CN114806900A

CN114806900A - Engineering strain capable of secreting fiber swelling protein, construction method and application

Info

Publication number: CN114806900A
Application number: CN202210433263.6A
Authority: CN
Inventors: 张天元; 邵雄俊; 薛怡芸
Original assignee: Suzhou Juwei Yuanchuang Biotechnology Co ltd
Current assignee: Suzhou Juwei Yuanchuang Biotechnology Co ltd
Priority date: 2022-04-24
Filing date: 2022-04-24
Publication date: 2022-07-29

Abstract

The invention relates to the technical field of genetic engineering, and particularly provides an engineering strain capable of secreting fiber-swelling protein, wherein the strain is clostridium thermocellum engineering strain with a fiber-swelling protein gene Clcl-1298 for recombinant expression, the fiber-swelling protein gene Clcl-1298 is derived from clostridium clinorum, and the fiber-swelling gene is introduced into clostridium thermocellum to construct the clostridium thermocellum engineering strain for recombinant expression of the gene. The clostridium thermocellum engineering bacteria can efficiently express the fiber swelling protein. The invention also discloses that the clostridium thermocellum engineering strain can be efficiently applied to the hydrolysis of lignocellulose and has good application prospect.

Description

Engineering strain capable of secreting fiber swelling protein, construction method and application

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to an engineering bacterium capable of secreting fiber swelling protein, a construction method and application.

Background

Lignocellulose is a renewable resource which is widely distributed, large in quantity and difficult to treat, and has important significance in converting the lignocellulose into renewable energy. Lignocellulose mainly consists of cellulose, hemicellulose and lignin, wherein the cellulose is a highly ordered and tightly combined crystal structure which is tightly connected with the hemicellulose, the periphery of the cellulose is surrounded by the lignin, and the cellulose is difficult to be directly hydrolyzed into available glucose. At present, cellulase derived from filamentous fungi is mostly used for enzymatic hydrolysis of lignocellulose, which is typically Trichoderma, Aspergillus, Penicillium and the like, but the enzyme consumption is high in the enzymolysis process, the activity is easily inhibited by products, and the enzyme proteins are not high-temperature resistant and acid-base resistant, so that the large-scale application of the cellulase is restricted.

Clostridium thermophilum is one of the most efficient microorganisms known in nature for degrading cellulose at present, and secreted cellulosome has extremely strong cellulose degradation capability. The cellulosome has about 50 times greater ability to degrade cellulose than Trichoderma, and this high efficiency depends on the particular structure of the cellulosome. The clostridium thermocellum is a strict anaerobic thermophilic microorganism and has special growth conditions, so that the secreted lignocellulose hydrolase has better heat resistance and little risk of mixed bacteria pollution.

The fiber swelling protein is a protein without glycosidic bond hydrolysis activity, and can promote fiber in cellulose in plant cell walls to slide so as to change the crystalline structure of the cellulose and destroy the cellulose structure without generating reducing sugar. Since the fiber swelling protein can make the fiber structure of the natural fiber material become swollen and loose, the fiber swelling protein can be cooperated with the cellulase to improve the hydrolysis efficiency of the lignocellulose. However, as active recombinant proteins, heterologous expression of intact swollenin is still less.

Disclosure of Invention

In order to overcome the defects of the prior art, the invention provides the engineering bacteria capable of secreting the fiber swelling protein, the construction method and the application, the enzyme hydrolysis efficiency of the clostridium thermocellum is enhanced through the synergistic effect of the fiber swelling protein, and the hydrolysis efficiency is higher compared with the traditional cellulose enzyme hydrolysis under the same enzymolysis condition.

In order to achieve the purpose, the invention adopts the following technical scheme:

the invention provides an engineering strain capable of secreting the fiber swelling protein, and the strain is clostridium thermocellum engineering bacteria obtained by recombining and expressing a fiber swelling protein gene Clcl-1298.

The strain is an engineering bacterium obtained by replacing the nucleotide sequence of SEQ ID No. 1 in the clostridium thermocellum cel9K gene with the nucleotide sequence of a fiber swelling protein gene Clocl-1298 through recombination.

The nucleotide sequence of the said fiber expansion protein gene is shown in SEQ ID No. 2. The obtained clostridium thermocellum engineering bacteria comprises a nucleotide sequence shown as SEQ ID No. 2.

