CN111019973A - Method for efficiently expressing recombinant protein by using insect cell-baculovirus expression system - Google Patents
Method for efficiently expressing recombinant protein by using insect cell-baculovirus expression system Download PDFInfo
- Publication number
- CN111019973A CN111019973A CN201911359260.7A CN201911359260A CN111019973A CN 111019973 A CN111019973 A CN 111019973A CN 201911359260 A CN201911359260 A CN 201911359260A CN 111019973 A CN111019973 A CN 111019973A
- Authority
- CN
- China
- Prior art keywords
- cell
- culture
- cells
- recombinant
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/14011—Baculoviridae
- C12N2710/14041—Use of virus, viral particle or viral elements as a vector
- C12N2710/14043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vectore
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/103—Plasmid DNA for invertebrates
- C12N2800/105—Plasmid DNA for invertebrates for insects
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Virology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a method for efficiently expressing recombinant protein by using an insect cell-baculovirus expression system. The method can be used for suspension cell shake flask culture and fermentation tank production. The recombinant protein expression effect based on the Sf9 cell suspension culture technology is detected, the target protein can achieve secretory expression, and cell freeze thawing and a complex purification process thereof are not needed. The process is simple and easy to amplify, and can achieve the purposes of cell growth and propagation and protein expression by using only one culture medium without changing liquid.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a method for efficiently expressing recombinant protein by using an insect cell-baculovirus expression system.
Background
An insect cell-baculovirus expression system is a system which utilizes isolated insect cells for sustainable culture and utilizes an inoculated baculovirus expression vector for expression of target proteins. Sustainable insect cell lines were first established by Grace in 1962, and over the course of years of development and expansion, more than 500 cell lines were currently established from more than 100 insects. These cell lines are derived mainly from agricultural pests of the order diptera and lepidoptera, and their source tissues include ovaries, spermary, embryos, adult discs, blood cells, midgut, adipose bodies, etc., of which the cell lines established with ovarian tissues and embryonic tissues are the most abundant.
To date, although there are numerous insect cell lines established, the most mature used are the Trichoplusia ni (Trichoplusiani) embryonic cell line High Five, the Spodoptera Frugiperda ovarian cell line Sf21 and its clone Sf 9. Compared with other expression systems, the insect expression system has the advantages of high expression efficiency, lower production cost, simple and convenient operation, capability of post-processing protein and the like. The method has the advantages of effectively promoting the market value of the expression system and further improving the comprehensive expression efficiency of the foreign protein for further optimization of insect cell culture and the expression system thereof, and has important significance for the development of biological medicines.
Disclosure of Invention
The invention aims to provide a method for efficiently expressing recombinant protein by using an insect cell-baculovirus expression system, in particular to a recombinant protein expression process based on SF9 cell serum-free suspension culture technology.
In order to achieve the object of the present invention, in a first aspect, the present invention provides a method for efficiently expressing a recombinant protein using an insect cell-baculovirus expression system, comprising the steps of:
(1) constructing a recombinant shuttle plasmid Bacmid containing a DNA fragment encoding a recombinant protein through a Bac-to-Bac system, then uniformly mixing the recombinant shuttle plasmid Bacmid with a transfection reagent, transfecting a suspension culture insect cell, and harvesting a culture supernatant (virus solution) when the cell viability is reduced to 60-80%, wherein the culture supernatant is a P0 generation recombinant baculovirus;
(2) inoculating the insect cells subjected to suspension culture in a shake flask with P0 generation recombinant baculovirus, performing shake culture at the rotation speed of 130-; at the time of inoculation, the cell density was 2X 106-4×106The volume per mL is 1/4-1/3 of the volume of the shake flask.
The method further comprises the step of expanding the cultured infected cells stepwise after step (2) according to a ratio of 1: 8-1: 10, and when more than or equal to 90 percent of cells have obvious pathological changes and lose the activity, harvesting culture supernatant.
