CN111116720A - Classical swine fever virus recombinant E2 protein and application thereof - Google Patents
Classical swine fever virus recombinant E2 protein and application thereof Download PDFInfo
- Publication number
- CN111116720A CN111116720A CN202010112369.7A CN202010112369A CN111116720A CN 111116720 A CN111116720 A CN 111116720A CN 202010112369 A CN202010112369 A CN 202010112369A CN 111116720 A CN111116720 A CN 111116720A
- Authority
- CN
- China
- Prior art keywords
- recombinant
- swine fever
- sequence
- classical swine
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
- A61K2039/552—Veterinary vaccine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/14011—Baculoviridae
- C12N2710/14021—Viruses as such, e.g. new isolates, mutants or their genomic sequences
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/14011—Baculoviridae
- C12N2710/14041—Use of virus, viral particle or viral elements as a vector
- C12N2710/14043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vectore
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/24011—Flaviviridae
- C12N2770/24311—Pestivirus, e.g. bovine viral diarrhea virus
- C12N2770/24322—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/24011—Flaviviridae
- C12N2770/24311—Pestivirus, e.g. bovine viral diarrhea virus
- C12N2770/24334—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
Abstract
The invention discloses a preparation method and application of a baculovirus expression classical swine fever E2 recombinant subunit vaccine. The classical swine fever E2 recombinant subunit vaccine comprises classical swine fever virus recombinant E2 protein and a pharmaceutically acceptable adjuvant. The amino acid sequence of the classical swine fever virus recombinant E2 protein is an amino acid sequence shown in 1 st to 339 th sites of an amino terminal of a sequence 3 in a sequence table, an amino acid sequence shown in the sequence 3 in the sequence table, an amino acid sequence shown in 1 st to 339 th sites of an amino terminal of a sequence 4 in the sequence table, or an amino acid sequence shown in the sequence 4 in the sequence table. After being used for immunizing pigs, the swine fever E2 recombinant subunit vaccine provided by the invention can be induced to generate specific antibodies, and has the advantages of strong immunogenicity, good safety and matching with the current epidemic strains; meanwhile, the vaccine immunity and wild virus infected animals can be distinguished through differential diagnosis, and the method can be used for purifying the classical swine fever virus.
Description
Technical Field
The invention relates to a classical swine fever virus recombinant E2 protein and application thereof; in particular to a classical swine fever virus recombinant E2 protein and a method for preparing a recombinant subunit vaccine by expressing the classical swine fever virus recombinant E2 protein through baculovirus and application. The invention belongs to the technical field of animal vaccines and biological products for animals.
Background
Classical Swine Fever (CSF) is a highly contagious and lethal disease caused by infection of domestic and wild boars with Classical Swine Fever Virus (CSF Virus, CSFV). The outbreak of swine fever usually causes huge economic loss, is classified as A-class infectious disease by OIE, and is one of the main epidemic diseases which harm the swine industry in China at present.
CSFV is a single-stranded positive-strand RNA virus belonging to the genus pestivirus of the family Flaviviridae. The CSFV genome is about 12.3kb long, encodes an open reading frame of about 3898 amino acids, and is processed into 12 mature proteins including four structural proteins (Core, E) under the action of host cell signal peptide and viral proteasernsE1 and E2) and eight non-ringsStructural protein (N)proP7, NS2, NS3, NS4A, NS4B, NS5A, and NS 5B). The structural protein E2 is a main protective antigen of the virus, induces an organism to generate a neutralizing antibody, can resist the attack of a lethal CSFV virulent strain, and is also an important target protein for developing a swine fever genetic engineering vaccine.
In recent years, the prevalence of swine fever in China is continuously reduced and sporadically distributed, wherein the continuous virus infection of sows is a main infection source. From the gene subtypes, the main epidemic gene subtypes in our country are 2.1, 2.2, 2.3 and 1.1 types in about 2000, and the subtypes 2.2 and 2.3 gradually decrease; in 2017, the gene subtypes are mainly 2.1 and 1.1, and the proportion is 97 percent and 3 percent respectively.
China pays great attention to the prevention and control of swine fever, and has clear requirements on the purification of porcine reproductive and respiratory syndrome and swine fever in a pig farm. The immunization is a main measure for preventing and controlling the occurrence and prevalence of the swine fever, and the quality of the swine fever vaccine directly influences the immune effect of the swine fever. The traditional hog cholera lapinized virus live vaccine comprises a splenic gonorrhea vaccine, a primary cell vaccine and an ST passage cell vaccine, and the vaccine cannot distinguish vaccine immunity from wild virus infected animals and cannot meet the requirement of hog cholera purification. Under the background that the prevalence rate of the swine fever is low at present, the immunization of the vaccine is fully covered, and the requirement of governments and markets for the vaccine capable of providing DIVA identification is met, the development of the subunit vaccine matched with the current epidemic strains has positive significance for the purification of the future swine fever.
Disclosure of Invention
The invention aims to develop the classical swine fever E2 recombinant subunit vaccine, which not only has the equivalent immune efficacy with the classical swine fever lapinized attenuated virus C strain vaccine, but also the vaccine immunized animal only generates the antibody aiming at the E2 protein, and the E can pass throughrnsThe antibody diagnosis kit carries out DIVA differentiation, and the matching degree of the corresponding genotype and the current domestic epidemic strains is higher, thereby avoiding the influence caused by the gene difference generated by the gradual deviation of the evolution trend of the epidemic strains from the attenuated vaccine strains and providing guarantee for the purification of the swine fever in the future.
Based on the above, the invention aims to provide a classical swine fever virus E2 subunit vaccine, and a preparation method and application thereof.
The classical swine fever virus E2 subunit vaccine comprises classical swine fever virus recombinant E2 protein and a pharmaceutically acceptable adjuvant, such as ISA 201VG adjuvant.
The invention provides a classical swine fever virus recombinant E2 protein which is a CSFV 1.1 type or 2.1d type E2 protein truncation (tE2), and specifically, the amino acid sequence of the recombinant E2 protein is an amino acid sequence shown in 1 st to 339 th sites of an amino terminal of a sequence 3 in a sequence table, an amino acid sequence shown in the sequence 3 in the sequence table (a carboxyl terminal is connected with a His label), an amino acid sequence shown in 1 st to 339 th sites of an amino terminal of a sequence 4 in the sequence table, or an amino acid sequence shown in the sequence 4 in the sequence table (a carboxyl terminal is connected with a His label).
