CN101392261B - Modified highly pathogenic porcine reproductive and respiratory syndrome virus ORF5 gene and application - Google Patents
Modified highly pathogenic porcine reproductive and respiratory syndrome virus ORF5 gene and application Download PDFInfo
- Publication number
- CN101392261B CN101392261B CN2008100487680A CN200810048768A CN101392261B CN 101392261 B CN101392261 B CN 101392261B CN 2008100487680 A CN2008100487680 A CN 2008100487680A CN 200810048768 A CN200810048768 A CN 200810048768A CN 101392261 B CN101392261 B CN 101392261B
- Authority
- CN
- China
- Prior art keywords
- gene
- porcine reproductive
- orf5
- leu
- orf5 gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention pertains to the technical field of animal virology and epizootiology, in particular to a cloning method of a modified type artificially synthesized high pathogenicity porcine reproductive and respiratory syndrome ORF5 gene and an application thereof serving as a vaccine, which is characterized in that: an artificially synthesized nucleotide sequence of a coded subsidiary T lymphocyte epitope is inserted between a neutralizing epitope and an overlapping epitope; glycosylation sites (N30, N34, N35 and N51) at the two ends of the neutralizing epitope are removed; and the codon of the ORF5 gene is changed into the codon that pig bodies prefer to, thus obtaining the high pathogenicity porcine reproductive and respiratory syndrome ORF5 gene; wherein, the nucleotide sequence is shown as a sequence table SEQ ID NO:1. The modified gene is contained in the eukaryotic expression plasmid pcDNA3.1-SynORF5 and the Escherichia coli DH5 Alpha/pcDNA3.1-SynORF5 containing the plasmid is preserved in CCTCC with a preservation number of CCTCC NO: M208112. The invention also discloses an application of the gene in preparing the DNA vaccine of porcine reproductive and respiratory syndrome.
Description
Technical field
The invention belongs to animal virology and epizootiology technical field.Be specifically related to the modification of a kind of high-pathogenicity porcine reproductive and respiratory syndrome virus variant ORF5 gene, utilize this application of modification back gene in the sick dna vaccination of preparation reproductive and respiratory syndrome.
Background technology
Porcine reproductive and respiratory syndrome (porcine reproductive and respiratory syndrome, PRRS, hereinafter referred PRRS) be a kind of new viral infectious of finding in recent years, with breeding difficultys such as sow heating, apocleisis, premature labor, miscarriage, stillborn foetus, weak son and various age pig respiratory system disease and high mortality be feature.This disease was reported in southern US early than 1987, had promptly propagated into the Midwest soon, and at the whole America rapid spread.Subsequently some countries such as Canada, Germany, Holland also successively broken out should disease (Bilodeau R et al, Porcine reproductiveand respiratory syndrome in Quebec.Vet Rec, 1991,129:102-103; Dea S, Bilodeau R, Athanassious R et al.Swine reproductive and respiratory syndrome virus in Quebec:isolation of an enveloped virusserologically-related to lelystad virus.Can Vet J.1992,33:801-808); The area, Asia reports that this sick time is later relatively, and this disease (Zhang Zhi's one-tenth etc., breeding of Taiwan pig and the evaluation of respiratory tract syndrome I virus, Chinese animal doctor's magazine, 1993,19 (4): 268-276) appearred in 1991 in the Taiwan; Japan broke out PRRS (Hiroyoshi Kuwaahara.An outbreak of PRRS in Japan.J Vet MedSci, 1994,56 (50): 901-909) in 1994; The China's Mainland reported that this disease came into vogue in 1996, and (Guo Baoqing etc. are from the research of doubtful PRRS aborted fetus separation porcine reproductive and respiratory syndrome virus, Chinese livestock and poultry transmissible disease, 1996,87 (2): 1-5) to be separated to virus.Above-mentioned document shows that porcine reproductive and respiratory syndrome caused enormous economic loss for global pig industry, and only European PRRS's in 1991 breaks out the death that has just caused 1,000,000 pigs.
Since in May, 2006, China has broken out the what is called " high fever syndrome of pigs " that is caused by highly pathogenic PRRSV, this disease with high heat, flush, be short of breath, clinical symptom such as nervous symptoms is principal character, there are characteristics of incidence such as high incidence, high mortality and low curative ratio, China's pig industry is caused great harm and great financial loss, had a strong impact on the stable production safety that reaches pig industry in increasing peasant income and pork consumption market.
Anti-system with other viral infectious of pig is the same, and the anti-system of PRRS also mainly is immunoprophylaxis.Be used at present to prevent PRRS vaccine mainly be weak malicious seedling and deactivation vaccine.Although attenuated vaccine can provide immunoprotection preferably, exist virulence to return strong danger, and it is quite high to return strong probability, this point state such as Denmark several years ago causes this disease to be confirmed in breaking out greatly because of being extensive use of weak malicious seedling.Compare with weak malicious seedling, though inactivated vaccine safety often needs the immunization of repeated multiple times, and the effect instability, also often cause immuning failure.We can say, at present unsatisfactory always to the anti-system of this disease, press for more safe and effective vaccine and prevent and control the generation of this disease and popular.
