CN114807067A

CN114807067A - Engineering strain capable of secreting laccase and construction method and application thereof

Info

Publication number: CN114807067A
Application number: CN202210337447.2A
Authority: CN
Inventors: 张天元; 邵雄俊; 薛怡芸
Original assignee: Suzhou Juwei Yuanchuang Biotechnology Co ltd
Current assignee: Suzhou Juwei Yuanchuang Biotechnology Co ltd
Priority date: 2022-03-31
Filing date: 2022-03-31
Publication date: 2022-07-29

Abstract

The invention relates to the technical field of genetic engineering, and particularly provides an engineering strain capable of secreting laccase, wherein the engineering strain is a clostridium thermocellum engineering strain with a gene Tfu _1114 for recombinant expression of laccase, and is derived from brown high-temperature bifidobacteriumThermobifida fuscaThe laccase gene Ttu _1114 is introduced into clostridium thermocellum to construct a clostridium thermocellum engineering bacterium for recombining and expressing the gene. The clostridium thermocellum engineering bacterium can efficiently express laccase. The invention also discloses that the clostridium thermocellum engineering strain can be efficiently applied to the hydrolysis of lignocellulose and has good application prospect.

Description

Engineering strain capable of secreting laccase and construction method and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to an engineering strain capable of secreting laccase, and a construction method and application thereof.

Background

Lignocellulose is a renewable resource which is widely distributed, large in quantity and difficult to treat, and has important significance in converting the lignocellulose into renewable energy. Lignocellulose mainly comprises cellulose, hemicellulose and lignin, wherein the cellulose is a highly ordered and tightly combined crystal structure, is tightly connected with the hemicellulose, and is surrounded by the lignin at the periphery. Lignin is generally considered to be the most important factor for limiting the degradation of lignocellulose, lignin further consolidates the cell wall structure through covalent linkage with other components of the cell wall, increases the steric resistance, and thus plays a limiting role in enzymatic hydrolysis, and lignin has an adsorption capacity on enzymes, and can influence the efficiency of enzymatic hydrolysis through nonspecific or non-productive adsorption on cellulase, so that it is rather difficult to directly hydrolyze cellulose into available glucose.

At present, cellulase derived from filamentous fungi is mostly used for enzymatic hydrolysis of lignocellulose, which is typically Trichoderma, Aspergillus, Penicillium and the like, but the enzyme consumption is high in the enzymatic hydrolysis process, the activity is easily inhibited by products, and the enzyme proteins are not high-temperature resistant and acid-base resistant, so that the large-scale application of the cellulase is restricted.

The clostridium thermophilum is one of the microorganisms which are known to degrade cellulose most efficiently in nature at present, and secreted cellulosome has extremely strong cellulose degradation capability. The cellulosome has about 50 times greater ability to degrade cellulose than Trichoderma, and this efficiency depends on the particular structure of the cellulosome. The clostridium thermocellum is a strict anaerobic thermophilic microorganism and a special growth condition, so that the secreted lignocellulose hydrolase has better heat resistance and extremely small risk of mixed bacteria pollution.

Laccase is a copper-containing polyphenol oxidase, can selectively catalyze lignin degradation without generating toxic substances, and lignin is one of the most important reasons for influencing lignocellulose hydrolysis, so that the laccase applied to the lignocellulose hydrolysis can effectively improve the hydrolysis efficiency, can also effectively reduce the content of lignin in hydrolysate, and provides a better basis for further utilization of the hydrolysate.

Disclosure of Invention

In order to overcome the defects of the prior art, the invention provides an engineering strain capable of secreting laccase and a construction method and application thereof, the enzyme hydrolysis efficiency of the clostridium thermocellum is enhanced through the synergistic effect of the laccase, and the content of soluble lignin in sugar liquor obtained by hydrolysis of the clostridium thermocellum is equivalent to that of the sugar liquor decolored by activated carbon under the condition that the sugar liquor is not decolored by activated carbon.

In order to achieve the aim, the invention provides an engineering strain capable of secreting laccase, and the engineering strain is a clostridium thermocellum engineering strain with a Tfu _1114 gene for recombinant expression of laccase.

The strain is an engineering bacterium obtained by replacing a nucleotide sequence of SEQ ID No. 1 in clostridium thermocellum cel9K with laccase gene Tfu _1114 through recombination.