The fiber expansion protein gene Clocl-1298 is derived from clostridium cleiflaviClostridium clarifavum DSM19732。

The invention also provides a construction method of an engineering strain capable of secreting the fiber swelling protein, which is characterized in that the fiber swelling protein gene Clocl _{_} 1298 is recombined and expressed on the genome of the clostridium thermocellum to obtain the engineering strain which can secrete the fiber swelling protein.

Preferably, the clostridium thermocellum is used as an original strain, a partial sequence (shown as SEQ ID No: 1) of the cel9K gene on the clostridium thermocellum genome is replaced by a gene sequence of a fiber swelling protein gene Clo-1298 to obtain a recombinant clostridium thermocellum engineering strain, and the replaced fiber swelling protein gene Clo-1298 has a nucleotide sequence shown as SEQ ID No: 2.

The clostridium thermocellum is clostridium thermocellum (C)Clostridium thermocellum) PN2102 with preservation date of 2021 year, 07 month and 09 day, and preservation unit of China general microbiological culture Collection center with preservation number of CGMCC No. 22869.

The invention relates to a construction method of an engineering strain capable of secreting fiber swelling protein, which comprises the following steps: (1) designing and constructing a recombinant plasmid PUC-Clocl-1298 into which the fiber-swelling protein gene is inserted; (2) transferring a recombinant plasmid PUC-Clocl-1298 consisting of the fiber swelling protein gene and the linearized template plasmid into clostridium thermocellum; (3) and selecting and PCR verifying positive monoclone and culturing to obtain positive converting strain.

The invention also provides application of the engineering strain capable of secreting the fiber swelling protein in lignocellulose hydrolysis, wherein the application of the anaerobic fermentation broth of the clostridium thermocellum engineering strain in the hydrolysis of straw fibers by compounding cellulase comprises the following steps:

(1) pretreatment of lignocellulose: common agricultural straws are used as raw materials for pretreatment, lignin is removed, and straw fibers are extracted; (2) anaerobic fermentation of clostridium thermocellum: sequentially carrying out seed culture and anaerobic fermentation on the clostridium thermocellum engineering bacteria to obtain fermentation liquor; (3) fiber hydrolysis: and (3) compounding the fermentation liquor obtained in the step (2) with other cellulase to hydrolyze the straw fiber obtained by the treatment in the step (1).

Preferably, in the step (1), the pretreatment of the lignocellulose comprises the following specific steps: cleaning and chopping straw raw materials, carrying out hydrothermal reaction under an alkaline condition, fully removing lignin, extracting straw fiber, dehydrating and fully washing off residual alkali liquor; the alkali is sodium hydroxide and sodium sulfite; the weight of the sodium hydroxide is as follows: the absolute dry weight of the straw raw material is 1 (4-6), and the sodium sulfite: the weight ratio of the sodium hydroxide is 1 (3-5); the treatment conditions were: the reaction temperature is 150 ℃ and 160 ℃, and the reaction time is 1-3 h.

Preferably, in the step (2), the process of seed culture and anaerobic fermentation is as follows: A. seed culture: unfreezing the strain of the clostridium thermocellum engineering bacteria preserved at the temperature of-80 ℃ in a refrigerator at the temperature of 4 ℃, sucking 1 mL of strain under aseptic condition, injecting the strain into a seed culture medium, and culturing for 16-24 h at the temperature of 55 ℃ and at the speed of 200 rpm; B. anaerobic fermentation: then inoculating into fermentation medium with an inoculum size of 5% -10% (v/v), and culturing at 55 deg.C and 200 rpm for 16-24 h.

Preferably, theThe culture medium in the step (2) comprises a solution A, a solution B, a solution C, a solution D and a solution E in a volume ratio of 40:2:1:1:1, wherein the solution A is 5 g/L of a carbon source and 10.00 g/L of MOPS; the solution B is 50.00 g/L tripotassium citrate, 31.25 g/L citric acid monohydrate, and 25.00 g/L Na ₂ SO ₄ 、25.00 g/L KH ₂ PO ₄ 、62.50 g/L NaHCO ₃ (ii) a The solution C is 250.00 g/L urea, and the solution D is 50.00 g/L MgCl ₂ ·6H ₂ O、10.00 g/L CaCl ₂ ·2H ₂ O、5.00 g/L FeCl ₂ ·4H ₂ O, 50.00 g/L L-cysteine hydrochloride; the E solution is 1.00 g/L pyridoxamine dihydrochloride, 0.20 g/L p-aminobenzoic acid, 0.10 g/L biotin and 0.10 g/L VB ₁₂ 。

More preferably, the carbon source of the liquid A in the seed culture medium is 5.00 g/L microcrystalline cellulose, the carbon source of the fermentation culture medium is 5.00 g/L straw fiber, and the straw fiber prepared in the step (1) is more preferably selected.

