 Marker;1 to 6: white bacterial colonies; +: blue colonies; -: negative control;

FIG. 4 shows rBacmid-E2 recombinant bacmid-transfected Sf9 cells (200X); a: normal cells; b: transfected cells of rBacmid-E2 recombinant bacmid;

FIG. 5 shows the result of Western Blot detection of P1 virus; m: pre-stabilized Protein Ladder; -: negative control (Sf 9 cells); 1-2: supernatant (medium); 3-4: precipitation (soma); +: a positive control;

FIG. 6 shows the results of P2 virus detection; m: pre-stabilized Protein Ladder;1: precipitating; 2: supernatant fluid; -: negative control; +: a positive control;

FIG. 7 is a plaque assay for virus titer; NC: blank control; 10 ^-4 -10 ^-8 : dilution factor of P2 generation virus

FIG. 8 shows the indirect immunofluorescence assay of E2 protein expression (100 ×) in Sf9 cells; a: a P2 virus-infected cell; b: FITC-labeled cells after P2 virus infection;

FIG. 9 shows the results of purification of E2 protein; m: protein Marker;1: purified E2 protein;

FIG. 10 is an E2 Western Blot assay; 1-2: western Blot results of E2 protein and BVDV positive serum; m: a protein Marker;

FIG. 11 is a transmission electron microscope observation; a: transmission electron micrographs of recombinant baculovirus; b: transmission electron micrograph of E2 protein;

FIG. 12 is the level of antibody produced following immunization of mice with E2 protein;

FIG. 13 is a test of neutralizing activity of mouse antibodies after immunization; a: neutralizing activity of mouse antibody 14 days after primary immunization; b: neutralizing activity of mouse antibody after 14 days of hyperimmunization;

FIG. 14 shows the detection of splenic lymphocyte proliferation responses in immunized mice using the MTT assay (p < 0.05;. P < 0.01);

FIG. 15 is the determination of optimal coating conditions;

FIG. 16 is a determination of an optimal blocking fluid;

FIG. 17 is a determination of optimal incubation times for serum and secondary antibodies;

FIG. 18 is the determination of the optimal incubation time for the substrate;

FIG. 19 is the results of the sensitivity test.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail below with reference to examples, and the equipment and reagents used in the examples and test examples are commercially available without specific reference. The specific embodiments described herein are merely illustrative of the invention and do not delimit the invention.

Various modifications to the precise description of the invention will be readily apparent to those skilled in the art from the information contained herein without departing from the spirit and scope of the appended claims. It is to be understood that the scope of the invention is not limited to the procedures, properties, or components so defined, as these embodiments, as well as others described, are intended to be illustrative of specific aspects of the invention only. Indeed, various modifications of the embodiments of the invention which are obvious to those skilled in the art or related fields are intended to be included within the scope of the following claims.

For a better understanding of the invention, and not as a limitation on the scope thereof, all numbers expressing quantities, percentages, and other numerical values used in this application are to be understood as being modified in all instances by the term "about". Accordingly, unless expressly indicated otherwise, the numerical parameters set forth in the specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. As used herein, "about" means within 10%, preferably within 5%, of a given value or range.

The normal temperature in the following embodiments of the present invention refers to a natural room temperature condition in four seasons, and is not subjected to additional cooling or heating treatment, and is generally controlled at a normal temperature of 10 to 30 ℃, preferably 15 to 25 ℃.

The invention discloses a method for preparing bovine viral diarrhea virus E2 protein by a baculovirus expression system and application thereof, and the key point of the technology of the invention is that BVDV E2 protein with a form similar to a natural virus antigen is packaged by the baculovirus expression system, the complex process of density gradient centrifugation in the prior art is overcome, a large amount of purification is directly carried out by using a His-labeled nickel column, and the purified E2 protein is found to have good effects in vaccines and diagnosis.

The invention relates to cells and plasmids: plasmid pFastBac1, competent cell DH10Bac ^TM Cellffectin, a transfection reagent ^TM II Reagent was purchased from Sf9 cells, grace's Instrument, serum-free Sf-900, invitrogen, USA ^TM II SFM cell culture media was purchased from Thermo Fisher, USA.