The cell culture conditions were as follows: the liquid loading amount of the fermentation tank is 3/5-4/5, the stirring revolution of the fermentation tank is 130-150rpm, the DO value is controlled to be 40 +/-10%, the temperature is controlled to be 27 +/-0.5 ℃, and the pH is controlled to be 6.2 +/-0.2, so that the fermentation tank culture is carried out.
The ratio of virus inoculation in the step (2) is 0.1-1% v/v, namely, the virus liquid is inoculated into the cell culture solution according to the ratio of 0.1-1% v/v.
In the present invention, the insect cell is Sf9 or Sf 21.
The culture medium for Sf9 cells was purchased from Shanghai culture Biotech GmbH, InsectProSF9/SF21 insect cell serum-free medium, cat # H810 KJ.
By the technical scheme, the invention at least has the following advantages and beneficial effects:
the process is simple, the condition parameters are easy to control, and the cell culture is easy to amplify. During the cell culture period after virus inoculation, the effects of cell culture, virus passage and target protein expression can be achieved without changing liquid.
And (II) through a correctly constructed baculovirus expression vector, the expressed target protein is expressed in a soluble secretory mode, freeze thawing and cell disruption are not needed, and a complex later-stage purification process is not needed. Provides possibility for industrial mass production.
And thirdly, the protein expressed by the process has high activity, and the expressed antigen protein has good toxic counteracting and protecting effects.
Drawings
FIG. 1 shows healthy Sf9 cells (left) compared to diseased cells (right) in example 1 of the present invention.
FIG. 2 shows the result of the detection of the antigen agar titer in example 1 of the present invention.
FIG. 3 shows virus-like particles observed under an electron microscope in example 1 of the present invention.
FIG. 4 shows the expression levels of recombinant proteins at different times in example 1 of the present invention.
Detailed Description
The invention provides a serum-free suspension culture and recombinant protein expression process of Sf9 cells, which comprises the following steps:
1. shake flask Sf9 cell suspension culture and small expression of recombinant protein
(1) Recovery of Sf9 suspension cells: sf9 cells frozen in liquid nitrogen are taken, quickly thawed in warm water at 27 ℃, centrifuged at 1000rpm for 10min, and the precipitate is collected and the supernatant is removed. Cells were diluted to 1X 10 using insect cell culture medium6cells/mL were incubated at 27 ℃ for 24h at 140rpm in a shaker.
(2) Culture of Sf9 cells: taking cell sap cultured for 24h, measuring cell viability, centrifuging at 1000rpm for 10min, and collecting precipitate. Resuspending the cell pellet in the same volume, and continuing culturing until the cell number reaches 5 × 106cells/mL. And (4) measuring the cell activity, and if the cell activity is more than or equal to 90%, performing recombinant baculovirus inoculation.
(3) Recombinant baculovirus inoculation: get the quantity up toTo 5X 106Sf9 cell culture solution with cell/mL and activity not less than 90%, using fresh preheated Sf9 insect cell culture medium, diluting the cells to 2 × 106cells/mL and 0.1% v/v of the current volume was inoculated with recombinant baculovirus.
(4) Observation and lesion judgment after inoculation: the culture solution of the inoculated Sf9 cells was cultured at 27 ℃ and 140rpm, and the cytopathic state was observed every 12 hours and counted. Lesions were evident in Sf9 cells, generally 72h after inoculation. The pathological state is as follows: the cell activity is reduced, and the volume of pathological cells is obviously larger than that of healthy cells.
(5) Preparation of passaged recombinant baculovirus: collecting SF9 cell culture solution with pathological changes for 72h, centrifuging to obtain supernatant, determining agar expansion titer, SDS-PAGE, Western Blot and the like according to the type of the expressed protein, and simultaneously storing the culture sample with the detected effective protein as an Fx generation virus, wherein the passage is not more than 10 generations.