Porcine reproductive and respiratory syndrome virus (porcine reproductive and respiratory syndrome virus; PRRSV; hereinafter referred PRRSV) the glycoprotein GP5 of ORF5 genes encoding is a topmost protective antigen among the PRRSV; can induce humoral immunization and cellular immunization; and the topmost neutralizing epitope of determining at present also is positioned at its N end extracellular region; therefore be the preferred object gene (DeaS of design PRRS new generation vaccine; Gagnon CA; Mardassi H.Current knowledge on the structural proteins of porcine reproductive and respiratorysyndrome virus:comparison of the North American and European isolates.Arch Virol; 2000a, 145:659-688).(Pirzadeh B such as Pirzaden in 1998, Dea S.Immune response in pigs vaccinated with plasmid DNA encoding ORF5of Porcine Reproductive and Respiratory Syndrome Virus.J Gen Virol, 1998a, 79:989～999) the eukaryon expression plasmid immune swine of usefulness coding GP5, can make the inoculation pig produce the specific antibody of anti-GP5, the inoculation pig can avoid general viremia and the pulmonary lesion that strong virus attack causes, and interstitial pneumonia and broncho-alveolitis are obviously alleviated.(Kwang J such as Kwang in 1999, Zuckermann F, Ross G, et al.Antibody and cellular immune responses of swine following immunization with plasmid DNAencoding the PRRS virus ORFs4,5,6and 7.vet Sci, 1999,67:199～201) with gene constructed 4 kinds of dna vaccinations of coding GP4, GP5, M, 4 kinds of structural protein of N, in the immune swine, the antibody that the plasmid of expression GP5 excites has the ability of the strongest neutralization virus.But it is not high by (＜1: 8) that above-mentioned research all finds to express the proteic dna vaccination inductive of GP5 neutralizing antibody.Recently, (Ostrowski M such as Ostrouski, Galeota JA, Jar AM, et al.Identification of neutralizing and nonneutralizing epitopes in theporcine reproductive and respiratory syndrome virus GP5ectodomain.J Virol, 2002,76:4241～4250) when adopting phage display technique to determine the GP5 neutralizing epitope, find to have a non-neutralizing epitope with neutralizing epitope next-door neighbour's upstream, this epi-position has the coating effect that is similar to covering epi-position among the HIV, the also coating effect of this covering epi-position just, cause the GP5 neutralizing epitope fully to expose, thereby be difficult to excite very strong neutralizing antibody.
In addition, the GP5 albumen amino terminal extracellular foreign lands high glycosylation of highly pathogenic PRRSV infers to have 5 N-glycosylation sites (N30, N34, N35, N44 and N51).In order to study the effect of glycosylation in the reaction of PRRSV neutralizing antibody, [10] such as Israrul H.Ansari utilize PRRSV the reverse genetic system constructing mutant strain of a series of PRRSV GP5 protein glycosylations site origination point sudden change, result of study shows: glycosylated sudden change at the neutralizing epitope two ends had both improved the susceptibility of virus in neutralization test, had also strengthened near the immunogenicity of the epitope the glycosylation site.
Proteic expression level is directly related with the immune response that it causes, and the Rolling of coded amino acid codon has caused the cell of different plant species to have the inclined to one side preferendum that codon uses in the protein translation process, and mammalian cell exists notable difference with the sub-frequency of utilization of viral protein amino acid code in the protein translation process.A lot of documents have also been reported the example of genetic modification success.
Based on these three discoveries, the applicant modifies the ORF5 gene, the Nucleotide that is about to the coding helper T cell epi-position of synthetic inserts between the neutralizing epitope and covering epi-position of ORF5, the glycosylation site (N30, N34, N35 and N51) at neutralizing epitope two ends is eliminated, and the codon of ORF5 gene transform as the codon of pig body hobby, the immunogenicity and the immune response of having compared the ORF5 gene of modification and unmodified in the mode of dna vaccination.
Summary of the invention
First purpose of the present invention is the ORF5 gene of the high pathotype porcine reproductive and respiratory syndrome virus of synthetic, and it is modified, to expose in it and epi-position, bring out more effective immunne response thereby improve proteic expression amount, obtain the better ORF5 gene of a kind of immunogenicity.
Another object of the present invention is a kind of dna vaccination and application in preparation porcine reproductive and respiratory syndrome dna vaccination thereof of expressing the ORF5 gene of high-pathogenicity porcine reproductive and breath syndrome virus modification of preparation.
The present invention implements by the following technical programs:
A kind of modified highly pathogenic porcine reproductive of synthetic and breath syndrome virus ORF5 gene, its nucleotide sequence is shown in sequence table SEQ ID NO:1.
A kind of modified highly pathogenic porcine reproductive of synthetic and breath syndrome virus ORF5 gene are with the neutralizing epitope of the nucleotide sequence insertion GP5 of the coding helper T cell epi-position of synthetic and cover between epi-position, the glycosylation site (N30, N34, N35 and N51) at neutralizing epitope two ends is eliminated, and the codon of GP5 gene transform as the codon that the pig body has a liking for and obtain.
The dna vaccination of the ORF5 gene that described expression high-pathogenicity porcine reproductive and breath syndrome virus are modified is that the KpnI that the ORF5 gene that will modify inserts carrier for expression of eukaryon pcDNA3.1 forms with XhoI site structure, the intestinal bacteria Escherichia coli DH5a/pcDNA3.1-SynORF5 that contains this plasmid, be deposited in Chinese typical culture collection center (CCTCC) in the Wuhan University of Chinese Wuhan City, Hubei Province on July 25th, 2008, deposit number is CCTCC NO:M 208112.
The present invention also comprises the high-pathogenicity porcine reproductive and the application of breath syndrome virus ORF5 gene on preparation porcine reproductive and respiratory syndrome vaccine of above-mentioned modification.
Invention effect of the present invention:
The present invention and application number are that the comparative analysis of 200410009838.3 major technique feature and implementation result is as shown in table 1:
The major technique difference of table 1 the present invention and prior art
| Item compared | Major technique feature of the present invention | The technical characterictic of documents 2004100098383 applications | The present invention is with respect to the outstanding effect of contrast application |
| Gene source | The ORF5 gene of high-pathogenicity porcine reproductive and breath syndrome virus JXA1 strain | The ORF5 gene of the porcine reproductive and respiratory syndrome virus YA1 strain of common virulence | Aspect immunogenicity, because the strain of deriving of the present invention is from China highly pathogenic PRRSV of popular now, with respect to having popular preferably specificity from common PRRSV strain in the contrast application, the protection that is provided also can be higher. |
| Modified |
1, the nucleotide sequence of the coding helper T cell epi-position of synthetic is inserted the neutralizing epitope of ORF5 and cover between the epi-position; 2, the glycosylation site (N30, N34, N35 and N51) at neutralizing epitope two ends is eliminated; 3, the codon of ORF5 gene is transform as the codon of pig body hobby. | The nucleotide sequence of the coding helper T cell epi-position of synthetic is inserted the neutralizing epitope of ORF5 and cover between the epi-position. | The present invention has more the method for two kinds of modifications with respect to the contrast application: eliminate " sugared bridging effect " that Protein Glycosylation Overview brings; The codon of ORF5 gene is transform as the codon of pig body hobby. |
More detailed technical scheme such as following step are as described in " specific embodiments ".