The invention also provides a classical swine fever virus recombinant E2 gene, which is a coding gene of the classical swine fever virus recombinant E2 protein, and specifically, the classical swine fever virus recombinant E2 gene is a nucleotide sequence from 1 to 1017 th site at the 5 'end of a sequence 1 in a self-sequence list, a nucleotide sequence shown in a sequence 1 in a sequence list, a nucleotide sequence from 1 to 1017 th site at the 5' end of a sequence 2 in the self-sequence list, or a nucleotide shown in a sequence 2 in the sequence list.
The CSFV 1.1 type tE2 amino acid sequence of the truncated body (tE2) of the CSFV E2 protein is an amino acid sequence shown in the 1 st to 339 th site of the amino terminal of a sequence 3 in a sequence table, a coding sequence is nucleotides from the 5' end 1 to 1017 th site of the sequence 1, a CSFV 1.1 type tE2 amino acid sequence carrying a His label is shown in the sequence 3, and a coding sequence is the sequence 1. The amino acid sequence of CSFV 2.1d type tE2 is shown as the 1 st to 339 th site of the amino terminal of the sequence 4 in the sequence table, the coding sequence is the 1 st to 1017 th site nucleotide of the 5' end of the sequence 1, the amino acid sequence of CSFV 2.1d type tE2 carrying His label is shown as the sequence 4, and the nucleotide sequence is shown as the sequence 2. The nucleotide sequence of the gp67 signal peptide is shown in a sequence 5, and the amino acid sequence of the gp67 signal peptide is shown in a sequence 6.
The invention also aims to provide a recombinant expression vector for expressing the classical swine fever virus recombinant E2 protein, which is a recombinant expression vector for expressing the classical swine fever virus recombinant E2 protein carrying gp67 signal peptide, obtained by cloning the gp67 signal peptide coding gene and the classical swine fever virus recombinant E2 gene into a shuttle vector pFastBac 1; wherein, the nucleotide sequence of the gp67 signal peptide is shown in a sequence 5, and the amino acid sequence of the gp67 signal peptide is shown in a sequence 6.
The invention also aims to provide a recombinant baculovirus expressing the classical swine fever virus recombinant E2 protein, which is characterized in that the recombinant baculovirus is a recombinant baculovirus which is obtained by transforming an escherichia coli DH10Bac competent cell with the recombinant expression vector of claim 3, screening a positive expression recombinant bacterium, transfecting an insect cell Sf9 with the obtained recombinant Bacmid, rescuing the recombinant baculovirus and expressing the classical swine fever virus recombinant E2 protein.
The invention also provides a preparation method of the classical swine fever virus E2 subunit vaccine, and the purpose of the invention is realized by the following steps: the artificially synthesized signal peptide and the gene encoding the CSFV type 1.1 or type 2.1d E2 protein truncation (tE2) are cloned to a commercial baculovirus expression vector pFastBac1 according to codon preference to obtain recombinant shuttle plasmids pFastBac1-1.1tE2 or pFastBac1-2.1dtE 2. Then, the recombinant shuttle plasmid is transformed into an escherichia coli DH10Bac competent cell, and a positive colony is screened through a blue-white spot, namely Bacmid-1.1tE2 or Bacmid-2.1dtE2 is recombined. The recombinant Bacmid is transfected into an insect cell Sf9 to obtain a recombinant baculovirus expressing CSFV type 1.1 or 2.1d tE2 protein. And infecting insect cells with High Five at the logarithmic phase by the recombinant baculovirus, performing amplification culture, and purifying to obtain the tE2 protein. And mixing the tE2 and pharmaceutically acceptable adjuvant to obtain the swine fever E2 recombinant subunit vaccine.
Further, the method comprises the steps of:
(1) and infecting insect cells High Five in logarithmic phase with the obtained recombinant baculovirus, performing amplification culture, and purifying to obtain the classical swine fever virus recombinant E2 protein.
(2) And (2) fully and uniformly mixing the recombinant E2 protein obtained in the step (1) with a pharmaceutically acceptable adjuvant to obtain the classical swine fever E2 recombinant subunit vaccine.
The specific operation steps are as follows:
1. construction of recombinant baculovirus expressing hog cholera E2 protein
(1) Acquisition of the E2 gene: comparing the gene sequences of classical swine fever virus E2 disclosed by NCBI, and screening out 1.1 d and 2.1d type gene information aiming at the current epidemic strain and vaccine strain information; then, genes of 1.1tE2 (sequence 1 in the sequence table) and 2.1dtE2 (sequence 2 in the sequence table) were artificially synthesized according to the codon preference of insects, respectively, and the sequences included truncated tE2 from which the transmembrane region of the E2 gene was removed and a tag of 6 XHis.
(2) Construction of recombinant shuttle plasmid: inserting the artificially synthesized gp67 signal peptide sequence into a baculovirus shuttle vector pFastBac1 to obtain a recombinant plasmid pFastBac1-gp 67; then, genes 1.1tE2 and 2.1dtE2 are respectively inserted into recombinant plasmids pFastBac1-gp67, and recombinant shuttle plasmids pFastBac1-1.1tE2 and pFastBac1-2.1dtE2 are constructed.
(3) Extraction of recombinant Bacmid: the recombinant shuttle plasmids pFastBac1-1.1tE2 and pFastBac1-2.1dtE2 are respectively transformed into escherichia coli DH10Bac competent cells, Tn7 transposition occurs, and recombinant Bacmid-1.1tE2 and Bacmid-2.1dtE2 are obtained through at least three times of blue-white spot screening.
(4) Rescue of recombinant baculovirus: recombinant Bacmid-1.1tE2 and Bacmid-2.1dtE2 DNA 5. mu.g were transfected with 1X 106Adherent insect cells Sf9, culture supernatant was harvested at 72 hours to obtain 2ml of recombinant baculovirus of P1 generation.
(5) Amplification of recombinant baculovirus: two generations of P1 recombinant baculovirus were separately infected with 1X 10 of 1ml at log phase7Adherent insect cell Sf9, the cell became large and round obviously 48 hours after infection, 10ml of virus liquid was harvested 72 hours and recorded as P2 generation virus; further, two recombinant viruses were separately added in a volume ratio of 1:100 infection of Sf9 cells in suspension at log phase amplified virus in large quantities and culture supernatants were harvested 72 hours post infection and scored as P3 virus.