(6) Expression of recombinant protein: sf9 cells are inoculated with the secondary recombinant virus for expression, and the cell viability is detected after 168-192h inoculation. When more than or equal to 90 percent of SF9 cells are obviously diseased and lose vitality, collecting the culture solution. Centrifuging at 1000rpm for 10min, collecting supernatant, and determining its agarose titer, SDS-PAGE, Western Blot, etc. according to the type of protein expressed.
2. Cell amplification and fermenter culture
(1) Cell amplification: culturing to 5 × 106SF9 cell culture solution with cell/mL and activity not less than 90%, using fresh preheated SF9 cell culture medium, diluting to cell concentration of 0.5 × 106-0.8×106cells/mL and transferred to the next stage of culture equipment, if the number of required amplifications is large, the above operations can be repeated until the culture solution is amplified into a large-capacity bioreactor.
(2) And (3) culturing the cells: the culture parameters of Sf9 cells in the reactor were: the stirring speed was 150rpm, the DO value was 40. + -. 10%, the temperature was 27. + -. 0.5 ℃ and the pH was 6.2. + -. 0.1, and the fermentation tank culture was carried out.
(3) Virus inoculation: when the reactor reached Sf9 cells of 5X 106At cell/mL, in responseFresh Sf9 cell culture medium was introduced into the chamber and diluted to 2X 106After the cells/mL, 0.1% of recombinant baculovirus for expression was added.
(4) Harvesting of the pilot protein expression fluid of interest: and (3) continuing culturing the Sf9 cells inoculated with the virus preservation solution by keeping parameters, sampling every 24h during the culture period, counting, detecting cell viability and the like, and culturing until 168-192h, wherein more than or equal to 90% of the cells are diseased and lose viability, and the expression level of the soluble target protein in the culture solution reaches the highest level. The culture broth was harvested, centrifuged to remove cell debris, the supernatant was stored for a long period of time, and the expression effect was examined by SDS-PAGE.
The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Unless otherwise indicated, the examples follow conventional experimental conditions, such as the Molecular Cloning handbook, Sambrook et al (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual,2001), or the conditions as recommended by the manufacturer's instructions. Example 1 method for high-efficiency expression of recombinant protein Using insect cell-baculovirus expression System
1. Cloning of the Gene of interest
Searching coding gene sequences and protein sequences of the proteins of the penton and hexon of the avian adenovirus, and extracting RNA from the existing virus to perform sequencing comparison. According to the previous research result, the region with stronger antigenicity is screened out for splicing, and a Linker (Linker) is added between the penton protein and the hexon protein to ensure the space conformation and the formation of virus-like particles (VLPs).
Checking and optimizing restriction enzyme cutting sites in the obtained sequence to ensure that the sequence does not contain BamHI and HindIII cutting sites, and sending the spliced sequence to a biological company for synthesis.
A pair of splicing primers for amplifying the gene segments of the avian adenovirus is designed by using Primer5.0 software, and protective bases and enzyme cutting sites are added to the 5 'end of an upstream primer and the 5' end of a downstream primer. The primer sequence is as follows:
FAdV-BamHⅠ-F：CGCGGATCCATGATGGGAAGCTACTTTGA
FAdV-HindIII-R：CCCAAGCTTTCAGCAGAATAACGATGATA
PCR amplification of the synthesized sequence was performed using pfu enzyme in a 50 μ L: 10 XPCR Buffer 5. mu.L, dNTP (10 mM each) 1. mu.L, upstream and downstream primers (10nM) 1. mu.L each, synthetic DNA 1. mu.L, pfu enzyme 1. mu.L, ddH2O40μL。
PCR reaction parameters: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 58 ℃ for 30s, 72 ℃ for 120 s; 7min at 72 ℃.
The product is detected by agarose gel electrophoresis, and a single bright band is arranged at the position of about 1400 bp. The product was recovered and sequenced using the DNA product (SEQ ID NO:1) recovery kit, and the alignment found to be identical to the expected.