The invention relates to the following main reagents and instruments: the virus RNA extraction kit, the cDNA reverse transcription kit, restriction enzymes Xho I and Kpn I, T4 DNA ligase, a pMD19-T vector and a glue recovery kit are purchased from Takara biological engineering (Dalian) Co., ltd; his label soluble protein purification kit, plasmid big extraction kit purchased from Beijing kang as century; 0.45 μm NC membrane was purchased from Beijing Soilebao; rabbit anti-His tag antibody, HRP-labeled goat anti-rabbit IgG from Beijing Bioss; monoclonal antibody against E2 protein, FITC-labeled goat anti-rabbit IgG, purchased from Abcam, USA; the protein Marker, the ECL color developing solution and the BCA protein quantitative detection kit are purchased from Thermo Fisher company in the United states; the 200-mesh carbon film is purchased from Michthyol corporation; goat anti-mouse IgG (HRP-labeled) was purchased from Beijing Bioss; the TMB single-component developing solution and the MTT lymphocyte proliferation detection kit are purchased from Beijing Solaibao company; lymphocyte separation was purchased from Tianjin grade Biotechnology, inc.

The experimental procedure of the present invention is specifically shown in the following examples.

Example 1 preparation of E2 protein Using baculovirus expression System

1. Codon optimization and synthesis of target genes

A BVDV-LC E2 protein sequence (MK 102095.1) is obtained from an NCBI GenBank database, a His tag protein sequence is added at the front end of the sequence, and codon optimization is carried out to ensure that the sequence is suitable for insect cell expression. Adding Xho I enzyme cutting site at the upstream of the optimized sequence, adding Kpn I enzyme cutting site at the downstream, sending to Shanghai biological engineering Limited company for synthesis, connecting to pMD19-T vector, and naming as E2-T cloning vector. The optimized His-tagged E2 protein sequence has a nucleotide sequence shown in SEQ ID NO.1, and a protein sequence shown in SEQ ID NO. 2.

2. Construction and identification of pFB-E2 recombinant transfer vector

Extracting E2-T recombinant plasmid by using a plasmid miniprep kit, carrying out double enzyme digestion by using Xho I and Kpn I, simultaneously carrying out double enzyme digestion on pFastBac1 plasmid (figure 1) by using Xho I and Kpn I, recovering glue after the enzyme digestion is finished, connecting by using T4 ligase in a water bath at 16 ℃ overnight, transforming to E.coli DH5 alpha competent cells the next day to construct a recombinant transfer vector, and correctly naming the recombinant transfer vector as pFB-E2 by using double enzyme digestion and sequencing verification. 20 μ L of the double enzyme digestion system: plasmid 10. Mu.L, ddH ₂ mu.L of 0, 2. Mu.L of buffer, 1. Mu.L of Xho I and Kpn I respectively, and the digestion conditions are as follows: 37 ℃ for 4h.

The pFB-E2 plasmid was digested with Xho I and Kpn I, and bands of about 5238bp and 1059bp were digested compared with the control plasmid (FIG. 2), which was consistent with the expected results, indicating successful construction of the pFB-E2 recombinant transfer vector.

3. Acquisition and identification of rBacmid-E2 recombinant bacmid

pFB-E2 plasmid was extracted and transformed into E.coli DH10Bac ^TM Competent cells were plated with three antibodies (50. Mu.g/mL Kanamycin, 7. Mu.g/mL Gentamicin, 10. Mu.g/mL Tetracycline) and developed (100. Mu.g/mL X-gal, 40. Mu.g/mL IPTG) and cultured overnight at 37 ℃ in an inverted manner. The next day, white colonies were picked, inoculated into 20mL of three-antibody LB medium, and cultured overnight at 37 ℃ and 180 rpm. Plasmids were extracted in small amounts and verified for plasmid correctness using primers pFastBacac-F and pFastBacac-R, and the positive designation rBacmid-E2.PCR reaction 25 μ L: ddH ₂ O9.7 muL, mix 12.5 muL, template 2 muL, upstream and downstream primers 0.4 muL each; and (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 5min; denaturation at 94 ℃ for 40s, annealing at 56 ℃ for 30s, and elongation at 72 ℃ for 400s; further extension was carried out at 72 ℃ for 10min.

A 5' primer pFastbac-F TATTCCGGATTATTCATACC, SEQ ID No.3;

the 3' primer pFastBac-R is ACAATGTGTGGTATGGCTGA, SEQ ID NO.4.

The rBacmid-E2 plasmid is extracted and PCR identification is carried out by using a pFastbac1 universal primer, and the result shows that bands appear in all picked white colonies (figure 3), and the band is consistent with the expected result, which indicates that the rBacmid-E2 recombinant bacmid is successfully constructed.