2. Expression and purification of tE2 protein
(1) Expression of tE2 protein: infecting the suspension insect cells High Five in logarithmic phase with P3 recombinant baculovirus in the volume ratio of 1:4 for amplification culture at the cell density of 2 × 106200ml of P3 generation baculovirus was inoculated into 800ml cell suspension of the cell/ml, and culture supernatant was harvested after 48 hours of culture.
(2) Purification of tE2 protein: firstly, 1000ml of culture supernatant is filtered by a 0.22 mu m filter membrane, then is loaded to a HisTrap HP 5ml nickel column pre-packed column by a peristaltic pump at the flow rate of 1ml/min, after loading, the mixed protein and the unbound protein are washed off by a buffer solution (20mM NaCl,50mM Tris-HCl, pH 8.0) containing 20mM imidazole in an AKTA purifier, then the target protein is washed off by a buffer solution containing 300mM imidazole, and a sample containing the target protein is collected for the next step of gel filtration chromatography by combining the electrophoresis result of SDS-PAGE; then, the sample obtained from the previous step of purification is purified by a GE HiLoadSuperdex 16/600200pg column in an AKTA purifier to obtain the target protein.
3. The classical swine fever virus tE2 protein and ISA 201VG adjuvant are emulsified to prepare the vaccine: mixing a quantitative classical swine fever virus tE2 protein and ISA 201VG according to the volume ratio of 1:1 to prepare the classical swine fever virus E2 subunit vaccine.
After being used for immunizing pigs, the swine fever E2 recombinant subunit vaccine provided by the invention can be induced to generate specific antibodies, and has the advantages of strong immunogenicity, good safety and matching with the current epidemic strains; meanwhile, the vaccine immunity and wild virus infected animals can be distinguished through differential diagnosis, and the method can be used for purifying the classical swine fever virus.
Drawings
FIG. 1 is a diagram of the cellular pathology of insect cell Sf9 infected with recombinant baculovirus expressing classical swine fever virus recombinant E2 protein (tE2), and Sf9 is a cell negative control without virus infection.
FIG. 2 is a result diagram of Western blot immunological identification of a classical swine fever virus recombinant E2 protein (tE2) recombinant baculovirus, wherein the diagram (A) is an identification result diagram of anti-His monoclonal antibody, and the diagram (B) is an identification result diagram of classical swine fever virus specific anti-E2 monoclonal antibody.
FIG. 3 is a SDS-PAGE result of affinity chromatography purified classical swine fever virus recombinant E2 protein (tE2), lanes 2 and 3 are tE2 protein monomer form, and the size of 1.1 and 2.1d type classical swine fever virus recombinant E2 protein (tE2 protein) with the same nucleotide size is slightly different on the SDS-PAGE picture, which is caused by the difference of glycosylation modification positions of the protein expressed by the constructed classical swine fever virus E2 recombinant baculovirus system; lanes 4 and 5 are the dimeric form of tE2 (no DTT in loading buffer), demonstrating that the protein expressed by the constructed classical swine fever virus E2 recombinant baculovirus system is able to fold correctly to form a dimeric structure. Glycosylation and dimer formation ensure the immunogenicity of the subunit vaccine.
FIG. 4 is a graph showing the results of the antibody production levels of the subunit vaccines of classical swine fever virus type 1.1, recombinant E2 protein (1.1tE2) or 2.1d, recombinant E2 protein (2.1dtE2) after immunization of piglets, respectively.
Detailed Description
Preferred embodiments of the present invention will be further described with reference to the following specific examples. It will be understood by those skilled in the art that changes and modifications may be made therein without departing from the spirit and scope of the invention as defined in the following claims.
The test materials and test reagents used in the following examples are commercially available unless otherwise specified.
Plasmid pFastBac1 used in the examples described belowTMEscherichia coli DH10Bac was purchased from Invitrogen, USA; transfection reagent Lipofectamine 3000 from ThermoFisher; insect cells Spodoptera frugiperdaSf9 and High FiveTMPurchased from american type culture center ATCC; HisTrap HP 5ml Nickel column Pre-column and HiLoad Superdex 16/600200pg gel filtration columns were purchased from GE.
Example 1: rescue and amplification of recombinant baculovirus expressing classical swine fever virus recombinant E2 protein (tE2)
1. An artificially synthesized baculovirus gp67 signal peptide sequence (sequence 5 in a sequence table) is loaded into a vector pFastBac1 through BamH I and Pst I enzyme cutting sitesTMObtaining a recombinant plasmid pFastBac1-gp 67;
comparing the gene sequences of classical swine fever virus E2 disclosed by NCBI, and screening out 1.1 d and 2.1d type gene information aiming at the current epidemic strain and vaccine strain information; then, genes of 1.1tE2 (sequence 1 in the sequence table) and 2.1dtE2 (sequence 2 in the sequence table) were artificially synthesized according to the codon preference of insects, respectively, and the sequences included truncated tE2 from which the transmembrane region of the E2 gene was removed and a tag of 6 XHis. 1.1tE2 and 2.1dtE2 are respectively loaded into a recombinant vector pFastBac1-gp67 through Pst I and Xho I enzyme cutting sites, and recombinant shuttle plasmids pFastBac1-1.1tE2 and pFastBac1-2.1dtE2 are constructed. This step is directly synthesized and constructed by gene synthesis company according to the requirement.
2. Blue and white spot screening
(1) And (3) transformation: taking 1 ul (about 100ng) of each of shuttle vectors pFastBac1-1.1tE2 and pFastBac1-2.1dtE2, respectively adding 50 ul of escherichia coli DH10Bac competent cells, lightly flicking an Ep tube to mix the plasmid and the competent cells uniformly, and placing the Ep tube on ice for 30 minutes; then, immediately placing the mixture on ice for cooling for 1-2 minutes after heat shock is carried out on the mixture for 90 seconds in a 42-DEG water bath; mu.l of non-resistant LB medium was added and cultured at 37 ℃ for 4 hours at a speed of 220 rpm.
(2) Blue-white screening: taking 50 mu l of the bacterial liquid, coating an LB plate containing 50 mu g/ml kanamycin, 7 mu g/ml gentamicin and 10 mu g/ml tetracycline (KTG three-resistant), 100 mu g/ml Bluo-gal and 40 mu g/ml IPTG on the bacterial liquid, placing the plate in a 37-degree incubator for culturing for 48 hours, picking white spots on 500 mu l of KTG three-resistant LB culture medium, and culturing at 37 ℃ and 220rpm overnight; taking 1-ring of the bacterial liquid by using an inoculating loop, scribing on an LB (Langmuir-Bluet) plate containing KTG (Kalanchol-Kalanchol) three-antibody, Bluo-gal and IPTG (isopropyl-beta-thiogalactoside) and placing the plate in a 37-degree incubator for culturing for 48 hours; repeating the steps for at least 3 times to obtain the recombinant Escherichia coli positive bacteria.