2. Construction and expression of FAdV recombinant protein
Estimating the concentration of the target fragment and the pFastBac 1 vector, mixing the target sequence and the pFastBac 1 vector according to the proportion of 1: 4, adding T4 Buffer and T4 ligase, carrying out enzymatic ligation at 16 ℃ overnight, transforming the ligation product into escherichia coli DH5 α competent cells, extracting plasmid, verifying to be completely correct, extracting the pFastBac 1 vector containing the target gene, transforming the vector into DH10Bac, and screening out positive clones by a blue-white spot screening method.
Serum-free Sf9 cells cultured in suspension with a cell density of 2.5X 10 were selected6cells/ml, suspension transfection in 125ml shake flask, culture volume 25ml, using Opti-MEM to dilute 12.5. mu.g recombinant Bacmid and 30ul insect cell line cell transfection reagent, mixing, adding Sf9 cell suspension, culturing at 27 deg.C, 120rpm shaking table. And (3) harvesting culture supernatant 72-96h after transfection when the cell viability is reduced to 60-80%, namely P0 generation baculovirus.
Sf9 cells were cultured to 5X 10 with Sf9 serum-free suspension medium6cells/ml, cell density diluted to 2.5X 10 with fresh serum-free medium6cells/ml, inoculating baculovirus according to the proportion of 1 per thousand, culturing for 168h, and harvesting culture supernatant. And (3) carrying out SDS-PAGE electrophoresis to identify the molecular weight of the protein, observing whether virus-like particles are formed or not by using an electron microscope, and detecting the amplification potency of the protein.
3. Acquisition of P0-generation virus liquid
Serum-free Sf9 cells cultured in suspension at a density of 2X 106cells/mL, suspension transfection in 125mL shake flask, culture volume 25mL, using Opti-MEM to dilute 12.5. mu.g recombinant Bacmid and 30ul insect cell line cell transfection reagent, mixing well, adding Sf9 cell suspension, culturing at 27 ℃, 120rpm shaker. And (3) harvesting culture supernatant after 72-96h after transfection when the cell viability is reduced to 60-80% and the cells have obvious lesions (figure 1), namely P0 generation recombinant baculovirus.
4. Small expression of FAdV key antigen proteins
(1) Adherent expression: SF9 cells were cultured to 5X 10 with Sf9 conventional medium6cells/mL, cell density diluted to 2X 10 with fresh medium6Inoculating the recombinant baculovirus of P0 generation with 500mL cell suspension at 0.1%, adding the cell into culture area of 6335cm2The 10-layer cell factory is used for carrying out adherent expression on protein, the culture temperature is 27 ℃, sampling is carried out every 24 hours during 72-192 hours, the protein expression level is measured by adopting an agar amplification method, and the result shows that the recombinant protein has the highest expression level in 120 hours and the titer is 1: 16.
(2) Suspension expression: sf9 cells were cultured to 5X 10 with Sf9 serum-free suspension medium6cells/mL, cell density diluted to 2X 10 with fresh serum-free medium6And (2) putting 500mL of the cells/mL into a 2L shake flask, inoculating the P0 generation recombinant baculovirus according to the proportion of 0.1%, putting the cells/mL into a shaking table for protein expression, rotating at 120rpm and at 27 ℃, sampling every 24 hours during 72-192 hours, and measuring the protein expression level by adopting an agar amplification method, wherein the result shows that the expression level of the recombinant protein is the highest at 168-192 hours (figure 4) and the antigen amplification titer detection result is 1:32 (Table 1).