4. rBacmid-E2 recombinant bacmid transfected Sf9 cells and harvested P1 generation recombinant baculovirus

2mL of the suspension with a density of 8X 10 ⁵ Sf9 cells/mL were seeded in six-well plates and allowed to stand at 27 ℃ for cell attachment. 1.5mL of Grace's Insect Medium (containing 10% FBS and no antibiotic) and 8.5mL of Grace's Insect Medium (containing no FBS and no antibiotic) were mixed to prepare 10mL of transfection Medium, and the Medium in the six-well plate was removed after the cells adhered to the wall and replaced with 2mL of transfection Medium. Add 8. Mu.L of Cellffectin to 100. Mu.L of Grace's medium ^TM II transfection reagent, 100. Mu.L Grace's medium, add 3. Mu.g rBacmid-E2 plasmid, mix briefly by vortexing. mu.L of diluted rBacmid-E2 plasmid and 100. Mu.L of diluted Cellffectin ^TM II Reagent mix and incubate for 30 minutes at room temperature. The plasmid-liposome mixture was added dropwise to the cells, incubated at 27 ℃ for 5h, the infectious agent was slowly discarded and 2mL of Sf-900 was used ^TM II SFM replacement. And (3) statically culturing the cells at 27 ℃ for about 4-7 days, preparing electrophoresis samples from a culture medium and the cells respectively when the cells show virus infection signs, performing Western Blot by using an antibody of a His tag, and detecting the expression condition of the E2 protein. The remaining medium was transferred to a 2ml centrifuge tube as P1 virus and stored at 4 ℃ in the dark.

The transfected cells showed signs of viral infection at about 4 days (FIG. 4), at which time the supernatants and cells were harvested and subjected to Western Blot analysis, showing that a band of approximately 45kDa protein size appeared in both cell supernatants and pellets (FIG. 5), indicating successful acquisition of P1 generation recombinant baculovirus and that the E2 protein was expressed predominantly intracellularly.

5. P2 generation recombinant baculovirus amplification and virus titer determination

8mL of a mixture having a density of 2X 10 ⁶ cells/mL Sf9 cells seeded at T25 cm ² The cell culture flask of (4), 800. Mu.L of the P1 virus was further added to the flask, and the mixture was cultured at 27 ℃ for 3 days, and the medium was transferred to a 15ml centrifuge tube as the P2 virus, and stored at 4 ℃ in the dark. Determination of P2 generation virus titer: will be 5X 10 ⁵ cells/mL Sf9 cells were dispensed into six-well plates and incubated in an incubator at 27 ℃ for 1 hour. 4% Low melting agarose was placed in a 70 ℃ water bath, and 1.3 XSf-900 medium was placed at 37 ℃In water bath, after the low melting point agarose is liquefied, the two are mixed to prepare upper layer agarose, and the upper layer agarose is placed in water bath at 37 ℃ for standby. The P2 generation virus was treated as 10 ^-1 To 10 ^-8 Serial dilution, 6-well plate supernatant was slowly discarded after Sf9 cells were adherent and immediately replaced with 1mL of the corresponding virus dilution, after incubation in an incubator at 27 ℃ for 1h, virus inoculum was removed from the 6-well plate and replaced with 2mL of prepared supernatant agar. After allowing the gel to harden for 20min, the 6-well plate was incubated in an incubator at 27 ℃ for 4-10 days, the plate was monitored daily, and when the number of plaques remained unchanged for 2 consecutive days, 1mL of neutral Red was added, and after incubation at room temperature for 2h, the plaques were counted. The P2 generation virus titer was calculated as: viral titer (pfu/mL) = 1/dilution fold × number of plaques × 1/inoculation volume per well.

P1 virus was inoculated into Sf9 cells at a ratio of 1. The optimal range for plaque count is 3 to 20 plaques per well in a 6 well plate, at 10 ^-7 The number of the time plaques is 12, and the final measurement shows that the P2 generation recombinant baculovirus titer is 6 multiplied by 10 ⁷ pfu/mL (FIG. 7).

6. Indirect immunofluorescence detection of E2 protein expression

Under sterile conditions, 2mL of Sf9 cells (1X 10) ⁶ Per well) were inoculated into 6-well plates, incubated at room temperature for 1h, the cells were attached to the bottom of the 6-well plate, P2 virus with MOI =10 was added, while a negative control was set up, and incubated at 27 ℃ for 72h in an incubator. Discard the supernatant, add 200 μ L of 80% cold acetone, fix for 45min at room temperature (or fix for 6h at-20 ℃), discard the acetone, wash three times with PBST, add 1.