The nucleotide sequence of the laccase gene Ttu _1114 is SEQ ID No. 2.

The clostridium thermocellum engineering strain comprises a nucleotide sequence shown as SEQ ID No. 2.

The laccase gene Ttu _1114 is derived from a laccase gene Ttu _1114 of Bifidobacterium fuscus (Thermobifida fusca) YX.

The invention also provides a construction method of an engineering strain capable of secreting laccase, which is characterized in that a laccase gene Ttu _1114 is introduced into a clostridium thermocellum genome to construct a clostridium thermocellum engineering bacterium for recombining and expressing the gene, so as to obtain the engineering strain capable of secreting the fiber swelling protein.

A wild strain of clostridium thermocellum is used as an initial strain, fusion protein is constructed by replacing a partial sequence of a cel9K gene on a genome of clostridium thermocellum to express a laccase gene Ttu _1114, wherein the replaced gene sequence in the cel9K gene is shown as SEQ ID No. 1, and the gene sequence of the laccase gene Ttu _1114 is shown as SEQ ID No. 2.

The Clostridium thermocellum is Clostridium thermocellum (Clostridium thermocellum) PN2102, the preservation date is 2021, 07 and 09 days, the preservation unit is the common microorganism center of China Committee for culture Collection of microorganisms, the preservation address is No. 3 of Xilu No. 1 of Beijing, Chaoyang district, and the preservation number is CGMCC No. 22869.

Further preferably, the above construction method comprises the steps of: (1) performing PCR amplification by using a brown high-temperature bifidobacterium (Thermobifida fusca) YX genome as a template and using PUC19 as an expression vector; (2) connecting Tfu _1114 gene through Gibson Assembly to construct a recombinant plasmid pPN 01; (3) transferring the recombinant plasmid pPN01 into clostridium thermocellum, so that a target gene Ttu _1114 sequence is inserted into a genome of the clostridium thermocellum; (4) and selecting positive monoclonals, carrying out PCR verification, and then culturing to obtain positive transformation strains.

The invention also provides application of the engineering strain capable of secreting laccase in lignocellulose hydrolysis, and fermentation liquor obtained by anaerobic fermentation of clostridium thermocellum engineering bacteria is compounded with other cellulase to hydrolyze straw fibers. The method specifically comprises the following steps:

(1) pretreatment of lignocellulose: common agricultural straws are taken as raw materials, and are pretreated by one or two of physical and chemical methods to remove lignin and extract straw fibers; (2) anaerobic fermentation of clostridium thermocellum engineering bacteria: sequentially carrying out seed culture and anaerobic fermentation on the fuscoporia thermocellum engineering bacteria to obtain fermentation liquor; (3) fiber hydrolysis: and (3) compounding the fermentation liquor obtained in the step (2) with other cellulase to hydrolyze the fiber obtained by the treatment in the step (1).

Preferably, in the step (1), the pretreatment of lignocellulose comprises the following specific steps: cleaning and chopping straw raw materials, carrying out hydrothermal reaction under an alkaline condition, fully removing lignin, extracting straw fiber, dehydrating and fully washing off residual alkaline liquor; the alkali is sodium hydroxide and sodium sulfite; the weight of the sodium hydroxide is as follows: the absolute dry weight of the straw raw material is 1 (4-6), and the weight ratio of sodium sulfite: the weight ratio of the sodium hydroxide is 1 (3-5); the treatment conditions were: the reaction temperature is 150 ℃ and 160 ℃, and the reaction time is 1-3 h.

Preferably, in the step (2), the process of seed culture and anaerobic fermentation is as follows: A. seed culture: thawing the strain of Clostridium thermocellum engineering bacteria preserved at-80 deg.C in a refrigerator at 4 deg.C, sucking 1mL strain under aseptic condition, injecting into seed culture medium, and culturing at 55 deg.C and 200rpm for 16-24 hr; B. anaerobic fermentation: then inoculating into fermentation medium with an inoculum size of 5% -10% (v/v), and culturing at 55 deg.C and 200rpm for 16-24 h.