TABLE 1 protein expression levels at different times
5. Fermenter expression of FAdv key antigen protein
Sf9 cells were cultured to 5X 10 with Sf9 serum-free suspension medium6Cell/cell-mL, cell density diluted to 2X 10 with fresh serum-free medium6cells/mL were transferred to a 50L fermentor (40L liquid loading), and culture parameters of Sf9 cells in the reactor were: stirring at 150rpm, DO value of 40 + -10%, temperature of 27 + -0.5 deg.C, pH of 6.2 + -0.1, performing fermenter culture, inoculating recombinant baculovirus of P0 generation at 0.1% ratio while introducing CO2The pH value of the mixture is controlled by gas and NaOH, the DO value of the mixture is controlled by introducing oxygen, and the temperature of the mixture is controlled by insulating jacket water. And sampling every 24h during 72-192h, determining the protein expression level by adopting an agar-agar amplification method, wherein the result shows that the recombinant protein has the highest expression level in 168-192h, the antigen agar-agar amplification titer detection result is 1:32 (figure 2), and observing the expression protein by an electron microscope to form VLP virus-like particles (figure 3).
Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.
Sequence listing
<110> Qianyuan Haoyao organism GmbH
<120> method for efficiently expressing recombinant protein using insect cell-baculovirus expression system
<130>KHP191116921.1
<160>1
<170>SIPOSequenceListing 1.0
<210>1
<211>1461
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
atgggaagct actttgactt gaaaaacaag ttcagacaga cggtcgtggc gcccacccga 60
aatgtcacga cagaaaaggc tcaacggctg caaatccgct tttaccccat ccaaaccgac 120
gacacgtcga cgggctaccg cgtgcggtac aacatcaatg tgggcgacgg ttgggtcctg 180
gacatggggt cgacctattt cgacatcaag ggaatcctag accgagggcc gtccttcaag 240
ccctactgcg gcacggctta caacccgctg gctcccaagg agtccatgtt taacaactgg 300
tcggagacgg cacccgggca gaacgtgtcc gcctccggtc agctgtccaa tgtctatacc 360
aacacgagca ccaccaaaga cacgacggcg gcgcaggtga cgaagatttc cggcgtcttt 420
cccaacccca accagggacc cggaataaat cctctgcggc aggtagaaaa cgccaacacc 480
ggcgtgctcg gtcgcttcgc caagtctcag tacaattacg cttacggtgc ctacgtcaag 540
cccgtcgccg ccgacggttc ccagtccctc acgcagaccc cctactggat catgaataac 600
gcgggcaccg aatacgaatt caacacattt tactgctgtg aactttgttg taatcctgcc 660
agtgctggaa gttataacac acaaatatat acgataaatg acaagatact atcatatacg 720
gaatcgatgg caggcaaaag agaaatggtt atcattacat ttaagagcgg cgaaacattt 780
caggtcgaag tcccgggcag tcaacatata gactcccaga aaaaagccat tgaaaggatg 840
aaggacacat taagaatcac atatctgacc gagaccaaaa ttgataaatt atgtgtatgg 900
aataataaaa cccccaattc aattgcggca atcagtatga aaaacactag tgccaatcag 960
acgaccttgc tgacggtgcc cgatatggcg ggcgggatcg gggcgatgta cacgtccctg 1020
cccgatacct ttatcgcgcc taccgggttc aaggaagata acacgaccaa cctttgcccg 1080
gtcgtcggca tgaacctgtt ccccacctac aataaaattt attaccaggc ggcgtccacg 1140
tacgtgcaac gcctggaaaa ttcctgccag tcggccacag ccgccttcaa ccgctttccc 1200
gaaaacgaga ttctgaagca agcgcccccc atgaatgttt cgtccgtgtg cgataaccaa 1260
cccgccgtcg ttcagcaggg tgtgttgcct gtgaagagct cgctccccgg actgcagcgc 1320
gtgctgatca cagacgacca gcgtcgtccg ataccctacg tgtataagtc tatcgcgacg 1380
gttcagccga ccgttctgag ttccgcgacc ttgcagatca ccaccattat tatcgttatc 1440
atcgttattc tgctgagcta a 1461
Claims (4)
1. The method for efficiently expressing the recombinant protein by using the insect cell-baculovirus expression system is characterized by comprising the following steps of:
(1) constructing a recombinant shuttle plasmid Bacmid containing a DNA fragment encoding a recombinant protein through a Bac-to-Bac system, then uniformly mixing the recombinant shuttle plasmid Bacmid with a transfection reagent, transfecting an insect cell cultured in a suspension manner, and harvesting a culture supernatant when the cell viability is reduced to 60-80%, namely a P0 generation recombinant baculovirus;
(2) inoculating the insect cells subjected to suspension culture in a shake flask with P0 generation recombinant baculovirus, performing shake culture at the rotation speed of 130-; at the time of inoculation, the cell density was 2X 106-4×106The volume per mL is 1/4-1/3 of the volume of the shake flask.