Description of drawings
Sequence table SEQ ID NO:1 is the sequence of the ORF5 gene after the present invention modifies
Fig. 1: the structure iron that has shown the ORF5 gene DNA vaccine pcDNA A3.1-ORF5 of ORF5 gene DNA vaccine pcDNA A3.1-SynORF5 that highly pathogenic PRRSV modifies and unmodified
Fig. 2: the enzyme that has shown the ORF5 gene DNA vaccine pcDNA A3.1-ORF5 of unmodified is cut qualification result
Fig. 3: the enzyme that has shown the ORF5 gene DNA vaccine pcDNA A3.1-SynORF5 that modifies is cut qualification result
Fig. 4: shown the ELISA antibody horizontal behind highly pathogenic PRRSV ORF5 gene DNA vaccine pcDNA A3.1-ORF5 and the pcDNA3.1-SynORF5 immunity Balb/c mouse
Fig. 5: shown the neutralizing antibody level behind highly pathogenic PRRSV ORF5 gene DNA vaccine pcDNA A3.1-ORF5 and the pcDNA3.1-SynORF5 immunity Balb/c mouse, Fig. 5 A shows the neutralizing antibody level that produces at highly pathogenic PRRSV (JXA1), and Fig. 5 B shows the neutralizing antibody level that produces at classical strains (CH-1a)
Fig. 6: shown inductive cellular immune level (splenic lymphocyte stimulation index) behind highly pathogenic PRRSV ORF5 gene DNA vaccine pcDNA A3.1-ORF5 and the pcDNA3.1-SynORF5 immunity Balb/c mouse.
Fig. 7: after having shown highly pathogenic PRRSV ORF5 gene DNA vaccine pcDNA A3.1-ORF5 and pcDNA3.1-SynORF5 immunity Balb/c mouse, detect mouse spleen lymphocyte is stimulated the back secretion of gamma-IFN by specific antigen level with the ELISA method
Fig. 8: after having shown highly pathogenic PRRSV ORF5 gene DNA vaccine pcDNA A3.1-ORF5 and pcDNA3.1-SynORF5 immunity Balb/c mouse, detect mRNA that mouse spleen lymphocyte stimulated back IFN-γ by specific antigen level relatively with fluorescent quantitative RT-PCR method.
Embodiment
The present invention is further illustrated below in conjunction with Figure of description, but be not restriction protection scope of the present invention.
One, the structure of the dna vaccination of the ORF5 gene of the modification of PRRSV ORF5 gene and expression modification
1, the synthetic of the ORF5 gene of Xiu Shiing
The highly pathogenic pig breeding of this modification (is called for short PRRSV with syndrome virus, down with) the ORF5 gene is that nucleotide sequence with the coding helper T cell epi-position of synthetic inserts the neutralizing epitope of ORF5 and covers between epi-position, the glycosylation site (N30, N34, N35 and N51) at neutralizing epitope two ends is eliminated, and the codon of ORF5 gene transform as the codon that the pig body has a liking for and obtain.The KpnI restriction enzyme site is introduced in the upstream of this gene, and the XhoI restriction enzyme site is introduced in the downstream, and improved gene order total length is 663bp, is assisted synthetic by precious biotechnology (Dalian) company limited.Sequence after synthetic is as follows:
GCCGGTACCACCATGCTGGGCAAGTGCCTGACCGCCTGCTGTTGCTCCCGCTTGCTGTTCCTGTGGTG
TATCGTGCCCTTCTATCTGGCCGTGCTGGTGGCCGCCTCCGCCAAGTTCGTGGCTGCCTGGACCCTGA
AGGCTGCCGCTAACGCCGCCTCGTCCCACATCCAGCTGATCTACAACCTGACCCTGTGTGAGCTGGC
CGGCACCGACTGGCTGGCCCAGAAGTTCGACTGGGCCGTGGAGACCTTCGTGATCTTCCCCGTGCTG
ACCCACATCGTGTCCTACGGCGCCCTGACCACCTCCCACTTCCTGGACACCGTGGGCCTGGCCACCG
TGTCCACCGCCGGCTACTACCACGGCCGCTACGTACTGTCCTCCATCTACGCCGTGTGCGCCCTGGC
CGCCCTGATCTGCTTCGTGATCCGCCTTGCCAAGAACTGCATGTCCTGGCGCTACAGCTGTACACGC
TACACCAACTTCCTGCTGGACACCAAGGGCCGCCTGTACCGCTGGCGCAGCCCCGTGATCGTGGAGA
AGGGCGGCAAGGTGGAGGTGGAGGGCCACCTGATCGACCTGAAGCGCGTGGTGCTGGACGGCTCCG
CCGCCACCCCCCTGACCCGCGTGTCCGCCGAGCTGTGGGGCCGCCTGTAGCTCGAGTGC
It is SynORF5 that the applicant will modify good unnamed gene.
2, express the structure of the dna vaccination plasmid of the ORF5 gene of modifying
After above-mentioned synthetic gene product SynORF5 cut with the KpnI+XhoI enzyme, the enzyme of purifying recovery is cut product to be connected with the pcDNA3.1 eukaryon expression plasmid of cutting with the KpnI+XhoI enzyme, obtain to express the eukaryon expression plasmid pcDNA3.1-SynORF5 that modifies the ORF5 gene of transforming, confirm to make up correct through KpnI, XhoI single endonuclease digestion and the evaluation of KpnI+XhoI double digestion.The reorganization of plasmid, preparation, restriction analysis all carry out (referring to J. Sa nurse Brooker, EF is the Ritchie not, T Manny A Disi work, Huang Peitang, Wang Jiaxi etc. translate, molecular cloning experiment guide (third edition), Science Press, 2002 editions) according to a conventional method.