Further preferably, the culture medium in step (2) is an MTC culture medium, and comprises a solution A, a solution B, a solution C, a solution D and a solution E, wherein the volume ratio of the solution A to the solution B is 40:2:1:1:1, and the solution A is 5g/L carbon source (microcrystalline cellulose or straw fiber) and 10.00g/L MOPS; the solution B is 50.00g/L tripotassium citrate, 31.25g/L citric acid monohydrate, and 25.00g/L Na ₂ SO ₄ 、 25.00g/L KH ₂ PO ₄ 、62.50g/L NaHCO ₃ (ii) a The solution C is 250.00g/L urea, and the solution D is 50.00g/L MgCl ₂ ·6H ₂ O、10.00g/L CaCl ₂ ·2H ₂ O、5.00g/L FeCl ₂ ·4H ₂ O, 50.00g/L L-cysteine hydrochloride; the E solution is 1.00g/L pyridoxamine dihydrochloride, 0.20g/L p-aminobenzoic acid, 0.10g/L biotin and 0.10g/L VB ₁₂ 。

More preferably, in the step (2), the carbon source of the solution A in the seed culture medium is 5.00g/L microcrystalline cellulose, and more preferably microcrystalline cellulose Avicel PH 105; the carbon source in the fermentation medium is 5.00g/L straw fiber, and the straw fiber prepared in the step (1) is more preferable.

Preferably, in the step (3), the fiber hydrolysis comprises the following specific steps: pH is 4.5-5.5, the solid-liquid ratio (absolute dry weight of straw fiber) is 1 (10-30), the reaction temperature is 45-55 ℃, 10-20mL of clostridium thermocellum fermentation liquor, 0-10FPU of cellulase and 4mg of xylanase are added into the straw fiber per unit mass; the hydrolysis time is 12-48h, and the stirring speed is 200 rpm.

The invention has the beneficial effects that: the invention is modified by gene engineering, and replaces partial sequence of cel9K gene on the genome of clostridium thermocellum with laccase Tfu _1114 gene from brown high-temperature bifidobacterium (Thermobifida fusca) YX, thereby constructing the fusion protein with laccase bioactivity. The clostridium thermocellum engineering bacteria can be efficiently applied to hydrolysis of lignocellulose, the enzyme hydrolysis efficiency of clostridium thermocellum is enhanced through the synergistic effect of laccase, the content of soluble lignin in sugar liquor obtained after hydrolysis of clostridium thermocellum is equivalent to that of sugar liquor subjected to decolorization by activated carbon under the condition that activated carbon is not added in the sugar liquor, and the clostridium thermocellum engineering bacteria is also completely suitable for fermentation culture of microorganisms such as chlorella (with the lignin tolerance concentration of 110 mg/L) when the sugar liquor is further utilized in the later period.

Drawings

FIG. 1 is a map of a recombinant plasmid pPN01 having a Tfu _1114 gene inserted into Clostridium thermocellum PN 2102;

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention clearer, the present invention will be described in further detail with reference to embodiments, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The present invention uses conventional techniques and methods used IN the fields of genetic engineering and MOLECULAR BIOLOGY, such as the methods described IN MOLECULAR CLONING, A LABORATORY MANUAL,3nd Ed. (Sambrook,2001) and CURRENTPROTOLS IN MOLECULAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, it is not intended that the invention be limited to any particular methodology, protocols, and reagents described, as these may vary.

In order to better understand the technical solutions, the technical solutions will be described in detail with reference to specific embodiments.

Example 1 construction of engineered Strain of Clostridium thermocellum

The media used in the examples were: CTFUD medium (g/L): 3.00 sodium citrate dihydrate, 1.30 (NH) ₄ ) ₂ SO ₄ 、 1.50 KH ₂ PO ₄ 、0.13 CaCl ₂ ·2H ₂ O, 0.5L-cysteine hydrochloride, 11.56 MOPS-Na, 2.60 MgCl ₂ ·6H ₂ O、 0.001 FeSO ₄ ·7H ₂ O、5.00 Avicel pH 105、4.50 YEIf a solid medium is prepared, 10g/L agar is added. The test materials used in the examples were purchased from a conventional biochemical reagent store unless otherwise specified. The experimental procedures in the examples are conventional unless otherwise specified.

The invention obtains the clostridium thermocellum engineering strain for recombining and expressing the laccase gene Ttu _1114 by replacing a partial sequence of the cel9K gene on the clostridium thermocellum genome with the laccase gene Ttu _ 1114.