Cells infected by the P2 virus are collected, indirect immunofluorescence is carried out by using the E2 protein monoclonal antibody, and compared with a control group, the experiment group has obvious green fluorescence (figure 8), which indicates that the recombinant baculovirus successfully expresses the E2 protein.

7. P2 generation recombinant virus amplification culture and E2 protein purification

Get 40mL density 2X 10 ⁶ cells/mL SF9 cells seeded at T25 cm ² In the cell culture flask, 400. Mu.L of P2 virus was added to the flask for expression amplification, and the cells were cultured at 27 ℃ for 3 days. The culture was centrifuged at 12000rpm for 10min, and the supernatant was purified using a His-tagged Ni column. The purification was checked by SDS-PAGE and Western Blot.

The P2 virus was grown and purified, and the result showed that E2 protein of about 45kDa was successfully obtained (FIG. 9). Western Blot detection using antibody-positive serum of BVDV as a primary antibody and rabbit anti-bovine IgG as a secondary antibody revealed that the purified E2 protein was reactive with BVDV-positive serum (FIG. 10).

8. Electron microscopy of E2 protein

Taking three copper nets paved with carbon film, sucking concentrated virus liquid by using a fine dropping pipe, dropping on a carbon film reinforced carrying net to form a drop of small liquid bead, and sucking redundant liquid by using a small filter paper strip after 2-5 min. Adding a drop of 3% phosphotungstic acid negative dye solution to a carrying net by using a fine dropping tube, sucking the redundant dye solution from the edge of the drop by using a small filter paper strip after 2-5min, placing under an infrared lamp for baking for 30min, and observing under a transmission electron microscope.

The BVDV E2 protein has normal structure and function after being packaged by Sf9 insect cells in a Bac to Bac baculovirus expression system, and electron microscope results show that rBacmid-E2 recombinant bacmids successfully assemble into recombinant baculoviruses (figure 11A), and the secreted E2 protein assembles into a structure similar to particles (figure 11B).

Example 2 assay of the application Properties of E2 protein

1. Immunization of laboratory animals

BALB/c mice were randomly divided into 3 groups (PBS group, E2 protein + adjuvant group, commercial vaccine group) of 6 mice each, and sera were collected 3 days before immunization as blank control. The E2 protein and Freund adjuvant 1 are mixed to be assembled into a subunit vaccine for immunizing a BALB/c mouse, the boosting immunization is carried out once every two weeks after the first immunization, the adjuvant for the first immunization is Freund complete adjuvant, the Freund incomplete adjuvant for the boosting immunization is used for subcutaneous injection, and the specific immunization dose is shown in (table 1).

TABLE 1 mouse immunization protocol design

2. Detection of immune mouse IgG specific antibody

After immunization, blood was collected from the caudal vein on

days

7, 14, 21, 28, 35, and 42, and the blood was left at 37 ℃ for 1h, centrifuged at 3000rpm for 5min, and the supernatant was separated, and then the antibody specific to the mouse was detected by indirect ELISA using E2 protein. The calculated results were analyzed for one-way variance using SPSS Statistics 25 statistical software.

In order to study whether the virus-like particles can induce specific antibody levels in mice in vivo, the E2 protein indirect ELASA method is used for detection, and the result shows that in the process of the experiment, the antibody level of the mice in the PBS control group is always lower than the cut off value (OD 450nm < 0.296), the antibody level of the E2 protein continuously rises within 14 days after primary immunization, and the antibody level rises more rapidly and more rapidly after boosting. Also, the immunization effect on mice was better compared to the commercial vaccine (fig. 12).