2. The method of claim 1, further comprising the step of expanding the cultured infected cells in stages after step (2) according to a ratio of 1: 8-1: 10, culturing the cells in an enlarged way, and harvesting culture supernatant when more than or equal to 90 percent of the cells have obvious pathological changes and lose activity;
the cell culture conditions were as follows: the liquid loading amount of the fermentation tank is 3/5-4/5, the stirring revolution of the fermentation tank is 130-150rpm, the DO value is controlled to be 40 +/-10%, the temperature is controlled to be 27 +/-0.5 ℃, and the pH is controlled to be 6.2 +/-0.2, so that the fermentation tank culture is carried out.
3. The method according to claim 1, wherein the ratio of the inoculated virus in the step (2) is 0.1 to 1% v/v.
4. The method of any one of claims 1 to 3, wherein the insect cell is Sf9 or Sf 21.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911359260.7A CN111019973A (en) | 2019-12-25 | 2019-12-25 | Method for efficiently expressing recombinant protein by using insect cell-baculovirus expression system |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911359260.7A CN111019973A (en) | 2019-12-25 | 2019-12-25 | Method for efficiently expressing recombinant protein by using insect cell-baculovirus expression system |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111019973A true CN111019973A (en) | 2020-04-17 |
Family
ID=70214350
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911359260.7A Pending CN111019973A (en) | 2019-12-25 | 2019-12-25 | Method for efficiently expressing recombinant protein by using insect cell-baculovirus expression system |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111019973A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108642020A (en) * | 2018-05-18 | 2018-10-12 | 山东信得动物疫苗有限公司 | A method of obtaining recombinant baculovirus using sf9 suspension insect cell high efficiency |
| CN112646840A (en) * | 2020-12-25 | 2021-04-13 | 石河子大学 | Method for preparing bovine viral diarrhea virus E2 protein by using baculovirus expression system and application |
| CN115877015A (en) * | 2023-01-09 | 2023-03-31 | 华南农业大学 | Method for monitoring antigen expression quantity of suspension culture baculovirus expression system |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102839195A (en) * | 2012-07-18 | 2012-12-26 | 华南农业大学 | Method for expression of PCV 2 Cap protein by pFast Bac Dual baculovirus |
| CN106946995A (en) * | 2017-04-05 | 2017-07-14 | 苏州米迪生物技术有限公司 | The I group of type aviadenovirus genetic engineering subunit vaccine of serum 4, its preparation method and application |
| CN108558989A (en) * | 2018-04-17 | 2018-09-21 | 扬州优邦生物药品有限公司 | 4 type aviadenovirus subunit vaccines of a kind of prevention and its preparation method and application |
-
2019
- 2019-12-25 CN CN201911359260.7A patent/CN111019973A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102839195A (en) * | 2012-07-18 | 2012-12-26 | 华南农业大学 | Method for expression of PCV 2 Cap protein by pFast Bac Dual baculovirus |
| CN106946995A (en) * | 2017-04-05 | 2017-07-14 | 苏州米迪生物技术有限公司 | The I group of type aviadenovirus genetic engineering subunit vaccine of serum 4, its preparation method and application |
| CN108558989A (en) * | 2018-04-17 | 2018-09-21 | 扬州优邦生物药品有限公司 | 4 type aviadenovirus subunit vaccines of a kind of prevention and its preparation method and application |
Non-Patent Citations (2)
| Title |
|---|
| 凌同综述: "昆虫杆状病毒表达系统的研究进展与应用", 《微生物学免疫学进展》 * |
| 郑鹏涛: "sf9昆虫细胞的培养", 《生物制药合伙人：ZPT_PARTNER》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108642020A (en) * | 2018-05-18 | 2018-10-12 | 山东信得动物疫苗有限公司 | A method of obtaining recombinant baculovirus using sf9 suspension insect cell high efficiency |