Partial gene sequence in the replacement pre-cel 9K gene is shown as SEQ ID No. 1:

AGAACCGGAGGTTATTTATGGTGACTGCAATGGCGACGGAAAAGTTAATTCAAC TGACGCTGTGGCATTGAAGAGATATATCTTGAGATCAGGTATAAGCATCAACACTGA TAATGCTGATGTAAATGCTGATGGCAGAGTTA

the gene sequence of the laccase gene is shown as SEQ ID No. 2:

GTTACCGGAACAGTTGTTGAGCTCGCACCGGGTATCCATGCAGGCTTTACAGGA CGTGCAGGCGGCGTTAGCGGTGAGCCGTACGCAACACTTAACCTTGGAGATCATGTT GGGGATGATCCAGCGGCAGTTGCAGAGAACAGACGAAGAGCAGCACTTGGTTTTGG TATTAGCCCGGATAGAGTTGTTTGGATGAACCAGGTTCATGGAGCAACAGCAGTTAC AGTTACAGGCAGCGGACAGGCAGGTGATGTTGATGCGGTTGTTACACCGGAGGCGG GACTTGCACTCGCAGTTCTTGTTGCAGATTGCCTTCCGCTTCTTGTTGCAGATGCAGC GGCAGGTGTTATTGGAGCAGCACATGCAGGCAGACCGGGAATGGCAGCAGGCGTTG TTCCAGCACTTGTTGCAGAGATGGCAAGACATGGTGCAAGACCGGAGAGATGTGTCG CACTTCTTGGTCCGGCAATTTGCGGAAGATGCTACGAGGTTCCGAGAGATCTTCAGG ATCGAGTTGCAAGAACCGTCCCAGAGGCAAGATGCACGACAGCAGAGGGAACGCCA GGCCTAGATATCCGGGCAGGCGTTACAGCGCAGCTCACCAACCTCGGAGTTACCAAC ATTACGCACGATTCGAGATGTACGAGAGAGAGCGCAGATCTCTTTAGCTACAGACGA GATGCAACAACAGGCAGATTTGCAGGCTACGTTTGGCGAGTTCCATAA

the specific implementation method comprises the following steps:

(1) design and construction of recombinant plasmid pPN01

Laccase gene Tfu _1114 is derived from Bifidobacterium fuscus (Thermobifida fusca) YX. The Gene ID number of the YX laccase Gene from Bifidobacterium fuscus (Thermobifida fusca) obtained from NCBI and literature is Gene ID: 3579296, the laccase gene is synthesized by Nanjing Kinshire Biotechnology GmbH, named as Tfu _1114, and codon optimization is carried out, wherein the sequence of Tfu _1114 is SEQ ID NO: 2.

The template plasmid was PUC19, which was either commercially available or synthesized by gene design companies. Comprising the gapDH promoter, the thiamphenicol resistance gene, the hpt gene, the puc19 initiation region, the tdk gene, the replication protein and the ampicillin resistance gene. The template plasmid PUC19 was stored in the laboratory.

pPN01 recombinant plasmids were constructed by Gibson Assembly ligation, then transferred into BL21 and screened on a benzyl-amino-containing gel plate. The method comprises the following specific steps:

A.PCR amplification

The genome of the Bifidobacterium fuscus YX and the plasmid PUC19 are used as templates, an upstream recombination fragment 1 of the replaced DNA is inserted at the front end of a promoter gapDH, and an upstream recombination fragment 2 of the replaced DNA, a Tfu _1114 gene and a downstream recombination fragment of the replaced DNA are inserted at the rear end of an hpt gene. The three-section recombinant fragment of the replaced DNA for constructing the gene insertion plasmid is obtained by PCR of the following three pairs of primers and the head-tail connecting fragment of the 20-25bp template plasmid.

Upstream fragment 1 primer 1: GCGGCTCAATGTTTGGAA the flow of the air in the air conditioner,

upstream fragment 1, primer 2: TCTGGGTCTACTCCTCCT, respectively;

upstream fragment 2 primer 1: ATCTTGACGGAATGCAGG the flow of the air in the air conditioner,

upstream fragment 2 primer 2: TCTGGGTCTACTCCTCCT, respectively;

downstream fragment primer 1: ACTCTACAGACTTGGCAAT the flow of the air in the air conditioner,

downstream fragment primer 2: TCCATCTGTTTTGCCCTTT are provided.