3. Acquisition of recombinant Bacmid
(1) Inoculating 50 μ l of recombinant Escherichia coli positive bacteria liquid into 5ml of KTG three-resistant LB culture medium, and culturing overnight (16 hours) at 37 ℃ and 220rpm with shaking;
(2) transferring the bacterial liquid to a 1.5ml Ep tube, centrifuging at 12000rpm for 1 minute, and absorbing the supernatant as much as possible;
performing operations (3) to (5) according to the instruction of the TIANGEN plasmid miniprep kit:
(3) adding 250 mul of solution P1 into the Ep tube with the bacteria, and suspending the bacteria;
(4) then adding 250 mul of solution P2 into an Ep tube, turning up and down gently and mixing uniformly for 6-8 times to ensure that the thalli are fully cracked;
(5) adding 350 μ l of solution P3 to obtain white flocculent precipitate, immediately turning gently up and down for 6-8 times, mixing well, and centrifuging at 12000rpm for 10 min;
(6) transferring 500. mu.l of the supernatant to a new Ep tube by using a pipette, adding phenol, chloroform, isoamyl alcohol (25:24:1) in the same volume, mixing the mixture by turning the mixture upside down, and centrifuging the mixture at 12000rpm for 5 minutes;
(7) transferring 500. mu.l of the upper layer liquid to a new Ep tube, adding chloroform in the same volume, turning upside down and mixing evenly, and centrifuging at 12000rpm for 10 minutes;
(8) transferring 400 μ l of the supernatant liquid to a new Ep tube, adding 1/10 volume of 3M sodium acetate, then adding 2.5 volume times of ethanol, mixing by turning upside down, and precipitating at-20 deg.C overnight;
(9) taking out the previous step in an Ep tube with the temperature of-20 ℃, centrifuging at 4 ℃ and 12000rpm for 15 minutes, then adding 1ml of 75% ethanol solution for cleaning once, centrifuging at 4 ℃ and 12000rpm for 5 minutes, discarding the upper liquid as much as possible, and drying at room temperature for 10 minutes;
(10) add 100. mu.l deionized water to the bottom of Ep tube, prevent 2 minutes at room temperature, gently blow the tube evenly with a pipette, take 2. mu.l Bacmid DNA and measure its concentration.
4. Rescue of recombinant baculovirus expressing classical swine fever virus tE2
(1) Sf9 cells are subcultured and spread in 6-well cell culture plates, and the monolayer cells to be attached are as long as about 90% (about 1X 10)6) Washing the cells twice with PBS, and then adding 1.8ml of serum-free Grace culture medium;
(2) taking two 1.5mL sterile Ep tubes, adding 100 ul Grace culture medium into each tube, adding 10 ul liposome Lipofectamine 3000 into one tube, adding 5 ug Bacmid DNA and 10 ug l P3000 reagent into the other tube, mixing the liquid in the two tubes uniformly and placing for 5 minutes;
(3) the mixed solution is added into a 6-hole cell culture plate, the mixed solution is gently shaken and uniformly mixed, and after the mixed solution is continuously cultured in an incubator at 28 ℃ for 72 hours, 2ml of first-generation recombinant baculovirus is harvested and recorded as P1, and the mixed solution is stored at 4 ℃ in a dark place.
5. Identification and amplification of recombinant baculovirus expressing classical swine fever virus tE2
(1) 1X 10 in log phase into 100mm cell culture dishes71ml of P1 generation recombinant baculovirus is added into adherent insect cell Sf9, compared with a control group of non-toxic Sf9 cell, the cell inoculated with the P1 generation virus is obviously enlarged and rounded (shown in figure 1) 48 hours after infection, and 10ml of culture supernatant is harvested 72 hours and is marked as P2 generation virus;
(2) meanwhile, 20 mu l of the culture supernatant obtained in the step (1) is taken, 5 mu l of 5 Xprotein loading buffer is added to prepare a protein sample, 10 mu l of protein sample SDS-PAGE is taken, and the protein sample is identified by anti-His monoclonal antibody and classical swine fever virus specific anti-E2 monoclonal antibody Westernblotting respectively, and the result is shown in figure 2, wherein the two monoclonal antibodies can be specifically combined with 1.1tE2 and 2.1dtE2 proteins respectively;
(3) sf9 suspension cells 1 liter to 2 liter glass triangle bottle, when the cells grow to logarithmic phase (density 2X 10)6/ml), the P2 virus was added at a volume ratio of 1:100, and the culture supernatant was harvested 72 hours after infection and designated as P3 virus.
Example 2: expression and purification of tE2 recombinant protein
1. Expression of the tE2 protein
Insect cell High Five suspension cell 800ml passage to 2 liter glass triangle bottle, when the cell growth to logarithmic phase (density of 2.5X 10)6Perml), 200ml of the P3 virus was added at a volume ratio of 1:4 to perform scale-up culture, and the culture supernatant was harvested by centrifugation at 5000rpm for 20 minutes after 48 hours of culture.
2. Purification of the tE2 protein
(1) Filtering 1000ml of culture supernatant with a 0.22 μm filter membrane, loading the filtered culture supernatant onto a HisTrap HP 5ml nickel column pre-packed column by a peristaltic pump at a flow rate of 1ml/min, washing away the contaminating proteins and unbound proteins in an AKTA purifier with a buffer containing 20mM imidazole (20mM NaCl,50mM Tris-HCl, pH 8.0), then washing down the proteins of interest with a buffer containing 300mM imidazole, collecting 20 μ l of each stage of protein sample, adding 5 μ l of 5 × loadingbuffer, placing on ice after boiling water bath for 10 minutes;
(2) taking 10 mu l of protein sample SDS-PAGE electrophoresis, and collecting a sample containing the target protein by combining the SDS-PAGE electrophoresis result for the next step of gel filtration chromatography;
(3) purifying the sample obtained from the last step by GE HiLoad Superdex 16/600200pg column in AKTA purifier to obtain target protein, taking 10 μ l protein sample for SDS-PAGE electrophoresis to identify (shown in figure 3), and concentrating the target protein by using 10kD ultrafiltration tube.
(4) The BCA method determines that the protein concentration is 2mg/ml, the volume is about 20-25ml, and the expression quantity of the tE2 protein can be calculated to be as high as 50 mg/L.