Preferably, in the step (3), the fiber hydrolysis comprises the following specific steps: pH is 4.5-5.5, the solid-to-liquid ratio is 1 (10-30), the reaction temperature is 45-55 ℃, 10-20 mL of clostridium thermocellum fermentation liquor, 0-10 FPU of cellulase and 4 mg of xylanase are added into the straw fiber per unit mass; the hydrolysis time is 12-48 h, and the stirring speed is 200 rpm.

The invention has the beneficial effects that: the clostridium thermocellum engineering bacterium provided by the invention can be efficiently applied to hydrolysis of lignocellulose. Through genetic engineering modification, partial sequence of cel9K gene on the genome of the clostridium thermocellum is replaced by the gene from clostridium cleiflaviClostridium clarifavumThe fiber swelling protein gene Clocl-1298 of DSM19732 constructs a fusion protein with the biological activity of the fiber swelling protein, enhances the enzymatic hydrolysis efficiency of the clostridium thermocellum through the synergistic action of the fiber swelling protein, and has higher hydrolysis efficiency under the same enzymatic hydrolysis condition.

Drawings

FIG. 1 is a map of the recombinant plasmid PUC-ClOCl-1298 inserted with the fiber-swelling protein gene ClOCl-1298.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention clearer, the present invention will be described in further detail with reference to embodiments, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The present invention uses conventional techniques and methods used IN the fields of genetic engineering and MOLECULAR BIOLOGY, such as the methods described IN MOLECULAR CLONING, A LABORATORY MANUAL, 3nd Ed. (Sambrook, 2001) and CURRENTPROTOLS IN MOLECULAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, it is not intended that the invention be limited to any particular methodology, protocols, and reagents described, as these may vary.

The test materials used in the examples were purchased from a conventional biochemical reagent store unless otherwise specified. The experimental procedures in the examples are conventional unless otherwise specified.

The CTFUD culture medium comprises the following components in percentage by weight (g/L): 3.00 sodium citrate dihydrate, 1.30 (NH) ₄ ) ₂ SO ₄ 、1.50 KH ₂ PO ₄ 、0.13 CaCl ₂ •2H ₂ O, 0.5L-cysteine hydrochloride, 11.56 MOPS-Na, 2.60 MgCl ₂ •6H ₂ O、0.001 FeSO ₄ •7H ₂ O, 5.00 Avicel pH105, 4.50 YE, 10 g/L agar was added if a solid medium was prepared.

Starting strain Clostridium thermocellum (of the present invention)Clostridium thermocellum) PN2102 with preservation date of 2021 year, 07 month and 09 day, and preservation unit of China general microbiological culture Collection center with preservation number of CGMCC No. 22869.

Example 1 construction of engineered strains of Clostridium thermocellum

Clocl-1298 is expressed by constructing a fusion protein by replacing part of the sequence of the cel9K gene on the C.thermocellum genome. The partial gene sequence before replacement in the cel9K gene on the clostridium thermocellum genome is shown as SEQ ID No. 1:

AGAACCGGAGGTTATTTATGGTGACTGCAATGGCGACGGAAAAGTTAATTCAACTGACGCTGTGGCATTGAAGAGATATATCTTGAGATCAGGTATAAGCATCAACACTGATAATGCTGATGTAAATGCTGATGGCAGAGTTA

with Clostridium cleaver (C.), (Clostridium clarifavum）The fiber swelling protein gene Clocl-1298 of DSM19732 replaces the gene sequence shown in SEQ ID No. 1, and the gene sequence of the fiber swelling protein gene is shown in SEQ ID No. 2:

ATGAATTTTAAAAAAATCAGGCTTTTCACTGCCATTTTAATTATAGCTGCTCAAGTTTTATCCTATAATTTTATCTCTTCCGCCCAACTTCAAGTTGGAGATGTCAATGGAGACAATAATGTGGATAGTATTGACTTTGCATTGATGAAAAGCTTTATATTGAAAATTATCAATACTCTTCCTGCCGAAGATTCCCTTTTGGCAGGTGACTTGGACGGAGACGGTTCTATAAACAGCATTGACTGTGCTTTAATGAAACAATATCTTCTCGGAATGATCAAAGTTTTTCCCAAAACTCAATCTCCAGCACCTACACCGACAAATACACCATTGCCTGAATACAGCGAGCCATATCCCGGATGGGATAAAATACGCTCAGGGTATGCCACTTATACCGGTTCAGGATATGTAGGCGGAATTGCCCTTTTAGATCCAATTCCTGAAGATATGGAAATTGTGGCCGTTAACAAACCCGATTTTAATTGTTACGGTGTACAGGCCGCTCTAGCCGGTGCATATTTGGAGGTAACAGGGCCTAAAGGTACCACAGTTGTCTATGTAACCGATTGCTATACGGAAGCCCCGGAAGGTGCTTTGGACCTTTGCGGAATTTCCTGTGATAAAATAGGCGATACAAATGTTCCCGGAGGTAAAATTGATGTAACATGGCGTATTATACCTGCTCCCATCACCGGAAATTTTATATACCGAATCTTGCCGGCCAGTTCAAAATGGTGGTTTGCCATACAAGTAAGAAATCACAAATATCCTGTAATGAAAATGGAATACTTTAAAGACGGCGAATGGGTCGACATTCCCAAGGACCGCTGCAACTATTTTGTGATAAATAATTTGGATACTTCCAACCTTAAAATCAGAATTACCGATATCCGCGGCAAGGTTGTAACCGATATTATAGACCCTATTCCCGACAATCTCATGAATGGCTGTTTTATCCAGGGCAATGTTCAATTTCCGGATTAA

the specific implementation method comprises the following steps:

(1) design and construction of recombinant plasmid PUC-Clocl-1298

Construction of the PUC-Clocl-1298 recombinant plasmid the gene Clocl-1298 fragment was ligated with the linearized template plasmid pPN01 by Gibson Assembly, then transferred into BL21 and screened on a benzyl-containing gel plate.

The fiber expansion protein gene Clocl-1298 is derived from clostridium cleaveris (C.) (Clostridium clarifavumDSM 19732), from the literature (Complete Genome Sequence ofClostridium clariflavumDSM 19732) to obtain Clostridium cleaveris (Clos)Tridium clavum DSM 19732) to obtain a sequence of the swollenin gene Clocl-1298, GenBank No. Genbank: CP003065.1, synthesized the swollenin gene Clocl-1298 by Nanjing Kinsley Biotech, Inc., and subjected to codon optimization. The gene sequence of Clocl-1298 is shown in SEQ ID NO. 2.

The expression vector for constructing the recombinant plasmid is pPN01 template plasmid, and can be purchased from the market or stored in a laboratory after being synthesized by a gene design company. The template plasmid contains gapDH promoter, thiamphenicol resistance gene,hptGene, puc19 initiation region,tdkGenes, replication proteins and ampicillin resistance genes.

1) PCR Gene amplification

pPN01 is used as a template plasmid, an upstream recombination fragment 1 (US) of the replaced DNA (SEQ ID No: 1) is inserted at the front end of the promoter P-gapD, and an upstream recombination fragment 2 (DS) of the replaced DNA (SEQ ID No: 1), a Clocl-1298 gene and a downstream recombination fragment (INS) of the replaced DNA (SEQ ID No: 1) are inserted at the rear end of the hpt gene.

The three recombinant fragments of the replaced DNA constructed by the gene insertion plasmid pPN01 are obtained by PCR of the following three pairs of primers and the head-tail connecting fragment of the 20-25bp template plasmid.

Upstream fragment 1 primer 1: GCGGCTCAATGTTTGGAA the flow of the air in the air conditioner,

upstream fragment 1, primer 2: TCTGGGTCTACTCCTCCT, respectively;

upstream fragment 2 primer 1: ATCTTGACGGAATGCAGG the flow of the air in the air conditioner,

upstream fragment 2 primer 2: TCTGGGTCTACTCCTCCT, respectively;

downstream fragment primer 1: ACTCTACAGACTTGGCAAT the flow of the air in the air conditioner,

downstream fragment primer 2: TCCATCTGTTTTGCCCTTT are provided.