The PCR reaction system is as follows: 0.4. mu.L of each of the upstream fragment 1, the upstream fragment 2 and the downstream fragment primer 1, 0.4. mu.L of each of the upstream fragment 1, the upstream fragment 2 and the downstream fragment primer 2, 1. mu.L of a bacterial suspension or plasmid, 5. mu.L of a prime star (efficiency 10s/kb) and 3.2. mu.L of sterile water. The primer concentration was 10. mu.M.

The PCR reaction program is: pre-denaturation at 98 ℃ for 2 min; denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 10s, extension at 72 ℃ for 30s to 2min for 30s, and cycle number of 30; further extension at 72 deg.C for 2min, and heat preservation at 12 deg.C for 20 min.

B. Connection of target gene Ttu _1114 and linearized template plasmid PUC19

The template plasmid pUC19 was linearized using the following primers and PCR conditions:

primer 1: CTTACTCTAGCAGACTTGGCAATG the flow of the air in the air conditioner,

primer 2: TCCATCTGTTTCGTTTGCCCTTTCC are provided.

The PCR reaction system is as follows: primer 10.4. mu.L, primer 20.4. mu.L, bacterial suspension or plasmid 1. mu.L, prime star 5. mu.L (10 s/kb efficiency), sterile water 3.2. mu.L. The primer concentration was 10. mu.M.

The PCR reaction program is: pre-denaturation at 98 ℃ for 2 min; denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 10s, extension at 72 ℃ for 30s to 2min for 30s, cycle number 30; further extension at 72 deg.C for 2min, and heat preservation at 12 deg.C for 20 min.

Connecting the three sections of recombinant fragments, Tfu _1114 and the linearized template plasmid PUC19 by using Gibson Assembly (30 ng of each of the three sections of recombinant fragments and Tfu _1114, the linearized template plasmid PUC 1930 ng, 5 mu L of Gibson Assembly, sterile water to complement to 10 mu L, and keeping the temperature at 50 ℃ for 1h) to obtain a recombinant plasmid pPN 01; then, the recombinant plasmid pPN01 was transferred into E.coli competent cells BL21 and spread on a gel plate containing benzyl chloride, and after the colonies had grown out, PCR screening was performed using the following pair of primers.

Primer 1: AGCGGTAAAAGTGAAGAAC, respectively; primer 2: TGGGCCCCTACTAAAATGA are provided.

The PCR reaction system is as follows: primer 1 was used in an amount of 0.4. mu.L, primer 2 in an amount of 0.4. mu.L, a bacterial suspension or plasmid in an amount of 1. mu.L, prime star in an amount of 5. mu.L (efficiency 10s/kb), and sterile water in an amount of 3.2. mu.L, wherein each primer concentration was 10. mu.M.

The PCR reaction program is: performing pre-denaturation at 98 ℃ for 2 min; denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 10s, extension at 72 ℃ for 30s to 2min for 30s, cycle number 30; further extension at 72 deg.C for 2min, and heat preservation at 12 deg.C for 20 min.

C. Gel electrophoresis and recovery of PCR products

The reaction solution after PCR amplification is subjected to agarose gel electrophoresis (2% agarose, 110V, 30min), the DNA recovery fragment Ttu _1114 gene, and the size of the positive validation gel strip is 473bp, which indicates that the Ttu _1114 gene is successfully inserted into the template plasmid PUC 19.

The map of the recombinant plasmid pPN01 inserted with the Tfu _1114 gene is shown in figure 1, wherein the upstream fragment 1 is 923bp, the upstream fragment 2 is 370bp, and the downstream fragment is 877 bp.

(2) Transfer of recombinant plasmid pPN01

The recombinant plasmid pPN01 is transferred into clostridium thermocellum PN2102 by electric transformation, and a target gene sequence is inserted into clostridium thermocellum genome through homologous recombination and resistance screening. The operation steps are as follows:

1) cell growth

After 50mL of the bacterial solution was cultured until OD600 became 0.6-1, it was left on ice for 20 minutes.