Two, be used for the primer PORF5F and the PORF5R of a pair of highly pathogenic PRRSV ORF5 complete coding region that increases of structure design of dna vaccination expression plasmid pcDNA3.1-ORF5 of ORF5 gene of the expression unmodified of simultaneous test, upstream and downstream primer two ends have been designed KpnI and XhoI site respectively.Primer sequence is as follows:
PORF5F：5’-GCC
GGTACCACCATGTFGGGGAAGTGCTTGAC-3’
PORF5R：5’-GCA?
CTC?GAG?CTA?GAG?ACG?ACC?CCATAG?TTC-3’
Extract highly pathogenic PRRSV JXA1 strain ((Tian etc., 2007, Emergence of Fatal PRRSV Variants:UnparalleledOutbreaks of Atypical PRRS in China and Molecular Dissection of the Unique Hallmark)) total RNA is a template, carry out RT-PCR amplification (referring to: (referring to J. Sa nurse Brooker, EF is the Ritchie not, T Manny A Disi work, Huang Peitang, Wang Jiaxi etc. translate, molecular cloning experiment guide (third edition), Science Press, 2002 editions)), the clip size of amplification is 624bp.The RT-PCR reaction conditions is: 50 ℃ of 30min, 94 ℃ of 5min; Enter the PCR circulation, 94 ℃ of 1min, 57 ℃ of 1min, 72 ℃ of 1min, after 35 circulations, 72 ℃ are extended 10min.After reaction finishes, detect amplification with 1.0% agarose gel electrophoresis.Purifying reclaims the purpose fragment, the amplified production of purifying is behind KpnI and XhoI double digestion, directly be cloned into KpnI and the XhoI site of carrier for expression of eukaryon pcDNA3.1, the recombinant plasmid pcDNA3.1-ORF5 that obtains identifies through KpnI, XhoI single endonuclease digestion and KpnI and XhoI double digestion and PCR and confirms to make up correct that the no base of order-checking confirmation mismatches.The reorganization of plasmid, preparation, restriction analysis all carry out (J. Sa nurse Brooker, EF is the Ritchie not, T Manny A Disi work, Huang Peitang, Wang Jiaxi etc. translate, molecular cloning experiment guide (third edition), Science Press, 2002 years) according to a conventional method.
Three, a large amount of preparations of plasmid pcDNA3.1-ORF5, pcDNA3.1-SynORF5
(1) the picking colony inoculation that contains plasmid contains the LB nutrient solution that final concentration is 60 μ g/mL penbritins in 75mL, 37 ℃ of 300r/min overnight incubation, 6000r/min 5min, the collecting cell precipitation, with 3mL solution I (50mmol/L glucose, 10mmol/LEDTA, 25mmol/LTris-Cl (pH8.0), the rearmounted 4 ℃ of preservations of autoclaving are standby) (dispelling or vortex) suspends.
(2) add 6mL solution II (0.2mol/LNaOH, 1%SDS, now with the current), ice bath 7-10min.
(3) add 4.5mL solution III (3mol/L potassium acetate, Glacial acetic acid adjust pH to 4.8), ice bath 7-10min.4℃10000r/min?10-15min。
(4) get supernatant, add the Virahol of 0.6 times of volume, mixing ,-20 ℃ of 30min or room temperature 5min.Room temperature, 10000r/min 6-15min.
(5) abandon supernatant, with 75% ethanol rinsing once, vacuum is drained or seasoning, adds 1.5mLTE (10.0mmol/LTris-HCl, 1.0mmol/LEDTA) suspension (washing about wall 20min).
(6) add the 5mol/LNH that 1.5ml is the precooling of 1 times of volume ice
4Ac, mixing.4℃10000r/min?10min。
(7) supernatant is transferred to the centrifuge tube of 7mL, adds the Virahol mixing of 1 times of volume (3mL) ,-20 ℃ of effect 30min.12000r/min15min。
(8) abandon supernatant, with 75% ethanol rinsing once, vacuum is drained or seasoning, adds 500 μ LTE and suspends (washing about wall 20min), and be transferred to the centrifuge tube of 1.5mL.
(9) add an amount of RNase, 37 ℃ of 1h remove RNA.
(10) add 13% PEG8000 (containing 1.6mol/LNaCl) of 1 times of volume, mixing ,-20 ℃ of 30min (can spend the night).Centrifugal, abandon supernatant, heavy molten with 400 μ LTE.
(11) add equal-volume phenol: chloroform: primary isoamyl alcohol extracting 2 times, chloroform: primary isoamyl alcohol extracting 1 time.
(12) add 100 μ l 10mol/L NH
4Ac fully behind the mixing, adds the dehydrated alcohol of 2 times of volumes ,-20 ℃ of precipitation 30min.4 ℃ of centrifugal 5-10min of 12000r/min.
(13) abandon supernatant, with 75% ethanol rinsing once, vacuum is drained or seasoning, adds 50 μ LTE or H
2O is heavy molten, put-20 ℃ standby.
Four, the production technique of dna vaccination
The main flow process of production of vaccine technology: a large amount of extractions of the conversion of plasmid, plasmid, the mensuration and the dilution of plasmid concentration.