The PCR reaction system is as follows: the dosage of the primer 1 of the upstream, middle and downstream fragments is 0.4 muL respectively, the dosage of the primer 2 of the upstream, middle and downstream fragments is 0.4 muL respectively, the dosage of bacterial liquid or plasmid is 1 muL, the dosage of prime star is 5 muL (efficiency is 10 s/kb), and the dosage of sterile water is 3.2 muL. The primer concentration was 10. mu.M.

The PCR reaction program is: pre-denaturation at 98 ℃ for 2 min; denaturation at 98 ℃ for 10 s, annealing at 55 ℃ for 10 s, extension at 72 ℃ for 30 s to 2 min for 30 s, cycle number 30; further extension at 72 deg.C for 2 min, and heat preservation at 12 deg.C for 20 min.

2) pPN01 linearization of template plasmid and recovery of vector fragment:

the pPN01 template plasmid was linearized using the following primers and PCR conditions:

primer 1: CTTACTCTAGCAGACTTGGCAATG the flow of the air in the air conditioner,

primer 2: TCCATCTGTTTCGTTTGCCCTTTCC is added.

The PCR reaction system is as follows: the primer 1 dosage is 0.4 muL, the primer 2 dosage is 0.4 muL, the bacterial liquid or plasmid dosage is 1 muL, the prime star dosage is 5 muL (efficiency is 10 s/kb), and the sterile water dosage is 3.2 muL. The primer concentration was 10. mu.M.

The PCR reaction program is: performing pre-denaturation at 98 ℃ for 2 min; denaturation at 98 ℃ for 10 s, annealing at 55 ℃ for 10 s, extension at 72 ℃ for 30 s to 2 min for 30 s, cycle number 30; further extension at 72 deg.C for 2 min, and heat preservation at 12 deg.C for 20 min.

Connecting the three sections of recombinant fragments, Clocj1298 and the linearized template plasmid pPN01 by using Gibson Assembly (30 ng of each of the three sections of recombinant fragments and Clocj1298, pPN 0130 ng of the linearized template plasmid, 5 mu L of Gibson Assembly, supplementing sterile water to 10 mu L, and preserving heat at 50 ℃ for 1 h), transferring the obtained product into escherichia coli competent cells BL21 and coating the obtained product on a rubber plate containing benzyl, and using the next pair of primers for PCR screening confirmation after the growth of the bacteria. The recombinant plasmid PUC-Clocl-1298 with the Clocl-1298 gene inserted therein was obtained.

Primer 1: AGCGGTAAAAGTGAAGAAC, primer 2: TGGGCCCCTACTAAAATGA are provided. The PCR reaction system is as follows: the primer 1 dosage is 0.4 muL, the primer 2 dosage is 0.4 muL, the bacterial liquid or plasmid dosage is 1 muL, the prime star dosage is 5 muL (efficiency is 10 s/kb), and the sterile water dosage is 3.2 muL, wherein the primer concentration is 10 muM. The PCR reaction program is: pre-denaturation at 98 ℃ for 2 min; denaturation at 98 ℃ for 10 s, annealing at 55 ℃ for 10 s, extension at 72 ℃ for 30 s to 2 min for 30 s, cycle number 30; further extension at 72 deg.C for 2 min, and heat preservation at 12 deg.C for 20 min.

The reaction solution after PCR amplification was subjected to agarose gel electrophoresis (2% agarose, 110V, 30 min), and the size of the positive validation gel pattern band was 473 bp, indicating that the Clocl-1298 gene was successfully inserted into the template plasmid pPN 01.

FIG. 1 is a map of a recombinant plasmid PUC-Clocl-1298 into which the Clocl-1298 gene is inserted, wherein the upstream fragment 1 is 923 bp, the upstream fragment 2 is 370 bp, and the downstream fragment is 877 bp.

(2) Transfer of recombinant plasmid PUC-Clocl-1298

The recombinant plasmid PUC-Clocl-1298 is transferred into clostridium thermocellum PN2102 by utilizing electric transformation, and a target gene sequence is inserted into a clostridium thermocellum genome through homologous recombination and resistance screening. The operation steps are as follows:

1) cell growth

After 50 mL of the bacterial solution was cultured to OD600=0.6-1, it was placed on ice for 20 minutes.