2) Cell collection and washing

The Clostridium thermocellum PN2102 cells were collected by centrifugation at 6500g at 4 ℃ for 10 minutes, the supernatant was carefully decanted after centrifugation was completed, a washing buffer (reverse osmosis purified water sterilized with steam) was carefully added to the centrifuge tube or flask without stirring the precipitate during the addition, and then the cells were centrifuged again at 6500g at 4 ℃ for 10 minutes with careful decanting of the supernatant, and the above procedure was repeated twice.

3) Electric conversion

The collected cells were placed in an anaerobic chamber and gently resuspended in 100. mu.L of anaerobic wash buffer. Then, 20. mu.L of the cell suspension and 1. mu.g of DNA were added to a standard 1mm electric rotor and mixed well. The electric conversion conditions are set to be 1500V voltage and 1.5ms duration for electric conversion.

4) Incubating the electrically transformed cells

The cells after electroporation were remixed with 1mL of CTFUD medium and incubated at 51 ℃ for 16 hours.

(2) Positive monoclonal selection and validation

1) Selection of transformed cells

The CTFUD solid medium was thawed and cooled to 55 ℃, 1mL of thiamphenicol (6mg/mL) and 50. mu.L of the incubated electro-transformed cells were added to 20mL of the CTFUD solid medium and poured into a plate, the medium in the plate was allowed to solidify for 30 minutes at room temperature, and then the plate was left to incubate at 55 ℃ for 3-5 days.

2) A single colony was selected and PCR was performed using the following pair of primers to verify whether recombinant plasmid pPN01 had been transferred into competent cells of C.thermocellum PN 2102.

The reaction solution after PCR amplification is subjected to agarose gel electrophoresis detection experiment (2% agarose, 110V, 30min), the size of a positive verification gel picture strip is 473bp, which indicates that the recombinant plasmid pPN01 is successfully transferred into the clostridium thermocellum competent cells.

The single clone cell colony after being verified is inoculated into CTFUD liquid culture medium containing thiamphenicol (6mg/mL) and cultured for 1-2 days at 55 ℃.

3) mu.L to 1mL of the culture solution was added to 20mL of CTFUD solid medium containing thiamphenicol (6mg/L) and FUDR (10mg/L), poured onto a plate, the medium in the plate was allowed to solidify at room temperature for 30 minutes, and then the plate was left to incubate at 55 ℃ for 2 to 5 days.

4) A single colony was picked and PCR was performed using the following pair of primers to verify that the upstream fragment 1 and the downstream fragment of recombinant plasmid pPN01 had recombined onto the C.thermocellum genome.

Primer 1: GCGGCTCAATGTTTGGAA, respectively; primer 2: TCCATCTGTTTTGCCCTTT are provided.

The PCR reaction system is as follows: primer 1 was used in an amount of 0.4. mu.L, primer 2 in an amount of 0.4. mu.L, the bacterial suspension or plasmid in an amount of 1. mu.L, prime star in an amount of 5. mu.L (efficiency 10s/kb), and sterile water in an amount of 3.2. mu.L. The primer concentration was 10. mu.M.

The PCR amplification product was subjected to agarose gel electrophoresis (2% agarose, 110V, 30min) and the positive validation gel band size was 4756bp, indicating that the upstream fragment 1 and the downstream fragment in plasmid pPN01 had recombined into the C.thermocellum genome.

The colonies of the confirmed monoclonal cells were added to 20mL of CTFUD solid medium containing 8AZH (500mg/L) and poured into a plate, the medium in the plate was allowed to solidify at room temperature for 30 minutes, and the plate was then incubated at 55 ℃ for 2-5 days.

5) Monoclonal colonies were picked and PCR verified using the following pair of primers to verify that the two upstream fragments 2 on the genome were recombined.

Primer 1: GCGGCTCAATGTTTGGAA, respectively; primer 2: TCCATCTGTTTTGCCCTTT is added.

The PCR amplification product is subjected to agarose gel electrophoresis (2% agarose, 110V, 30min), and the size of a positive validation gel picture strip is 2526bp, which indicates that the two upstream fragments 2 on the genome are recombined.

The single clone cell colony after being verified is added into 5mLCTFUD culture medium to be cultured for 1-2 days and then is preserved. Obtaining the recombinant clostridium thermocellum engineering strain.