1, the conversion of plasmid
With dna vaccination expression plasmid pcDNA3.1-ORF5 and pcDNA3.1-SynORF5 (ammonia benzyl resistance) difference transformed into escherichia coli DH5d competent cell.Concrete operations are: 1) get 100 μ l competent cell suspensions and transfer in the aseptic 1.5ml EP pipe, add 10 μ l and connect product, rotate gently with the mixed content thing, place 30min on ice.2) centrifuge tube was put in the circulator bath that is warmed to 42 ℃ in advance thermal shocking 90 seconds.3) fast centrifuge tube is transferred in the ice bath, made cell cooling 1～2min.4) every pipe adds 400 μ l LB substratum.With water-bath substratum is heated to 37 ℃, centrifuge tube is transferred on 37 ℃ of shaking tables then, incubation 45min makes bacteria resuscitation.For reaching effective conversion, rotating speed should not be above 225 rev/mins during recovery.5) get competent cell that 100 μ l transform and transfer to and contain on the LB agar plate that final concentration is 60 μ g/mL penbritins, cell transformed is uniformly applied to agar plate surface with an aseptic elbow glass rod.6) plate is put 37 ℃ of cultivations, be absorbed until liquid, be inverted plate then and cultivate, bacterium colony can appear in 12-16h.
2, a large amount of extractions of plasmid are with the method (preparation process is with above-mentioned " three ") of " three, a large amount of preparations of the plasmid pcDNA3.1-SynORF5 " of this specification sheets.
3, the mensuration of plasmid concentration, dilution
Utilize the concentration of the plasmid of a large amount of preparations of spectrophotometric determination, with phosphate buffered saline buffer (8.0g NaCl, 0.2g KCl, 2.9gNa
2HPO
412H
2O, 0.2g KH
2PO
4Add ddH
2O to 1000mL) (PBS pH7.4) is diluted to 1 μ g/ μ l with it, promptly can be used for the animal injection.
Five, the immune efficacy of vaccine check
Vaccine is to the immuning effect test of Balb/c small white mouse
With dna vaccination pcDNA3.1-SynORF5 and pcDNA3.1-ORF5 respectively through the back leg intramuscular injection Balb/c mouse in 6 ages in week, 6 every group, every mouse 100 μ l (containing 100 μ g plasmids), immunity is 2 times altogether, at interval 3 weeks; Use the negative control of blank plasmid vector pcDNA3.1 simultaneously as nucleic acid immunization.3,6 weeks took a blood sample through tail vein negative pressure after first immunisation, separation of serum, detect ELISA antibody and neutralizing antibody, the dna vaccination pcDNA3.1-SynORF5 inductive ELISA antibody of the ORF5 gene that results expression is modified and neutralizing antibody are all apparently higher than the dna vaccination pcDNA3.1-ORF5 (seeing embodiment 2 for details) of the ORF5 gene of expressing unmodified.
Embodiment 1: the plasmid and the preparation that contains the plasmid of crt gene that contain the gene of the present invention's modification
1, the structure of the eukaryon expression plasmid pcDNA3.1-ORF5 of the ORF5 gene (contrast) of expression unmodified
Extract highly pathogenic PRRSV JXA1 (Tian etc., 2007, Emergence of Fatal PRRSV Variants:Unparalleled Outbreaksof Atypical PRRS in China and Molecular Dissection of the Unique Hallmark) total RNA is a template, and PORF5F and PORF5R are primer RT-PCR amplification ORF5 gene.The amplified production of purifying is after KpnI and XhoI enzyme are cut, directly be cloned into KpnI and the XhoI restriction enzyme site of carrier for expression of eukaryon pcDNA3.1, the recombinant plasmid pcDNA3.1-ORF5 that obtains, its structure is seen accompanying drawing 1, and enzyme is cut with the PCR qualification result and seen accompanying drawing 2 (KpnI, XhoI single endonuclease digestion all have only band, KpnI and the XhoI double digestion of a treaty 6000bp to produce the band of a treaty 600bp and a treaty 5400bp).
2, express the structure of the eukaryon expression plasmid pcDNA3.1-SynORF5 of the ORF5 gene of modifying
The SynORF5 gene of synthetic is cut with KpnI and XhoI enzyme, after reclaiming purifying, simultaneously be connected with the carrier for expression of eukaryon pcDNA3.1 that the XhoI enzyme is cut with KpnI, obtain to express the eukaryon expression plasmid pcDNA3.1-SynORF5 of the ORF5 gene after modifying, structure is seen accompanying drawing 1, and enzyme is cut qualification result and seen accompanying drawing 3 (KpnI, XhoI single endonuclease digestion all have only band, KpnI and the XhoI double digestion of a treaty 6000bp to produce the band of a treaty 660bp and a treaty 5400bp).
Embodiment 2: the biological experiment that dna vaccination of the present invention and control vaccine are renderd a service mouse immune
1, the immune programme for children of Balb/c mouse
The Balb/c mouse is divided into 3 groups, 6 every group, adopt the back leg intramuscular injection, every mouse 100 μ l (containing 100 μ g plasmids), immunity is 2 times altogether, at interval 3 weeks, uses the negative control of blank plasmid vector pcDNA3.1 as nucleic acid immunization simultaneously.Exempt from 3,6 weeks of back through the blood sampling of tail vein negative pressure at head, separation of serum detects ELISA antibody and neutralizing antibody.Exempt from 6 weeks of back in head, put to death all immune mouses by cervical vertebra, aseptic taking-up spleen, utilize lymphocyte separation medium (available from Tianjin TBD company) to separate splenic lymphocyte, carry out cellular immunization and (comprise that the stimulate proliferation mRNA of exponential sum IFN-γ of splenic lymphocyte transcribes, secretion level) detects (Comparison of immune responses and protectiveefficacy of suicidal DNA vaccine and conventional DNA vaccine encoding glycoprotein C of pseudorabies virusin mice.Vaccine.2004 such as Xiao, 22,345-351).
2, ELISA antibody horizontal
Adopt the GP5 albumen of escherichia coli expression and purifying to make antigen, detect the ELISA antibody horizontal in the serum, the result shows that modified improved dna vaccination pcDNA3.1-SynORF5 immune group inductive ELISA antibody horizontal will be apparently higher than not modified dna vaccination pcDNA3.1-ORF5 immune group (P＜0.05, t-test), show that the ORF5 after the modification has better immunogenicity, result such as accompanying drawing 4.