2) Cell collection and washing

Centrifuging at 6500 g and 4 deg.C for 10 min to collect Clostridium thermocellum cells, carefully pouring off the supernatant after centrifugation, carefully adding washing buffer (steam sterilized reverse osmosis purified water) to the centrifuge tube or flask without stirring the precipitate, centrifuging at 6500 g and 4 deg.C for 10 min, carefully pouring off the supernatant, and repeating the above steps twice.

3) Electric conversion

The collected cells were placed in an anaerobic chamber and gently resuspended in 100. mu.L of anaerobic wash buffer. Subsequently, 20. mu.L of the cell suspension and 1. mu.g of DNA were added to a standard 1 mm cuvette and mixed well. The electrotransformation conditions are set to be 1500V and the duration time is 1.5 ms for electrotransformation.

4) Incubating the electrically transformed cells

The electrotransferred Clostridium thermocellum PN2102 competent cells were remixed with 1 mL of CTFUD medium and incubated at 51 ℃ for 16 hours.

(3) Positive monoclonal selection and validation

1) Selection of transformed cells

The CTFUD solid medium was thawed and cooled to 55 ℃, 1 mL of thiamphenicol (6 mg/mL) and 50. mu.L of the incubated electro-transformed cells were added to 20 mL of the CTFUD solid medium and poured into a plate, the medium in the plate was allowed to solidify for 30 minutes at room temperature, and then the plate was left to incubate at 55 ℃ for 3-5 days.

2) A single colony was selected and PCR was performed using the following pair of primers to verify whether the PUC-Clocl-1298 recombinant plasmid had been transferred into competent cells of Clostridium thermocellum PN 2102.

Primer 1: AGCGGTAAAAGTGAAGAAC, respectively; primer 2: TGGGCCCCTACTAAAATGA are provided.

The reaction solution after PCR amplification was subjected to 2% agarose gel electrophoresis (110V, 30 min). The size of the positive validation gel strip was 473 bp, indicating that the recombinant plasmid PUC-Clocl-1298 was successfully transferred into competent cells of Clostridium thermocellum.

The single clone cell colony after being verified is inoculated into CTFUD liquid culture medium containing thiamphenicol (6 mg/mL) and cultured for 1-2 days at 55 ℃.

3) mu.L to 1 mL of the culture solution was added to 20 mL of CTFUD solid medium containing thiamphenicol (6 mg/L) and FUDR (10 mg/L), poured onto a plate, the medium in the plate was allowed to solidify at room temperature for 30 minutes, and then the plate was left to stand at 55 ℃ for culture for 2 to 5 days.

4) A single colony was picked and PCR verified using the following pair of primers to verify whether the upstream fragment 1 and the downstream fragment in plasmid PUC-Clocl-1298 had recombined onto the genome of Clostridium thermocellum PN 2102.

Primer 1: GCGGCTCAATGTTTGGAA, respectively;

primer 2: TCCATCTGTTTTGCCCTTT are provided.

The PCR amplification products were subjected to 2% agarose gel electrophoresis (110V, 30 min). The size of the positive validation glue picture strip is 5014 bp, which indicates that the upstream fragment 1 and the downstream fragment in the recombinant plasmid are recombined on the genome of the clostridium thermocellum.

The confirmed monoclonal cell colonies were added to 20 mL of CTFUD solid medium containing 8AZH (500 mg/L) and poured into a plate, the medium in the plate was allowed to solidify at room temperature for 30 minutes, and the plate was then incubated at 55 ℃ for 2-5 days.

5) A single colony is selected, and the following pair of primers is used for PCR verification to determine whether the two upstream fragments 2 on the genome of the recombinant clostridium thermocellum are recombined.

Primer 1: GCGGCTCAATGTTTGGAA, respectively;

primer 2: TCCATCTGTTTTGCCCTTT are provided.

The PCR amplification product was run on a gel (2% agarose gel electrophoresis, 110V, 30 min) and the positive validation gel size was 2784 bp, indicating that the two upstream fragments 2 had recombined onto the C.thermocellum genome.

The single clone cell colony after being verified is added into 5 mL culture medium to be cultured for 1-2 days and then is preserved.