Example 3: preparation of subunit vaccine of hog cholera E2
Adding 5ml of ISA 201VG adjuvant into a 20ml beaker with a rotor, starting a magnetic stirrer, adjusting to 6-stage, pouring 5ml of water phase (containing tE2 protein 1.1tE2 or 2.1dtE2) into the beaker to enable the final concentration of the protein to be 40 mug/2 ml, pouring for about 5 seconds, emulsifying for 5min after vortex is stabilized, closing the magnetic stirrer, filling the vaccine into a 20ml bottle, and capping and labeling; and 4 degrees are stored for later use.
Example 4: immunization test of swine fever E2 subunit vaccine on piglets
Screening of 30-day-old-aged 20 swine with hog cholera virus negative antibody was performed for evaluation of antibody level, and randomly divided into 4 groups and 5 groups. Wherein 2 groups of neck muscle are immunized with 2ml of 1.1tE2 and 2.1dtE2 subunit vaccines respectively, and the immunization is strengthened once after 21 days of primary immunization; 1 group of commercial swine fever live vaccines (passage cell source) are immunized once with the dosage of 1 part per head; group 1 served as a negative control, immunized with 2ml of PBS. Serum was collected once a week after immunization and tested for classical swine fever virus E2 antibody titer by IDEXX blocking ELISA.
TABLE 1 blocking ELISA results after immunization of piglets
As can be seen from the results in table 1 and fig. 4, the blocking rate of both the 1.1tE2 and 2.1dtE2 subunit vaccines 14 days after one immunization was significantly higher than that of a commercial classical swine fever live vaccine (subculture cell source), and the antibody blocking rate was greater than 70% at 21 days after one immunization, which was theoretically sufficient to protect the herd from classical swine fever virus infection; the blocking rate is increased to more than 90% 7 days and 14 days after the secondary immunization, and is obviously higher than that of the commercial swine fever live vaccine; in addition, the blocking rate of the 2.1dtE2 immune group was higher than that of the 1.1tE2 immune group at 14, 21, 28 and 35 days after immunization. This data demonstrates that our 1.1tE2 and 2.1dtE2 subunit vaccines can be used as candidate marker vaccines for swine fever, and especially have positive significance for the current domestic epidemic type 2.1 swine fever virus infection.
Sequence listing
<110> Zhongmu industries GmbH
<120> classical swine fever virus recombinant E2 protein and application thereof
<130>WHOI201006
<170>Patent-In 3.5
<160>6
<210>1
<211>1038
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
cgtttggctt gcaaggagga ctacagatac gccatcagca gcaccaacga gatcggattg 60
ttgggcgccg gcggattgac caccacctgg aaggagtact cccacgactt gcagttgaac 120
gacggaaccg tcaaggctat ctgcgtcgcc ggttcattca aggtgaccgc tctgaacgtc 180
gtgtcccgta gatacctggc ctccttgcac aagggagctt tgctgacctc cgtgaccttc 240
gagcttttgt tcgacggtac aaaccctagc accgaggaga tgggcgacga cttcggtttc 300
ggcctctgcc cattcgacac ctccccagtc gtcaagggaa agtacaacac caccctgttg 360
aacggtagcg ctttctacct cgtctgccct atcggatgga ccggagtcat cgagtgcacc 420
gctgtgtccc caaccaccct cagaaccgag gtcgtgaaga ccttccgtag agagaagcca 480
ttccctcaca gaatggactg cgtgaccacc accgtggaga acgaggactt gttctactgc 540
aagttgggcg gtaactggac ctgcgtcaag ggtgagcctg tggtctacac cggcggccag 600
gtgaagcagt gcaagtggtg cggattcgac ttcaacgagc cagacggttt gcctcactac 660
ccaatcggta agtgcatctt ggctaacgag accggttaca gaatcgtgga cagcaccgac 720
tgcaacaggg acggtgtggt catcagcgct gagggtagcc acgagtgctt gatcggaaac 780
accaccgtca aggtccacgc tagtgacgagaggctcggcc ctatgccatg ccgcccaaag 840
gagatcgtgt ccagcgctgg tcctgtgcgt aagacctcct gcaccttcaa ctacgctaag 900
accctgaaga acaagtacta cgagccccgc gacagctact tccagcagta catgctgaag 960
ggtgagtacc agtactggtt cgacttggac gtgaccgaca ggcactccga ctacttccac 1020
caccaccacc accactaa 1038
<210>2
<211>1038
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
aggctcagct gcaaggagga ctacagatac gccatctcca gcaccaacga gatcggccca 60
ttgggtgctg agggattgac caccacctgg cgcgagtaca gccacggtct ccagttggac 120
gacggaaccg tcagagctat ctgcaccgcc ggtagcttca aggtgatcgc tctgaacgtc 180
gtgtcccgta gatacttggc ctccttgcac aagcgcgctt tgcctacctc cgtgaccttc 240
gagttgctgt tcgacggaac ctcccccgct atcgaggaga tgggcgacga cttcggattc 300
ggattgtgcc cattcgacac cacccccgtc gtcaagggta agtacaacac caccctgttg 360
aacggtagcg ctttctactt ggtctgccca atcggatgga ccggtgtcat cgagtgcacc 420
gctgtgtccc caaccaccct cagaaccgag gtcgtgaaga ccttcaagcg tgagaagcca 480
ttccctcaca gagtggactg cgtgaccacc atcgtggaga aggaggactt gttctactgc 540
aagtggggcg gcaactggac ctgcgtgaag ggtaaccctg tgacctacat gggcggccag 600
gtgaagcagt gcaagtggtg cggtttcgac ttcaaggagc ctgacggttt gcctcactac 660
ccaatcggaa agtgcatctt ggctaacgag accggttaca gagtcgtgga cagcaccgac 720
tgcaacaggg acggtgtggt catcagcacc gagggagagc acgagtgctt gatcggaaac 780
accaccgtca aggtccacgc tctggacggc aggctgggtc ctatgccatg ccgccctaag 840
gagatcgtct cctccgccgg cccagtccgt aagacctcct gcaccttcaa ctacaccaag 900