3, neutralizing antibody level
Adopt (Yoon IJ such as Yoon, Joo HS, Goyal SM.A modified serum neutralization test for the detection of antibodyto porcine reproductive and respiratory syndrome virus in swine sera.J Vet Diagn Invest, 1994,6:289-292) the neutralizing antibody detection method of Bao Dao improvement detects the neutralizing antibody level in the serum.The neutralization test of carrying out with highly pathogenic PRRSV strain and classical PRRSV strain, the result is consistent with ELISA antibody result, the neutralizing antibody level of not modified dna vaccination pcDNA3.1-ORF5 immune group is not high, and rise comparatively slowly, and modify the neutralizing antibody fast rise of improved dna vaccination pcDNA3.1-SynORF5 immune group, the neutralizing antibody of indivedual immune mouses has reached 1: 32 in the 6th week, compare extremely significantly (P＜0.01 of difference with the pcDNA3.1-ORF5 immune group, t-test), test-results such as accompanying drawing 5.
4, the splenic lymphocyte index that stimulates proliferation detects
Adopt mtt assay measure the stimulation index (SI) of mouse spleen lymphocyte (chief editor such as Shen Guanxin. modern immunological experiment technology. Hubei science tech publishing house, version in 1998).The index that stimulates proliferation of the modified improved dna vaccination pcDNA3.1-SynORF5 immune group of the present invention as a result to be significantly higher than not modified dna vaccination pcDNA3.1-ORF5 immune group (P＜0.01, t-test).Test-results such as accompanying drawing 6.
5, the ELISA method detects splenic lymphocyte excretory IFN-γ level
Employing ELISA method (Long Zhenzhou, Medical Immunology (the 2nd edition). Beijing: People's Health Publisher, version in 2000) detect mouse spleen lymphocyte by the ability of specific antigen stimulation back secretion of gamma-IFN.The modified improved dna vaccination pcDNA3.1-SynORF5 immune group secretion of the present invention as a result IFN-γ level to be significantly higher than not modified dna vaccination pcDNA3.1-ORF5 immune group (P＜0.01, t-test).Test-results such as accompanying drawing 7.
6, fluorescence relative quantification RT-PCR method detects lymphocyte is stimulated back IFN-γ by specific antigen mRNA level
Employing fluorescence relative quantification RT-PCR method (referring to: Zhang Jingbo etc. the Cell Biology Experiment technology. Chemical Industry Press, version in 2006) detect mouse spleen lymphocyte by the mRNA level of specific antigen stimulation back IFN-γ.Mouse spleen lymphocyte extracts total RNA external after specific antigen (PRRSV of uviolizing deactivation) stimulates, utilize oligo dT that the mRNA in-vitro transcription is become cDNA.Utilize primer β-actins:5 '-CACTGCCGCATCCTCTTCCTCCC-3 ', β-actinr:5 '-CAATAGTGATGACCTGGCCGT-3 ' amplification mouse house-keeping gene β-actin, and with its confidential reference items as relative quantification RT-PCR; Primer I FN-γ s:5 '-TCAAGTGGCATAGATGTGGAAGAA-3 ', IFN-γ r:5 '-TGGCTCTGCAGGATTTTCATG-3 ', amplification mouse IFN-γ gene.Quantitative fluorescent PCR reaction system (25 μ l) comprising: each 0.5 μ l (10 μ M) of IFN-γ and β-actin upstream and downstream primer,
Green Realtime PCR Master Mix (comprising reaction buffer, dNTP, Mgcl2, SYBRGreen I, Taq enzyme) (available from ToYoBo company, Shanghai) 12.5 μ l, distilled water 11.0 μ l, cDNA sample 0.5 μ l.Each sample is done three repetitions.The reaction amplification condition is: 50 ℃ of 2min, 94 ℃ of pre-sex change 10mi enter PCR circulation: 94 ℃ of sex change 15s and 60 ℃ of annealing with extend 1min, totally 40 circulations.The variation of the fluorescent signal in the entire reaction course is detected by ABIPrism 7500 real-time fluorescence quantitative PCR instrument (available from U.S. Applied Biosystems company).The mRNA level of the modified improved dna vaccination pcDNA3.1-SynORF5 immune group IFN-γ of the present invention as a result will apparently higher than not modified dna vaccination pcDNA3.1-ORF5 immune group (P＜0.01, t-test).Test-results such as accompanying drawing 8.