Example 2 fermentation culture of Clostridium thermocellum engineering bacteria

(1) Preparation of culture Medium

The MTC medium was used as the medium and prepared as shown in the following table (Table 1). After the preparation of the solution A is finished, sterilizing at 121 ℃ for 20 min; B. c, D, E the liquid is prepared according to the table, and is filled in an anaerobic bottle, the bottle is sealed by a rubber plug and an aluminum cover, and then the bottle is repeatedly vacuumized and filled with high-purity nitrogen for 3 times, and finally the interior of the anaerobic bottle is kept at positive pressure. The 5 culture solutions were injected into the sterilized anaerobic bottles containing solution A in a super clean bench according to a ratio of 40:2:1:1:1(v/v) using disposable sterile syringes and 0.22 μm sterile filter membranes, and the total volume did not exceed 40% of the volume of the anaerobic bottles. Wherein, the carbon source (microcrystalline cellulose or straw fiber) in the solution A is microcrystalline cellulose Avicel PH105 in the seed culture medium, and the concentration is 5 g/L; straw fiber is used in the fermentation process for producing enzyme, and the concentration is 5 g/L.

TABLE 1 MTC Medium formulation

(2) Preparing a seed solution: thawing the strain of the engineering bacteria of the clostridium thermocellum preserved at the temperature of-80 ℃ in a refrigerator at the temperature of 4 ℃, sucking 1mL of the strain under the aseptic condition, injecting the strain into a seed culture medium, and culturing the strain for 24 hours at the temperature of 55 ℃ and at the speed of 200 rpm; the formulation of the seed medium is shown in Table 1, and the carbon source in solution A was microcrystalline cellulose (Avicel PH 105) at 5.00 g/L.

(3) Fermentation: inoculating the seed solution into fermentation medium at an inoculum size of 10% (v/v), and culturing at 55 deg.C and 200rpm for 16h to obtain fermentation liquid. The formulation of the fermentation medium is shown in Table 1, the carbon source is 5.00g/L straw fiber, which can be extracted from agricultural straw by pretreatment, see step (1) of example 4.

Example 4 application of Clostridium thermocellum engineering bacteria in lignocellulose hydrolysis

(1) Preparing wheat straw fiber:

cleaning and chopping wheat straw raw materials, and treating by using sodium hydroxide and sodium sulfite, wherein the weight of the sodium hydroxide is as follows: the absolute dry weight of the wheat straw raw material is 1:6, and the weight ratio of sodium sulfite: the weight ratio of sodium hydroxide is 1:3, and the treatment conditions are as follows: the reaction temperature is 150 ℃ and the reaction time is 2 h. After the lignin is fully removed, extracting the wheat straw fiber, dehydrating and fully washing off residual alkali liquor.

(2) Hydrolysis of wheat straw fiber:

soaking the straw fiber in acetic acid-sodium acetate (or similar buffer pair with buffer effect), and adding the fusobacterium thermocellum fermentation liquid to hydrolyze the straw fiber. The hydrolysis conditions were as follows: the pH value is 5, the solid-to-liquid ratio is 1:10, the adding amount of clostridium thermocellum fermentation liquor of unit mass fiber is 20mL, the cellulase 10FPU and the xylanase are 4mg, the reaction temperature is 50 ℃, the reaction time is 48 hours, and the oscillation rate is 200 r/min.

After the hydrolysis is finished, the content of soluble lignin in the obtained hydrolysate is lower than 30 mg/L. Under the same conditions, when Clostridium thermocellum (Clostridium thermocellum) PN2102 fermentation liquor is used for hydrolysis, the content of soluble lignin in hydrolysate is about 160-183 mg/L, 80% of lignin can be removed after the activated carbon treatment, and the level of the lignin in the hydrolysate is equivalent to that of the lignin in the hydrolysate obtained by using the engineering bacteria.

The present invention has been described in detail with reference to the examples, but the present invention is only preferred examples of the present invention and should not be construed as limiting the scope of the present invention. All equivalent changes and modifications made within the scope of the present invention shall fall within the scope of the present invention.