| CN112646840A (en) * | 2020-12-25 | 2021-04-13 | 石河子大学 | Method for preparing bovine viral diarrhea virus E2 protein by using baculovirus expression system and application |
| CN115877015A (en) * | 2023-01-09 | 2023-03-31 | 华南农业大学 | Method for monitoring antigen expression quantity of suspension culture baculovirus expression system |
| CN115877015B (en) * | 2023-01-09 | 2023-08-15 | 华南农业大学 | Method for monitoring antigen expression quantity of baculovirus expression system in suspension culture |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111019973A (en) | Method for efficiently expressing recombinant protein by using insect cell-baculovirus expression system | |
| CN112143712B (en) | Recombinant adeno-associated virus, preparation method thereof and application thereof in antibody detection | |
| CN112080521B (en) | Recombinant pseudorabies virus vector construction for expressing foreign protein and preparation method of recombinant pseudorabies virus | |
| CN108913813B (en) | Primer set for identifying DAdV-2 and DAdV-3 | |
| CN111718958B (en) | Rabbit hemorrhagic disease virus type 1 and type 2VP60 bivalent recombinant baculovirus vector inactivated vaccine and preparation method and application thereof | |
| CN103937835A (en) | Expression vector based on adenovirus AdC68 and construction method thereof | |
| CN105200085A (en) | Production method for recombinant human fibroblast growth factor-18 and application of growth factor-18 | |
| CN115197966A (en) | Method for large-scale production of recombinant vaccinia virus vector by using bioreactor | |
| CN114836418B (en) | CRISPR-Cas13d system for knocking down porcine epidemic diarrhea virus | |
| CN104178514B (en) | A kind of method of foreign protein content inside raising AcMNPV polyhedral bodies | |
| BR102015004964A2 (en) | method to obtain natural variant of enzyme and super thermostable cellobiohydrolase | |
| CN114058619A (en) | Construction of RIPLET knockout cell line and application of RIPLET knockout cell line as production cell line of picornaviridae virus vaccine | |
| CN103484499A (en) | Construction and application of replication-defective BmNPV vector | |
| CN102286534B (en) | Insect bioreactor capable of expressing multiple exogenous genes, and construction method and application thereof | |
| Welch et al. | Adomaviruses: an emerging virus family provides insights into DNA virus evolution | |
| CN104975043A (en) | Shuttle vector for constructing recombinant MVA virus and having marker gene self-deleting system | |
| CN110713963B (en) | Gene-deficient Aeromonas intermedia | |
| JP7011132B2 (en) | New chitosanase CHI1, its coding gene and its use | |
| CN102533657B (en) | Human 41 type adenovirus (Ad41) packaging cell line and application thereof | |
| CN114806900A (en) | Engineering strain capable of secreting fiber swelling protein, construction method and application | |
| CN108048479B (en) | Method for expressing recombinant protein by using trichoderma reesei as host | |
| CN116333944B (en) | Arthrobacter C2 and application of recombinant Arthrobacter in lignin degradation | |
| CN112574995B (en) | gRNA primer for editing miRNA gene of LAT gene cluster of Marek's disease virus and application thereof | |
| CN110904056A (en) | Infectious bronchitis virus rH120-YZS1 delta 5a and construction method and application thereof | |
| CN112646831A (en) | Shuttle plasmid, construction method and application thereof in synechocystis transformation exogenous gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200417 |
|
| RJ01 | Rejection of invention patent application after publication |