Appendix
Term definition:
The English name Chinese
The blank plasmid vector of pcDNA3.1
PcDNA3.1-ORF5 expresses the dna vaccination of the ORF5 gene of unmodified
PcDNA3.1-SynORF5 expresses the dna vaccination of the ORF5 gene of modification type
Sequence table
＜110〉Hua Zhong Agriculture University
＜120〉modified highly pathogenic porcine reproductive of synthetic and breath syndrome virus ORF5 gene and application
<130>
<141>2008-08-04
<160>2
<170>PatentIn?version?3.1
<210>1
<211>663
<212>DNA
＜213〉pig (Sus scrofa)
<220>
<221>gene
<222>(1)..(663)
<223>
<220>
<221>CDS
<222>(10)..(657)
<223>
<400>1
gccggtacc?acc?atg?ctg?ggc?aag?tgc?ctg?acc?gcc?tgc?tgt?tgc?tcc?cgc 51
Thr?Met?Leu?Gly?Lys?Cys?Leu?Thr?Ala?Cys?Cys?Cys?Ser?Arg
1 5 10
ttg?ctg?ttc?ctg?tgg?tgt?atc?gtg?ccc?ttc?tat?ctg?gcc?gtg?ctg?gtg 99
Leu?Leu?Phe?Leu?Trp?Cys?Ile?Val?Pro?Phe?Tyr?Leu?Ala?Val?Leu?Val
15 20 25 30
gcc?gcc?tcc?gcc?aag?ttc?gtg?gct?gcc?tgg?acc?ctg?aag?gct?gcc?gct 147
Ala?Ala?Ser?Ala?Lys?Phe?Val?Ala?Ala?Trp?Thr?Leu?Lys?Ala?Ala?Ala
35 40 45
aac?gcc?gcc?tcg?tcc?cac?atc?cag?ctg?atc?tac?aac?ctg?acc?ctg?tgt 195
Asn?Ala?Ala?Ser?Ser?His?Ile?Gln?Leu?Ile?Tyr?Asn?Leu?Thr?Leu?Cys
50 55 60
gag?ctg?gcc?ggc?acc?gac?tgg?ctg?gcc?cag?aag?ttc?gac?tgg?gcc?gtg 243
Glu?Leu?Ala?Gly?Thr?Asp?Trp?Leu?Ala?Gln?Lys?Phe?Asp?Trp?Ala?Val
65 70 75
gag?acc?ttc?gtg?atc?ttc?ccc?gtg?ctg?acc?cac?atc?gtg?tcc?tac?ggc 291
Glu?Thr?Phe?Val?Ile?Phe?Pro?Val?Leu?Thr?His?Ile?Val?Ser?Tyr?Gly
80 85 90
gcc?ctg?acc?acc?tcc?cac?ttc?ctg?gac?acc?gtg?ggc?ctg?gcc?acc?gtg 339
Ala?Leu?Thr?Thr?Ser?His?Phe?Leu?Asp?Thr?Val?Gly?Leu?Ala?Thr?Val
95 100 105 110
tcc?acc?gcc?ggc?tac?tac?cac?ggc?cgc?tac?gta?ctg?tcc?tcc?atc?tac 387
Ser?Thr?Ala?Gly?Tyr?Tyr?His?Gly?Arg?Tyr?Val?Leu?Ser?Ser?Ile?Tyr
115 120 125
gcc?gtg?tgc?gcc?ctg?gcc?gcc?ctg?atc?tgc?ttc?gtg?atc?cgc?ctt?gcc 435
Ala?Val?Cys?Ala?Leu?Ala?Ala?Leu?Ile?Cys?Phe?Val?Ile?Arg?Leu?Ala
130 135 140
aag?aac?tgc?atg?tcc?tgg?cgc?tac?agc?tgt?aca?cgc?tac?acc?aac?ttc 483
Lys?Asn?Cys?Met?Ser?Trp?Arg?Tyr?Ser?Cys?Thr?Arg?Tyr?Thr?Asn?Phe
145 150 155
ctg?ctg?gac?acc?aag?ggc?cgc?ctg?tac?cgc?tgg?cgc?agc?ccc?gtg?atc 531
Leu?Leu?Asp?Thr?Lys?Gly?Arg?Leu?Tyr?Arg?Trp?Arg?Ser?Pro?Val?Ile
160 165 170
gtg?gag?aag?ggc?ggc?aag?gtg?gag?gtg?gag?ggc?cac?ctg?atc?gac?ctg 579
Val?Glu?Lys?Gly?Gly?Lys?Val?Glu?Val?Glu?Gly?His?Leu?Ile?Asp?Leu
175 180 185 190
aag?cgc?gtg?gtg?ctg?gac?ggc?tcc?gcc?gcc?acc?ccc?ctg?acc?cgc?gtg 627
Lys?Arg?Val?Val?Leu?Asp?Gly?Ser?Ala?Ala?Thr?Pro?Leu?Thr?Arg?Val
195 200 205
tcc?gcc?gag?ctg?tgg?ggc?cgc?ctg?tag?ctc?gagtgc 663
Ser?Ala?Glu?Leu?Trp?Gly?Arg?Leu?Leu
210 215
<210>2
<211>214
<212>PRT
＜213〉pig (Sus scrofa)
<400>2
Thr?Met?Leu?Gly?Lys?Cys?Leu?Thr?Ala?Cys?Cys?Cys?Ser?Arg?Leu?Leu
1 5 10 15
Phe?Leu?Trp?Cys?Ile?Val?Pro?Phe?Tyr?Leu?Ala?Val?Leu?Val?Ala?Ala
20 25 30
Ser?Ala?Lys?Phe?Val?Ala?Ala?Trp?Thr?Leu?Lys?Ala?Ala?Ala?Asn?Ala
35 40 45
Ala?Ser?Ser?His?Ile?Gln?Leu?Ile?Tyr?Asn?Leu?Thr?Leu?Cys?Glu?Leu
50 55 60
Ala?Gly?Thr?Asp?Trp?Leu?Ala?Gln?Lys?Phe?Asp?Trp?Ala?Val?Glu?Thr
65 70 75 80
Phe?Val?Ile?Phe?Pro?Val?Leu?Thr?His?Ile?Val?Ser?Tyr?Gly?Ala?Leu
85 90 95
Thr?Thr?Ser?His?Phe?Leu?Asp?Thr?Val?Gly?Leu?Ala?Thr?Val?Ser?Thr
100 105 110
Ala?Gly?Tyr?Tyr?His?Gly?Arg?Tyr?Val?Leu?Ser?Ser?Ile?Tyr?Ala?Val
115 120 125
Cys?Ala?Leu?Ala?Ala?Leu?Ile?Cys?Phe?Val?Ile?Arg?Leu?Ala?Lys?Asn
130 135 140
Cys?Met?Ser?Trp?Arg?Tyr?Ser?Cys?Thr?Arg?Tyr?Thr?Asn?Phe?Leu?Leu
145 150 155 160
Asp?Thr?Lys?Gly?Arg?Leu?Tyr?Arg?Trp?Arg?Ser?Pro?Val?Ile?Val?Glu
165 170 175
Lys?Gly?Gly?Lys?Val?Glu?Val?Glu?Gly?His?Leu?Ile?Asp?Leu?Lys?Arg
180 185 190
Val?Val?Leu?Asp?Gly?Ser?Ala?Ala?Thr?Pro?Leu?Thr?Arg?Val?Ser?Ala
195 200 205
Glu?Leu?Trp?Gly?Arg?Leu
210
Claims (4)
1. the modified highly pathogenic porcine reproductive of a synthetic and breath syndrome virus ORF5 gene, its nucleotide sequence is shown in sequence table SEQ ID NO:1.