Example 2 fermentation culture of Clostridium thermocellum engineering bacteria

(1) Preparation of culture Medium

The medium of this example was MTC medium, prepared as shown in table 1. After the preparation of the solution A is finished, sterilizing at 121 ℃ for 20 min; B. c, D, E the liquid is prepared according to the table, and is filled in an anaerobic bottle, the bottle is sealed by a rubber plug and an aluminum cover, and then the bottle is repeatedly vacuumized and filled with high-purity nitrogen for 3 times, and finally the interior of the anaerobic bottle is kept at positive pressure. The 5 culture solutions are injected into the sterilized anaerobic bottle filled with the solution A in a super clean bench by using a disposable sterile syringe and a sterile filter membrane of 0.22 mu m according to a ratio of 40:2:1:1:1 (v/v), and the total volume of the culture solutions does not exceed 40% of the volume of the anaerobic bottle. Wherein, the carbon source (microcrystalline cellulose or straw fiber) in the solution A is microcrystalline cellulose Avicel PH105 in the seed culture medium, and the concentration is 5 g/L; straw fiber is used in the fermentation process for producing enzyme, and the concentration is 5 g/L.

TABLE 1 culture Medium formulation

(2) Preparing a seed solution: thawing the strain of the clostridium thermocellum engineering bacteria preserved at the temperature of-80 ℃ in a refrigerator at the temperature of 4 ℃, sucking 1 mL of the strain under the aseptic condition, injecting the strain into a seed culture medium, and culturing the strain for 24 hours at the temperature of 55 ℃ and at the speed of 200 rpm; the formulation of the seed medium is shown in Table 1, and the carbon source in solution A is microcrystalline cellulose (Avicel PH 105) at 5.00 g/L.

(3) Fermentation: inoculating the seed solution into fermentation medium at an inoculum size of 10% (v/v), and culturing at 55 deg.C and 200 rpm for 16 h to obtain fermentation liquid. The formulation of the fermentation medium is shown in Table 1, the carbon source is 5.00 g/L straw fiber, which can be extracted by pre-treating agricultural straw, see step (1) of example 4.

Example 4 application of Clostridium thermocellum engineering bacteria in lignocellulose hydrolysis

(1) Preparing wheat straw fiber:

cleaning and chopping wheat straw raw materials, and treating by using sodium hydroxide and sodium sulfite, wherein the weight of the sodium hydroxide is as follows: the absolute dry weight of the wheat straw raw material is 1:6, and the weight ratio of sodium sulfite: the weight ratio of sodium hydroxide is 1:3, and the treatment conditions are as follows: the reaction temperature is 150 ℃ and the reaction time is 2 h. After the lignin is fully removed, extracting the wheat straw fiber, dehydrating and fully washing off residual alkali liquor;

(2) hydrolysis of wheat straw fiber:

soaking the straw fiber in acetic acid-sodium acetate (or similar buffer pair with buffer effect), adding clostridium thermocellum fermentation liquor, and hydrolyzing the straw fiber to obtain hydrolysate. The hydrolysis conditions were as follows: the pH value is 5, the solid-to-liquid ratio is 1:10, the adding amount of the clostridium thermocellum fermentation liquor of unit mass straw fibers is 20 mL, the cellulase 10 FPU and the xylanase are 4 mg, the reaction temperature is 50 ℃, the reaction time is 24 hours, and the oscillation rate is 200 r/min.

At the end of the hydrolysis, the xylose concentration in the hydrolysate was about 8.00 g/L and the glucose concentration was 64.50 g/L. Under the same conditions, Clostridium thermocellum was usedClostridium thermocellumWhen PN2102 (preservation number CGMCC No. 22869) fermentation liquor is hydrolyzed, the hydrolysis time is 24 hours, the xylose concentration is about 7.75 g/L, and the glucose concentration is 57.50 g/L.

The present invention has been described in detail with reference to the examples, but the present invention is only preferred examples of the present invention and should not be construed as limiting the scope of the present invention. All equivalent changes and modifications made within the scope of the present invention shall fall within the scope of the present invention.