accctgaaga acaagtacta cgagcctaga gacagctact tccagcagta catgttgaag 960
ggcgagtacc agtactggtt cgacttggac gctaccgacc accacaccga ctacttccac 1020
caccaccacc accactaa 1038
<210>3
<211>345
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>3
Arg Leu Ala Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Ser Thr Asn
1 5 10 15
Glu Ile Gly Leu Leu Gly Ala Gly Gly Leu Thr Thr Thr Trp Lys Glu
20 25 30
Tyr Ser His Asp Leu Gln Leu Asn Asp Gly Thr Val Lys Ala Ile Cys
35 40 45
Val Ala Gly Ser Phe Lys Val Thr Ala Leu Asn Val Val Ser Arg Arg
50 55 60
Tyr Leu Ala Ser Leu His Lys Gly Ala Leu Leu Thr Ser Val Thr Phe
65 70 75 80
Glu Leu Leu Phe Asp Gly Thr Asn Pro Ser Thr Glu Glu Met Gly Asp
85 90 95
Asp Phe Gly Phe Gly Leu Cys Pro Phe Asp Thr Ser Pro Val Val Lys
100 105 110
Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val
115 120 125
Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Pro
130 135 140
Thr Thr Leu Arg Thr Glu Val Val Lys Thr Phe Arg Arg Glu Lys Pro
145 150 155 160
Phe Pro His Arg Met Asp Cys Val Thr Thr Thr Val Glu Asn Glu Asp
165 170 175
Leu Phe Tyr Cys Lys Leu Gly Gly Asn Trp Thr Cys Val Lys Gly Glu
180 185 190
Pro Val Val Tyr Thr Gly Gly Gln Val Lys Gln Cys Lys Trp Cys Gly
195 200 205
Phe Asp Phe Asn Glu Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys
210 215 220
Cys Ile Leu Ala Asn GluThr Gly Tyr Arg Ile Val Asp Ser Thr Asp
225 230 235 240
Cys Asn Arg Asp Gly Val Val Ile Ser Ala Glu Gly Ser His Glu Cys
245 250 255
Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Ser Asp Glu Arg Leu
260 265 270
Gly Pro Met Pro Cys Arg Pro Lys Glu Ile Val Ser Ser Ala Gly Pro
275 280 285
Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Ala Lys Thr Leu Lys Asn
290 295 300
Lys Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys
305 310 315 320
Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp Val Thr Asp Arg His Ser
325 330 335
Asp Tyr Phe His His His His His His
340 345
<210>4
<211>345
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>4
Arg Leu Ser Cys Lys Glu Asp Tyr Arg Tyr Ala Ile Ser Ser Thr Asn
1 5 1015
Glu Ile Gly Pro Leu Gly Ala Glu Gly Leu Thr Thr Thr Trp Arg Glu
20 25 30
Tyr Ser His Gly Leu Gln Leu Asp Asp Gly Thr Val Arg Ala Ile Cys
35 40 45
Thr Ala Gly Ser Phe Lys Val Ile Ala Leu Asn Val Val Ser Arg Arg
50 55 60
Tyr Leu Ala Ser Leu His Lys Arg Ala Leu Pro Thr Ser Val Thr Phe
65 70 75 80
Glu Leu Leu Phe Asp Gly Thr Ser Pro Ala Ile Glu Glu Met Gly Asp
85 90 95
Asp Phe Gly Phe Gly Leu Cys Pro Phe Asp Thr Thr Pro Val Val Lys
100 105 110
Gly Lys Tyr Asn Thr Thr Leu Leu Asn Gly Ser Ala Phe Tyr Leu Val
115 120 125
Cys Pro Ile Gly Trp Thr Gly Val Ile Glu Cys Thr Ala Val Ser Pro
130 135 140
Thr Thr Leu Arg Thr Glu Val Val Lys Thr Phe Lys Arg Glu Lys Pro
145 150 155 160
Phe Pro His Arg Val Asp Cys Val Thr Thr Ile Val Glu Lys Glu Asp
165 170 175
Leu Phe Tyr Cys Lys Trp Gly Gly Asn Trp Thr Cys Val Lys Gly Asn
180 185 190
Pro Val Thr Tyr Met Gly Gly Gln Val Lys Gln Cys Lys Trp Cys Gly
195 200 205
Phe Asp Phe Lys Glu Pro Asp Gly Leu Pro His Tyr Pro Ile Gly Lys
210 215 220
Cys Ile Leu Ala Asn Glu Thr Gly Tyr Arg Val Val Asp Ser Thr Asp
225 230 235 240
Cys Asn Arg Asp Gly Val Val Ile Ser Thr Glu Gly Glu His Glu Cys
245 250 255
Leu Ile Gly Asn Thr Thr Val Lys Val His Ala Leu Asp Gly Arg Leu
260 265 270
Gly Pro Met Pro Cys Arg Pro Lys Glu Ile Val Ser Ser Ala Gly Pro
275 280 285
Val Arg Lys Thr Ser Cys Thr Phe Asn Tyr Thr Lys Thr Leu Lys Asn
290 295 300
Lys Tyr Tyr Glu Pro Arg Asp Ser Tyr Phe Gln Gln Tyr Met Leu Lys
305 310 315 320
Gly Glu Tyr Gln Tyr Trp Phe Asp Leu Asp Ala Thr Asp His His Thr
325 330 335
Asp Tyr Phe His His His His His His
340 345
<210>5
<211>120
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
atgctactag taaatcagtc acaccaaggc ttcaataagg aacacacaag caagatggta 60
agcgctattg ttttatatgt gcttttggcg gcggcggcgc attctgcctt tgcggcggat 120
<210>6
<211>40
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>6
Met Leu Leu Val Asn Gln Ser His Gln Gly Phe Asn Lys Glu His Thr
1 5 10 15
Ser Lys Met Val Ser Ala Ile Val Leu Tyr Val Leu Leu Ala Ala Ala
20 25 30
Ala His Ser Ala Phe Ala Ala Asp
35 40
Claims (10)
1. A classical swine fever virus recombinant E2 protein has an amino acid sequence shown in 1 st to 339 th sites of an amino terminal of a sequence 3 in a sequence table, an amino acid sequence shown in the sequence 3 in the sequence table, an amino acid sequence shown in 1 st to 339 th sites of an amino terminal of a sequence 4 in the sequence table, or an amino acid sequence shown in the sequence 4 in the sequence table.
2. A classical swine fever virus recombinant E2 gene is a nucleotide sequence from 1 st to 1017 th at the 5 'end of a sequence 1 in a self-sequencing list, a nucleotide shown as a sequence 1 in a sequence table, a nucleotide sequence from 1 st to 1017 th at the 5' end of a sequence 2 in the self-sequencing list, or a nucleotide shown as a sequence 2 in the sequence table.