2. comprise the modified highly pathogenic porcine reproductive of synthetic and intestinal bacteria (Escherichia coli) DH5 α/pcDNA3.1-SynORF5 of breath syndrome virus ORF5 gene plasmid, be deposited in Chinese typical culture collection center (CCTCC), deposit number is CCTCC NO:M 208112.
3. dna vaccination of expressing artificial synthetic modified highly pathogenic porcine reproductive and breath syndrome virus ORF5 gene, it is after being cut with the KpnI+XhoI enzyme by the gene SynORF5 shown in the SEQ ID NO:1, purifying reclaims enzyme and cuts product, be connected with the eukaryon expression plasmid pcDNA3.1 that cuts with the KpnI+XhoI enzyme, obtain to express the eukaryon expression plasmid pcDNA3.1-SynORF5 of the ORF5 gene of modifying, this eukaryon expression plasmid is described dna vaccination.
4. the modified highly pathogenic porcine reproductive of the described synthetic of claim 1 and the breath syndrome virus ORF5 gene application in preparation porcine reproductive and respiratory syndrome dna vaccination.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008100487680A CN101392261B (en) | 2008-08-12 | 2008-08-12 | Modified highly pathogenic porcine reproductive and respiratory syndrome virus ORF5 gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008100487680A CN101392261B (en) | 2008-08-12 | 2008-08-12 | Modified highly pathogenic porcine reproductive and respiratory syndrome virus ORF5 gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101392261A CN101392261A (en) | 2009-03-25 |
| CN101392261B true CN101392261B (en) | 2011-03-23 |
Family
ID=40492772
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2008100487680A Expired - Fee Related CN101392261B (en) | 2008-08-12 | 2008-08-12 | Modified highly pathogenic porcine reproductive and respiratory syndrome virus ORF5 gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101392261B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102559611B (en) * | 2011-06-23 | 2015-04-22 | 江苏省农业科学院 | Double-expression recombinant modified vaccinia virus Ankara (MVA) without selection marker and construction method for virus |
| CN102321638B (en) * | 2011-09-06 | 2013-04-10 | 南京农业大学 | New porcine reproductive and respiratory syndrome virus ORF5 modified gene and application thereof |
| CN106039302A (en) * | 2016-06-21 | 2016-10-26 | 江苏省农业科学院 | Porcine reproductive and respiratory syndrome virus nucleic acid vaccine and preparation method thereof |
| CN113234760B (en) * | 2021-06-04 | 2022-12-02 | 长沙爱科博生物科技有限公司 | Recombinant adenovirus 5 vector containing porcine reproductive and respiratory syndrome ORF5 gene and preparation method and application thereof |
-
2008
- 2008-08-12 CN CN2008100487680A patent/CN101392261B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN101392261A (en) | 2009-03-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110093324B (en) | Attenuated African swine fever virus with gene deletion and application thereof as vaccine | |
| EP2985288B1 (en) | Porcine pseudorabies virus, vaccine composition and preparation method and use thereof | |
| CN110551695A (en) | African swine fever virus four-gene deletion low virulent strain and application thereof | |
| CN106148287B (en) | Porcine epidemic diarrhea virus strain and vaccine composition, preparation method and application thereof | |
| Zhao et al. | Immersion vaccination of Mandarin fish Siniperca chuatsi against infectious spleen and kidney necrosis virus with a SWCNTs-based subunit vaccine | |
| US20230285535A1 (en) | Recombinant Pseudorabies Virus and Vaccine Composition thereof | |
| US11464852B2 (en) | Modified PEDV spike protein | |
| CN113943714B (en) | Callicarpa virus strain and application thereof | |
| CN101392261B (en) | Modified highly pathogenic porcine reproductive and respiratory syndrome virus ORF5 gene and application | |
| CN111744003A (en) | Application of chemotactic factor CX3CL1 in preparation of vaccine and helicobacter pylori vaccine | |
| CN114163505B (en) | Swine fever and porcine pseudorabies virus bigeminal subunit vaccine and preparation method thereof | |
| CN108251382B (en) | Porcine pseudorabies virus weakening method, porcine pseudorabies virus weakening virus strain, porcine pseudorabies virus vaccine composition and application of porcine pseudorabies virus weakening virus strain | |
| CN114015660B (en) | Construction of ten-gene deleted attenuated African swine fever virus strain and application thereof as vaccine | |
| WO2020215301A1 (en) | Attenuated african swine fever virus with deleted gene and use of same as vaccine | |
| CN101092631B (en) | Modified ORF2 gene of toroidal virus of pig, and application | |
| KR20130058706A (en) | Parapoxvirus expressing the vp60 major capsid protein of the rabbit haemorrhagic disease virus | |
| CN107041951B (en) | Recombinant trivalent inactivated vaccine for foot-and-mouth disease and preparation method and application thereof | |
| CN101422608A (en) | Preparation method of PRRSV ORF5 gene nucleic acid vaccine containing CpG sequence | |
| CN105907776B (en) | The subunit vaccine of the immune response for pig blue-ear disease poison can be induced | |
| CN109337874B (en) | Recombinant porcine pseudorabies virus, application thereof and recombinant porcine pseudorabies live vaccine | |
| CN109517044B (en) | Porcine epidemic diarrhea virus genetic engineering antigen and antibody | |
| CN100357439C (en) | Modified pig propagation and respiratory syndrome virus ORF5 gene and use thereof | |
| CN109735477B (en) | Preparation and application of three-gene deletion attenuated mutant strain of Listeria monocytogenes | |
| CN114146172B (en) | Nano antibody vaccine capable of preventing porcine pseudorabies virus infection, preparation method and application | |
| CN112778423B (en) | Porcine reproductive and respiratory syndrome subunit vaccine composition and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110323 Termination date: 20110812 |