SEQUENCE LISTING

<110> Suzhou polyester vitamin element creation Biotech Co., Ltd

<120> engineering strain capable of secreting fiber swelling protein, construction method and application

<130>

<160> 2

<170> PatentIn version 3.3

<210> 1

<211> 143

<212> DNA

<213> cel9K gene on Clostridium thermocellum genome

<400> 1

agaaccggag gttatttatg gtgactgcaa tggcgacgga aaagttaatt caactgacgc 60

tgtggcattg aagagatata tcttgagatc aggtataagc atcaacactg ataatgctga 120

tgtaaatgct gatggcagag tta 143

<210> 2

<211> 984

<212> DNA

<213> nucleotides of the fiber swollenin gene Clocl-1298

<400> 2

atgaatttta aaaaaatcag gcttttcact gccattttaa ttatagctgc tcaagtttta 60

tcctataatt ttatctcttc cgcccaactt caagttggag atgtcaatgg agacaataat 120

gtggatagta ttgactttgc attgatgaaa agctttatat tgaaaattat caatactctt 180

cctgccgaag attccctttt ggcaggtgac ttggacggag acggttctat aaacagcatt 240

gactgtgctt taatgaaaca atatcttctc ggaatgatca aagtttttcc caaaactcaa 300

tctccagcac ctacaccgac aaatacacca ttgcctgaat acagcgagcc atatcccgga 360

tgggataaaa tacgctcagg gtatgccact tataccggtt caggatatgt aggcggaatt 420

gcccttttag atccaattcc tgaagatatg gaaattgtgg ccgttaacaa acccgatttt 480

aattgttacg gtgtacaggc cgctctagcc ggtgcatatt tggaggtaac agggcctaaa 540

ggtaccacag ttgtctatgt aaccgattgc tatacggaag ccccggaagg tgctttggac 600

ctttgcggaa tttcctgtga taaaataggc gatacaaatg ttcccggagg taaaattgat 660

gtaacatggc gtattatacc tgctcccatc accggaaatt ttatataccg aatcttgccg 720

gccagttcaa aatggtggtt tgccatacaa gtaagaaatc acaaatatcc tgtaatgaaa 780

atggaatact ttaaagacgg cgaatgggtc gacattccca aggaccgctg caactatttt 840

gtgataaata atttggatac ttccaacctt aaaatcagaa ttaccgatat ccgcggcaag 900

gttgtaaccg atattataga ccctattccc gacaatctca tgaatggctg ttttatccag 960

ggcaatgttc aatttccgga ttaa 984

Claims

1. An engineering strain capable of secreting a fiber swelling protein, which is characterized in that: the strain is clostridium thermocellum engineering bacteria with a gene Clocl-1298 for recombinant expression of the fiber swelling protein.

2. The engineered strain of claim 1, wherein: the strain is an engineering bacterium obtained by replacing a nucleotide sequence of SEQ ID No. 1 in clostridium thermocellum cel9K with a fiber swelling protein gene Clocl-1298 through recombination.

3. The engineered strain of claim 1 or 2, wherein: the fiber expansion protein gene Clocl-1298 is derived from clostridium cleiflavi (Clocl-1298)Clostridium clarifavum）DSM19732。

4. The method for constructing engineered strain capable of secreting swollenin according to claim 1, wherein: the fiber swelling protein gene Clocl _1298 is recombined to the genome of the clostridium thermocellum to obtain the engineering strain capable of secreting the fiber swelling protein.

5. The construction method according to claim 4, wherein: replacing the nucleotide sequence shown as SEQ ID No. 1 in the cel9K gene on the clostridium thermocellum genome with the gene sequence of a fiber swelling protein gene Clocl-1298 to obtain the recombinant clostridium thermocellum engineering bacterium.

6. The construction method according to claim 4, wherein: the nucleotide sequence of the fiber swelling protein gene Clocl-1298 is shown as SEQ ID No. 2.

7. The construction method according to claim 4, wherein: the clostridium thermocellum is clostridium thermocellum (C)Clostridium thermocellum) PN2102 with preservation date of 2021 year, 07 month and 09 day, and preservation unit of China general microbiological culture Collection center with preservation number of CGMCC No. 22869.

8. The building method according to claim 4, characterized by comprising the steps of: (1) designing and constructing a recombinant plasmid PUC-Clocl-1298 into which the fiber expansion protein gene is inserted; (2) transferring the recombinant plasmid PUC-Clocl-1298 into Clostridium thermocellum; (3) and selecting and PCR verifying positive monoclone to obtain the recombinant Clostridium thermocellum engineering strain.

9. Use of the engineered strain capable of secreting swollenin according to claim 1 in the hydrolysis of lignocellulose.

10. Use according to claim 9, characterized in that: the anaerobic fermentation broth of the clostridium thermocellum engineering bacteria is compounded with cellulase to hydrolyze the straw fiber.