3. Detection of neutralizing antibodies in immunized mice

BVDV-LC virus stored in refrigerator at-80 deg.C of zoonosis laboratory of Stone river university is taken out, its titer is determined, and diluted to 200TCID ₅₀ 0.1mL. Mouse sera at 14 days post-primary and 14 days post-secondary were inactivated in a 56 ℃ water bath for 30min, with DMEM culture fluid at a rate of 1: and diluting in 256 proportion. And mixing the diluted serum and the BVDV virus uniformly according to the proportion of 1. 2 x 10 of ⁵ cells/mL MDBK cells were seeded at 100. Mu.L per well in 96-well cell culture plates, at 37 ℃ C. And 5% ₂ Culturing in an incubator. When the cell fusion rate is about 70-80%, 100 μ L of serum virus mixed solution is added into each well, and negative control (adding negative serum and 100TCID50 virus mixed solution), positive control (adding positive serum and 100TCID50 virus mixed solution), and normal cell control are set simultaneously, and each sample is made into 3 parallels. After 72h incubation, the supernatant was discarded, washed 2 times with PBS, fixed at 4% paraformaldehyde at room temperature for 15min, washed 2 times with PBS, and diluted with BVDV-positive serum (1Release) was added to each well as a primary antibody, 50. Mu.L of the primary antibody was added to each well, incubated at 37 ℃ in an incubator for 2h, washed 3 times with PBST, and FITC-labeled rabbit anti-bovine IgG as a secondary antibody (1, 500 dilution), 50. Mu.L of the secondary antibody was added to each well, incubated at 37 ℃ in an incubator for 1h, washed 3 times with PBST, 30. Mu.L of glycerol physiological saline was added to each well, and the results were observed under an inverted fluorescence microscope. The formula for calculating the neutralizing activity of the mouse serum antibody is as follows: neutralizing antibody activity = (number of control group green fluorescent cells-number of test group green fluorescent cells)/number of control group green fluorescent cells × 100%.

And (4) judging a result: all control groups showed fluorescent spots, indicating that the experiment was successful. If some fluorescent spots appear, the virus is judged not to be completely neutralized, and if no fluorescent spots appear, the virus is judged to be completely neutralized.

The results of the virus-serum neutralization assay showed that no neutralizing activity was detected in the PBS control group sera 14 days after the first immunization, and the experimental group sera were selected from 1:2 ² To 1:2 ⁸ At proportional dilution, the neutralizing activity of the E2+ Freund group was not significantly different from that of the commercial vaccine group (fig. 13A). 14 days after the second immunization, E2+ Freund was scored from 1:2 ⁴ The neutralizing activity was initially higher than in the commercial vaccine group, serum was in 1:2 ⁵ The E2+ Freund neutralising activity at proportional dilution was still 100%, even at 1:2 ⁸ At dilution ratio, 20% of neutralizing activity was still present (FIG. 13B). The result shows that the E2 protein can generate high-level neutralizing antibodies on a mouse model and has good immunogenicity.

4. Lymphocyte proliferation assay

Lymphocytes from the spleen of mice were isolated according to the instructions for lymphocyte isolation from Terminalia indica, the isolated lymphocytes were counted and trypan blue stained, resuspended in 10% FBS-containing RMPI 1640 cell culture medium, placed on cell culture plates, incubated at 37 ℃ with 5% CO ₂ Culturing in an incubator. Collecting lymphocytes growing to logarithmic phase, adjusting cell suspension concentration to 1 × 10 ⁵ cells/well, placed in 96-well plates at 180. Mu.L/well. Test compounds were added to the test cells to establish Con A-stimulated group (5. Mu.g) and BVDV virus-stimulated group (10. Mu.g), each group was set to 5 wells, while setting zero-setting wells (RPMI 1640 medium, MTT, formazan lysis solution) and control wells (drench)Bacells, RPMI 1640 medium, MTT, formazan lysis solution), 3 replicate wells were set for each group. At 37 ℃ 5% CO ₂ After incubation in an incubator for 48h, 10. Mu.L of MTT solution was added. After 4h of culture, the supernatant was aspirated, 110. Mu.L of Formazan solution was added to each well, the mixture was placed on a shaker and shaken at a low speed for 10min to dissolve the crystals sufficiently, and absorbance values of all wells were measured at 490nm with a microplate reader and SI values were calculated, SI = sample group/control group.

The MTT test result shows that the lymphocyte proliferation level of the E2+ Freund group is very obviously higher than that of the PBS control group (p < 0.01) after the mouse lymphocytes are stimulated by conA (FIG. 14). After the mouse lymphocyte is stimulated by BVDV virus, the proliferation level of E2+ Freund lymphocyte is very higher than that of PBS control group (p < 0.01) and even higher than that of commercial vaccine (p < 0.05) (FIG. 14). The result shows that the E2 protein can induce the body to generate high-level specific cellular immune response.

Example 3 establishment of E2 protein Indirect ELISA detection method

1. Preliminary establishment of indirect ELISA detection method for E2 protein

Coating with purified E2 protein, wherein the concentration of the coating protein is 1 mug/mL, 5 mug/mL, 10 mug/mL and 20 mug/mL; sealing with 5% skimmed milk powder at 37 deg.C for 2 hr; primary antibody was incubated with BVDV-positive serum and positive serum at a dilution ratio of 1; secondary antibodies were incubated with rabbit anti-bovine IgG (HRP labeled) at a dilution ratio of 1.

The optimal coating concentration, the optimal primary antibody dilution concentration and the optimal secondary antibody dilution concentration of the E2 protein are screened by a chessboard method, and the P/N result shows that the optimal coating concentration of the E2 protein is 5 mug/mL, the optimal primary antibody dilution concentration is 1 50, and the optimal secondary antibody dilution concentration is 1.

TABLE 2 checkerboard method for screening E2 protein ELISA optimum condition

2. Determination of the conditions of the coating

E2 protein was coated under 3 conditions (4 ℃ overnight, 37 ℃ 2h and 37 ℃ 2h +4 ℃ overnight), ELISA tests were performed with standard positive and negative BVDV sera, each sample was repeated at least 3 times, and optimal coating conditions were determined by P/N after absorbance at 450 nm.

The maximum P/N value is optimal, therefore, the optimal E2 protein coating conditions are 4 ℃ overnight coating (FIG. 15).

3. Selection of confining liquids

After E2 protein is coated on an ELISA plate, 5% of skimmed milk powder, 2% of BSA and 2% of gelatin are selected, 200 mu L of the protein is added into each hole, the mixture is sealed at 37 ℃ for 2h, and the optimal sealing condition is determined by utilizing a P/N value.

The best confining liquid is 5% skimmed milk powder (fig. 16).

4. Determination of optimal incubation time of primary antibody

The blocked ELISA plates were divided into three groups, and BVDV positive and negative sera were diluted according to 1.

The maximum P/N value is the optimum condition, so the optimum reaction time of the serum to be detected is 60min (figure 17).

5. Determination of optimal incubation time for Secondary antibody

After the primary antibody incubation was completed, the HRP-labeled rabbit anti-bovine IgG was diluted according to 1 4000, 100 μ L was added to each well, incubated at 37 ℃ for 30, 60, 90min, respectively, at least 3 replicates per group, and the optimal incubation time for the secondary antibody was determined using the P/N value after measuring the absorbance at 450 nm.

The optimal reaction time for the secondary antibody was also 60min (FIG. 17).

6. Determination of optimal incubation time for substrates

After the secondary antibody incubation is finished, 100 mu L of TMB single-component color development liquid is added into each hole, the incubation is carried out for 5min, 10min and 15min in a dark place at 37 ℃, 50 mu L of stop solution is added into each hole, the light absorption value is measured at 450nm, and the optimal incubation time is determined by utilizing the P/N value.

The optimal action time of the substrate was 10min (FIG. 18).

7. Determination of negative and positive serum critical value by indirect ELISA method

Calculating the critical value of the ELISA detection method by using 56 BVDV negative sera, and calculating the formula: positive cutoff = OD of 56 negative sera ₄₅₀ Mean +3 × standard deviation, negative cutoff = OD of 56 negative sera ₄₅₀ Mean +2 × standard deviation.

56 BVDV negative serum sample OD ₄₅₀ Has an average value of 0.218, a standard deviation of 0.026, a positive cutoff value of 0.296 for the sample, and a negative cutoff value of 0.270 for the sample. Thus, the OD of the serum sample is measured ₄₅₀ Greater than or equal to 0.296 as positive, OD ₄₅₀ < 0.270 was negative.

8. Specificity test of indirect ELISA method

After Bovine Rotavirus (BRV), bovine Coronavirus (BCV), bovine parainfluenza type III virus (BPIV-3), infectious rhinotracheitis virus (IBRV) positive serum and bovine viral diarrhea virus positive and negative serum are respectively diluted by 1-fold and 50-fold, 100 mu L of the diluted serum is added into each hole, each sample is repeated for at least three times, and whether the E2 indirect ELISA detection method has cross reaction with common bovine diseases is judged.

The E2 protein indirect ELISA is used for detecting positive sera of BRV, BCV, BPIV-3 and IBRV, and the results show that the positive sera are all negative (table 3), which indicates that the detection method of the E2 protein indirect ELISA does not generate cross reaction with the sera of common bovine viral diseases when detecting the positive sera of BVDV.

TABLE 3 results of specificity test

9. Sensitivity test by indirect ELISA method

BVDV-positive sera were diluted according to nine gradients (1.

OD when BVDV-positive serum dilution ratio was 1 ₄₅₀ Still greater than 0.296, positive reaction, indicating that the sensitivity of the indirect ELISA detection method for E2 protein established in this study is 1.

10. Reproducibility test of indirect ELISA method

Preparing ELISA coated plates by using the purified E2 proteins of the same batch and 3 different batches, respectively taking 4 parts of BVDV strong positive serum, weak positive serum and negative serum to detect, determining according to an E2 protein indirect ELISA method established in the research, repeating each sample for 3 times, performing statistical analysis according to a light absorption value measured at 450nm, and respectively judging the repeatability of the E2 protein in the batch and the repeatability among different batches.

The ELISA results of the same batch and different batches show that the variation coefficient of the batch repeatability is 3.1-7.4%, and the variation coefficient of the batch repeatability is 2.5-9.2% (Table 4), which are both less than 10%, which indicates that the indirect ELISA of the E2 protein has good repeatability.

TABLE 4 results of repeated measurements

11. Preliminary testing of clinical specimens

240 parts of BVDV serum was detected according to the E2 protein ELISA detection method established above, and the coincidence rate was determined by comparing it with a commercial kit (IDEXX, USA).

The indirect ELISA result of the E2 protein shows that 173 parts of positive serum and 67 parts of negative serum are detected in 240 parts of serum. The test result of the IDEXX kit shows that 198 parts of positive serum and 42 parts of negative serum are detected in 1240 parts of serum (Table 5). Compared with IDEXX results, 173 positive sera and 42 negative sera are detected in total, and the coincidence rate is (173 + 42) ÷ 240 × 100% =89.58%.

TABLE 5 detection of E2 protein ELISA clinical samples

Statistical analysis: the results of calculation were analyzed for one-way variance using SPSS Statistics 25 software, and the images for detection of antibody level, detection of antibody neutralizing activity, and detection of mouse spleen lymphocyte proliferation level were plotted using GraphPad Prism 7.

The above description is intended to be illustrative of the preferred embodiment of the present invention and should not be taken as limiting the invention, but rather, the intention is to cover all modifications, equivalents, and alternatives falling within the spirit and scope of the invention.

Sequence listing

<110> river university

<120> method for preparing bovine viral diarrhea virus E2 protein by using baculovirus expression system and application

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1059

<212> DNA

<213> Bovine viral diarrhea virus

<400> 1

atggtaagcg ctattgtttt atatgtgctt ttggcggcgg cggcgcattc tgcctttgcg 60

atccccgaat gcagatcgga ctggtcatac gcaatagccc gttcagaaaa aatcggtcca 120

ctgggagctg aggagctgac cacccaatgg tacgattatt ctgaaggtat gaggttgaag 180

gacgctatgg tagaggtttg gtgcacgaac ggtaaagtca aattcctgaa gaagtgtgcc 240

cgtgaggccc gttacctggc tgccttgcat accagagctt tgcccaccag cgtcgtgttc 300

aagcaacttc tctctggaca gaagttggcc gataatatcg acatggaaga caacttcgag 360

ttcggtttgt gtccatgcga tgcccgtccc gtcgtgaaag gtaagtttaa caccaccctg 420

ctgaacggcc ctgcgttcca aatggtctgc cccatcggat ggacgggttc agtggagtgc 480

acactggtta acaaggacac tctgcgtacc gcggttgtgc gcacctacaa acgtgccaag 540

cctttccccc gtcgccaagg ctgtgccaca cagaaactgg taggagagga cctctacgat 600

tgcatgttgg gcggcaactg gacatgcatt actggcgatc aggtcaaata cgcaggcggt 660

gaggtcaaga catgtaaatg gtgcggttac aactttcaag gaagcaaggg tttgccgcat 720

tacccgattg gaaagtgtaa gctcggcaac gagactggat acaggctggt cgacgaaacc 780

ccatgcaatc gcgacggcgt ggccatagtc ccccatggta aggtcaagtg taagataggt 840

gacaccgtcg ttcaggtgat tgcaatggac actaagctgg gcccaatgcc atgcacgcca 900

tatgagatca tcccatccga gggcccggtt gaaaagaccg catgcacctt caactacaca 960

aagaccctga aaaacaagca cttcgagcct agggattcat acttccagca gtacatgctg 1020

aagggagaat accagtactg gtttgacctg gacgctatc 1059

<210> 2

<211> 353

<212> PRT

<213> Bovine viral diarrhea virus

<400> 2

Met Val Ser Ala Ile Val Leu Tyr Val Leu Leu Ala Ala Ala Ala His

1 5 10 15

Ser Ala Phe Ala Ile Pro Glu Cys Arg Ser Asp Trp Ser Tyr Ala Ile

20 25 30

Ala Arg Ser Glu Lys Ile Gly Pro Leu Gly Ala Glu Glu Leu Thr Thr

35 40 45

Gln Trp Tyr Asp Tyr Ser Glu Gly Met Arg Leu Lys Asp Ala Met Val

50 55 60

Glu Val Trp Cys Thr Asn Gly Lys Val Lys Phe Leu Lys Lys Cys Ala

65 70 75 80

Arg Glu Ala Arg Tyr Leu Ala Ala Leu His Thr Arg Ala Leu Pro Thr

85 90 95

Ser Val Val Phe Lys Gln Leu Leu Ser Gly Gln Lys Leu Ala Asp Asn

100 105 110

Ile Asp Met Glu Asp Asn Phe Glu Phe Gly Leu Cys Pro Cys Asp Ala

115 120 125

Arg Pro Val Val Lys Gly Lys Phe Asn Thr Thr Leu Leu Asn Gly Pro

130 135 140

Ala Phe Gln Met Val Cys Pro Ile Gly Trp Thr Gly Ser Val Glu Cys

145 150 155 160

Thr Leu Val Asn Lys Asp Thr Leu Arg Thr Ala Val Val Arg Thr Tyr

165 170 175

Lys Arg Ala Lys Pro Phe Pro Arg Arg Gln Gly Cys Ala Thr Gln Lys

180 185 190

Leu Val Gly Glu Asp Leu Tyr Asp Cys Met Leu Gly Gly Asn Trp Thr

195 200 205

Cys Ile Thr Gly Asp Gln Val Lys Tyr Ala Gly Gly Glu Val Lys Thr

210 215 220

Cys Lys Trp Cys Gly Tyr Asn Phe Gln Gly Ser Lys Gly Leu Pro His

225 230 235 240

Tyr Pro Ile Gly Lys Cys Lys Leu Gly Asn Glu Thr Gly Tyr Arg Leu

245 250 255

Val Asp Glu Thr Pro Cys Asn Arg Asp Gly Val Ala Ile Val Pro His

260 265 270

Gly Lys Val Lys Cys Lys Ile Gly Asp Thr Val Val Gln Val Ile Ala

275 280 285

Met Asp Thr Lys Leu Gly Pro Met Pro Cys Thr Pro Tyr Glu Ile Ile

290 295 300

Pro Ser Glu Gly Pro Val Glu Lys Thr Ala Cys Thr Phe Asn Tyr Thr

305 310 315 320

Lys Thr Leu Lys Asn Lys His Phe Glu Pro Arg Asp Ser Tyr Phe Gln

325 330 335

Gln Tyr Met Leu Lys Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp Ala

340 345 350

Ile

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tattccggat tattcatacc 20

<210> 4

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

acaaatgtgg tatggctga 19

Claims

1. A method for preparing bovine viral diarrhea virus E2 protein by a baculovirus expression system is characterized by comprising the following steps:

adding a His label at the front end of a BVDV-LC E2 gene sequence, and connecting to a pFastBac1 plasmid to obtain a recombinant transfer vector; the BVDV-LC E2 gene sequence is shown in SEQ ID NO. 1;

transformation of recombinant transfer vectors to e.coli DH10Bac by homologous recombination ^TM Obtaining recombinant bacmid;

transfecting Sf9 insect cells with recombinant bacmid to obtain P1 generation recombinant baculovirus; the culture condition of Sf9 insect cells is 27 ℃;

and then the P2 generation virus is subjected to amplification culture and then purified to obtain the E2 protein.

2. The use of the bovine viral diarrhea virus E2 protein prepared by the method of claim 1 in an indirect ELISA detection method for the E2 protein for non-diagnostic purposes; in the indirect ELISA detection method, the optimal coating concentration of the E2 protein is 5 mug/mL, the optimal dilution concentration of the primary antibody is 1; the optimal coating condition of the E2 protein is 4 ℃ overnight coating; the optimal sealing liquid is 5% of skimmed milk powder; the optimal reaction time is 60min; the optimal reaction time of the secondary antibody is also 60min; the optimal action time of the substrate is 10min.