3. The recombinant expression vector for expressing the classical swine fever virus recombinant E2 protein of claim 1, which is obtained by cloning the recombinant classical swine fever virus E2 gene of claim 2 and the encoding gene of gp67 signal peptide into an initial vector pFastBac1 to obtain a recombinant expression plasmid of the classical swine fever virus E2 protein carrying gp67 signal peptide; wherein, the nucleotide sequence of the gp67 signal peptide is shown in a sequence 5, and the amino acid sequence of the gp67 signal peptide is shown in a sequence 6.
4. The recombinant baculovirus expressing the classical swine fever virus recombinant E2 protein of claim 1, wherein the recombinant baculovirus is a recombinant baculovirus which is obtained by transforming the recombinant expression vector of claim 3 into escherichia coli DH10Bac competent cells, screening positive expression recombinant bacteria, transfecting the obtained recombinant Bacmid into an insect cell Sf9, rescuing the recombinant baculovirus, and expressing the classical swine fever virus recombinant E2 protein.
5. A classical swine fever E2 recombinant subunit vaccine, comprising the classical swine fever virus recombinant E2 protein of claim 1 and a pharmaceutically acceptable adjuvant.
6. A preparation method of a classical swine fever E2 subunit vaccine comprises the following steps:
(1) and (3) infecting insect cells with High Five at the logarithmic phase by the recombinant baculovirus obtained in the claim 4, and carrying out amplification culture and purifying to obtain the classical swine fever virus recombinant E2 protein.
(2) And (2) fully and uniformly mixing the recombinant E2 protein obtained in the step (1) with a pharmaceutically acceptable adjuvant to obtain the classical swine fever E2 recombinant subunit vaccine.
7. Classical swine fever E2 recombinant subunit vaccine prepared by the method of claim 6.
8. Use of the classical swine fever virus recombinant E2 protein of claim 1, for the preparation of a subunit vaccine for the prevention or treatment of classical swine fever.
9. Use of the classical swine fever virus recombinant E2 protein of claim 1, for the preparation of a diagnostic reagent for vaccine immunization and wild virus infection.
10. Use of the classical swine fever virus recombinant E2 gene of claim 2 or the recombinant baculovirus of claim 4 for the preparation of subunit vaccine for the prevention or treatment of classical swine fever virus disease or for the preparation of differential diagnostic reagents for vaccine immunization and wild virus infection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010112369.7A CN111116720B (en) | 2020-02-24 | 2020-02-24 | Classical swine fever virus recombinant E2 protein and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010112369.7A CN111116720B (en) | 2020-02-24 | 2020-02-24 | Classical swine fever virus recombinant E2 protein and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111116720A true CN111116720A (en) | 2020-05-08 |
| CN111116720B CN111116720B (en) | 2022-02-15 |
Family
ID=70492193
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010112369.7A Active CN111116720B (en) | 2020-02-24 | 2020-02-24 | Classical swine fever virus recombinant E2 protein and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111116720B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109182380A (en) * | 2018-08-14 | 2019-01-11 | 浙江大学 | The preparation method and application of the swine fever E2 subunit vaccine of baculovirus expression |
| CN111973738A (en) * | 2020-09-02 | 2020-11-24 | 天康生物股份有限公司 | Nucleic acid and recombinant protein co-immune vaccine based on hog cholera virus gene, preparation method and application |
| CN112375126A (en) * | 2020-11-04 | 2021-02-19 | 天康生物股份有限公司 | Marked classical swine fever virus E2 protein recombinant baculovirus inactivated vaccine |
| CN113384691A (en) * | 2021-06-11 | 2021-09-14 | 湖南兀邦生物科技有限公司 | Classical swine fever virus E2 protein recombinant subunit vaccine taking salmonella flagellin as molecular adjuvant and preparation method thereof |
| CN113980983A (en) * | 2021-10-21 | 2022-01-28 | 成都史纪生物制药有限公司 | Truncated classical swine fever virus E2 gene and application thereof |
| CN116068175A (en) * | 2022-09-07 | 2023-05-05 | 中国农业科学院兰州兽医研究所 | Swine fever virus tubular chemiluminescent antibody detection kit based on E2 protein dimer and application thereof |
Citations (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002020048A1 (en) * | 2000-08-10 | 2002-03-14 | Tsinghua University | A classical swine fever virus epitope vaccine and its producing method |
| CN103588864A (en) * | 2013-11-28 | 2014-02-19 | 华南农业大学 | Classic swine fever virus (CSFV) C strain E2 truncated protein and its preparation method and use |
| CN103751774A (en) * | 2013-07-17 | 2014-04-30 | 哈尔滨维科生物技术开发公司 | Recombinant cell line for stably expressing classical swine fever virus E2 protein, and applications of the same in preparation of subunit vaccines and diagnosis reagents of classical swine fever |
| CN104826100A (en) * | 2015-04-16 | 2015-08-12 | 浙江海隆生物科技有限公司 | Preparation method and application of classical swine fever virus recombinant subunit vaccine |
| US9328147B2 (en) * | 2014-09-05 | 2016-05-03 | Chung Yuan Christian University | Recombinant baculovirus vector and uses thereof |
| US9359411B2 (en) * | 2008-07-31 | 2016-06-07 | Maw Hsing Biotech Co., Ltd. | Yeast expressed classical swine fever virus glycoprotein E2 and use thereof |
| CN110029116A (en) * | 2019-03-12 | 2019-07-19 | 华南农业大学 | The recombinant virus and preparation method of a kind of more epitope E 2 gene of Classical Swine Fever of secreting, expressing and application |
| CN110177799A (en) * | 2016-12-22 | 2019-08-27 | 维也纳兽医大学 | Cause the separation of the novel pestivirus of A type congenital tremors |
| CN110618279A (en) * | 2019-09-29 | 2019-12-27 | 中牧实业股份有限公司 | African swine fever virus epitope antigen polypeptide and application thereof |
| WO2020211802A1 (en) * | 2019-04-18 | 2020-10-22 | Boehringer Ingelheim Vetmedica (China) Co., Ltd. | Csfv subunit vaccine |
| CN111848786A (en) * | 2020-07-29 | 2020-10-30 | 中牧实业股份有限公司 | Monoclonal antibody, preparation method and application thereof |
-
2020
- 2020-02-24 CN CN202010112369.7A patent/CN111116720B/en active Active