SEQUENCE LISTING

<110> Suzhou polyester vitamin element creation Biotech Co., Ltd

<120> engineering strain capable of secreting laccase and construction method and application thereof

<130>

<160> 2

<170> PatentIn version 3.3

<210> 1

<211> 143

<212> DNA

<213> cel9K gene partial gene

<400> 1

agaaccggag gttatttatg gtgactgcaa tggcgacgga aaagttaatt caactgacgc 60

tgtggcattg aagagatata tcttgagatc aggtataagc atcaacactg ataatgctga 120

tgtaaatgct gatggcagag tta 143

<210> 2

<211> 726

<212> DNA

<213> laccase Gene Tfu _1114

<400> 2

gttaccggaa cagttgttga gctcgcaccg ggtatccatg caggctttac aggacgtgca 60

ggcggcgtta gcggtgagcc gtacgcaaca cttaaccttg gagatcatgt tggggatgat 120

ccagcggcag ttgcagagaa cagacgaaga gcagcacttg gttttggtat tagcccggat 180

agagttgttt ggatgaacca ggttcatgga gcaacagcag ttacagttac aggcagcgga 240

caggcaggtg atgttgatgc ggttgttaca ccggaggcgg gacttgcact cgcagttctt 300

gttgcagatt gccttccgct tcttgttgca gatgcagcgg caggtgttat tggagcagca 360

catgcaggca gaccgggaat ggcagcaggc gttgttccag cacttgttgc agagatggca 420

agacatggtg caagaccgga gagatgtgtc gcacttcttg gtccggcaat ttgcggaaga 480

tgctacgagg ttccgagaga tcttcaggat cgagttgcaa gaaccgtccc agaggcaaga 540

tgcacgacag cagagggaac gccaggccta gatatccggg caggcgttac agcgcagctc 600

accaacctcg gagttaccaa cattacgcac gattcgagat gtacgagaga gagcgcagat 660

ctctttagct acagacgaga tgcaacaaca ggcagatttg caggctacgt ttggcgagtt 720

ccataa 726

Claims

1. An engineering strain capable of secreting laccase, which is characterized in that: the engineering strain is a clostridium thermocellum engineering strain with a gene Tfu _1114 for recombinant expression of laccase.

2. The engineered strain of claim 1, wherein: the strain is an engineering bacterium obtained by replacing a nucleotide sequence of SEQ ID No. 1 in clostridium thermocellum cel9K with laccase gene Tfu _1114 through recombination.

3. The engineered strain of claim 2, wherein: the nucleotide sequence of the laccase gene Ttu _1114 is shown in SEQ ID No. 2.

4. The engineered strain of claim 1, wherein: the laccase gene Ttu _1114 is derived from a laccase gene Ttu _1114 of Bifidobacterium fuscus (Thermobifida fusca) YX.

5. The method for constructing the engineering strain capable of secreting laccase according to claim 1, wherein the engineering strain comprises: the laccase gene Ttu _1114 is introduced into a genome of clostridium thermocellum, and clostridium thermocellum engineering bacteria for recombining and expressing the gene is constructed to obtain an engineering strain capable of secreting the fiber swelling protein.

6. The construction method according to claim 1, characterized in that: a wild strain of clostridium thermocellum is used as an initial strain, fusion protein is constructed by replacing a partial sequence of a cel9K gene on a genome of clostridium thermocellum to express a laccase gene Ttu _1114, wherein the replaced gene sequence in the cel9K gene is shown as SEQ ID No. 1, and the gene sequence of the laccase gene Ttu _1114 is shown as SEQ ID No. 2.

7. The construction method according to claim 5, wherein: the Clostridium thermocellum is Clostridium thermocellum (Clostridium thermocellum) PN2102, the preservation date is 2021, 07 and 09 days, the preservation unit is the common microorganism center of China Committee for culture Collection of microorganisms, the preservation address is No. 3 of Xilu No. 1 of Beijing, Chaoyang district, and the preservation number is CGMCC No. 22869.

8. The construction method according to claim 5, wherein: the method comprises the following steps: (1) designing and constructing a recombinant plasmid pPN01 inserted with a laccase gene Ttu _ 1114; (2) transferring the recombinant plasmid pPN01 into clostridium thermocellum, so that the sequence of the target gene Ttu _1114 is inserted into the genome of clostridium thermocellum; (3) and selecting positive monoclone, carrying out PCR verification, and culturing to obtain the clostridium thermocellum engineering strain.

9. Use of the engineered strain of claim 1 that can secrete laccase in the hydrolysis of lignocellulose.

10. Use according to claim 9, characterized in that: the anaerobic fermentation broth of the clostridium thermocellum engineering bacteria is compounded with other cellulase to hydrolyze the straw fiber.