Patent Citations (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002020048A1 (en) * | 2000-08-10 | 2002-03-14 | Tsinghua University | A classical swine fever virus epitope vaccine and its producing method |
| US9359411B2 (en) * | 2008-07-31 | 2016-06-07 | Maw Hsing Biotech Co., Ltd. | Yeast expressed classical swine fever virus glycoprotein E2 and use thereof |
| CN103751774A (en) * | 2013-07-17 | 2014-04-30 | 哈尔滨维科生物技术开发公司 | Recombinant cell line for stably expressing classical swine fever virus E2 protein, and applications of the same in preparation of subunit vaccines and diagnosis reagents of classical swine fever |
| CN103588864A (en) * | 2013-11-28 | 2014-02-19 | 华南农业大学 | Classic swine fever virus (CSFV) C strain E2 truncated protein and its preparation method and use |
| US9328147B2 (en) * | 2014-09-05 | 2016-05-03 | Chung Yuan Christian University | Recombinant baculovirus vector and uses thereof |
| CN104826100A (en) * | 2015-04-16 | 2015-08-12 | 浙江海隆生物科技有限公司 | Preparation method and application of classical swine fever virus recombinant subunit vaccine |
| CN110177799A (en) * | 2016-12-22 | 2019-08-27 | 维也纳兽医大学 | Cause the separation of the novel pestivirus of A type congenital tremors |
| CN110029116A (en) * | 2019-03-12 | 2019-07-19 | 华南农业大学 | The recombinant virus and preparation method of a kind of more epitope E 2 gene of Classical Swine Fever of secreting, expressing and application |
| WO2020211802A1 (en) * | 2019-04-18 | 2020-10-22 | Boehringer Ingelheim Vetmedica (China) Co., Ltd. | Csfv subunit vaccine |
| CN110618279A (en) * | 2019-09-29 | 2019-12-27 | 中牧实业股份有限公司 | African swine fever virus epitope antigen polypeptide and application thereof |
| CN111848786A (en) * | 2020-07-29 | 2020-10-30 | 中牧实业股份有限公司 | Monoclonal antibody, preparation method and application thereof |
Non-Patent Citations (10)
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109182380A (en) * | 2018-08-14 | 2019-01-11 | 浙江大学 | The preparation method and application of the swine fever E2 subunit vaccine of baculovirus expression |
| CN109182380B (en) * | 2018-08-14 | 2022-06-03 | 浙江大学 | Preparation method and application of baculovirus-expressed classical swine fever E2 subunit vaccine |
| CN111973738A (en) * | 2020-09-02 | 2020-11-24 | 天康生物股份有限公司 | Nucleic acid and recombinant protein co-immune vaccine based on hog cholera virus gene, preparation method and application |
| CN112375126A (en) * | 2020-11-04 | 2021-02-19 | 天康生物股份有限公司 | Marked classical swine fever virus E2 protein recombinant baculovirus inactivated vaccine |
| CN113384691A (en) * | 2021-06-11 | 2021-09-14 | 湖南兀邦生物科技有限公司 | Classical swine fever virus E2 protein recombinant subunit vaccine taking salmonella flagellin as molecular adjuvant and preparation method thereof |
| CN113384691B (en) * | 2021-06-11 | 2022-08-16 | 湖南兀邦生物科技有限公司 | Classical swine fever virus E2 protein recombinant subunit vaccine taking salmonella flagellin as molecular adjuvant and preparation method thereof |
| CN113980983A (en) * | 2021-10-21 | 2022-01-28 | 成都史纪生物制药有限公司 | Truncated classical swine fever virus E2 gene and application thereof |
| CN116068175A (en) * | 2022-09-07 | 2023-05-05 | 中国农业科学院兰州兽医研究所 | Swine fever virus tubular chemiluminescent antibody detection kit based on E2 protein dimer and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111116720B (en) | 2022-02-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111116720B (en) | Classical swine fever virus recombinant E2 protein and application thereof | |
| CN109182380B (en) | Preparation method and application of baculovirus-expressed classical swine fever E2 subunit vaccine | |
| CN111848786B (en) | Monoclonal antibody, preparation method and application thereof | |
| KR20070012862A (en) | Vaccine comprising an attenuated pestivirus | |
| WO2023051850A1 (en) | Recombinant fusion protein derived from hr region of s2 protein of sars-cov-2 and application of recombinant fusion protein | |
| CN109880838A (en) | A kind of recombinant virus and its preparation method and application of the O-shaped foot-and-mouth disease virus multi-epitope gene of secreting, expressing pig | |
| CN110025778A (en) | Chicken Mycoplasma synoviae novel gene engineering subunit vaccine | |
| CN110327461A (en) | A kind of preparation method and applications of porcine pseudorabies virus subunit vaccine | |
| CN111088271A (en) | Zika virus vaccine based on replication-defective recombinant adenovirus vector | |
| CN114163505B (en) | Swine fever and porcine pseudorabies virus bigeminal subunit vaccine and preparation method thereof | |
| CN113862284B (en) | Gene, virus-like particle, vaccine and preparation and application for encoding recombinant avian influenza virus HA protein | |
| CN104628871B (en) | A kind of preparation for recombinating bursal disease protein engineering vaccine | |
| CN110669142B (en) | RGD-fused porcine circovirus type 2 virus-like particle, mutant infectious clone, preparation method and application thereof | |
| CN109776657A (en) | Recombinate norovirus VLP particle and preparation method and its usage | |
| CN113896773B (en) | Recombinant FCV antigen and feline calicivirus genetic engineering subunit vaccine | |
| CN111925424B (en) | Japanese B encephalitis virus genetic engineering subunit vaccine, preparation method and application thereof | |
| CN116240222A (en) | Codon-optimized bovine viral diarrhea virus type 1E2 protein gene and application thereof | |
| CN111718400B (en) | Classical swine fever virus recombinant antigen and preparation method and application thereof | |
| CN112094354B (en) | Acinetobacter paragallinarum genetic engineering subunit vaccine, preparation method and application thereof | |
| CN107746848B (en) | Recombinant classical swine fever virus E2 protein and expression cell line, preparation method, application and classical swine fever virus subunit vaccine thereof | |
| CN110305225B (en) | SVA-PCV2 fusion protein, and preparation method, gene, biological material, application and vaccine thereof | |
| CN113861277A (en) | Bovine rotavirus recombinant VP8 protein and application thereof | |
| CN109021115B (en) | Porcine circovirus trivalent subunit vaccine | |
| CN113061167A (en) | Rabbit hemorrhagic disease virus recombinant antigen and application thereof | |
| CN115894718B (en) | Antigen epitope peptide of African swine fever virus and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |