CN106039302A - Porcine reproductive and respiratory syndrome virus nucleic acid vaccine and preparation method thereof - Google Patents

Porcine reproductive and respiratory syndrome virus nucleic acid vaccine and preparation method thereof Download PDF

Info

Publication number
CN106039302A
CN106039302A CN201610450557.4A CN201610450557A CN106039302A CN 106039302 A CN106039302 A CN 106039302A CN 201610450557 A CN201610450557 A CN 201610450557A CN 106039302 A CN106039302 A CN 106039302A
Authority
CN
China
Prior art keywords
nucleic acid
bpei
acid vaccine
plga
respiratory syndrome
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201610450557.4A
Other languages
Chinese (zh)
Inventor
李彬
杜露平
何孔旺
俞正玉
逄凤娇
徐向伟
范宝超
温立斌
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangsu Academy of Agricultural Sciences
Original Assignee
Jiangsu Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangsu Academy of Agricultural Sciences filed Critical Jiangsu Academy of Agricultural Sciences
Priority to CN201610450557.4A priority Critical patent/CN106039302A/en
Publication of CN106039302A publication Critical patent/CN106039302A/en
Pending legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53—DNA (RNA) vaccination
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/10011—Arteriviridae
    • C12N2770/10034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Virology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

The invention provides a porcine reproductive and respiratory syndrome virus (PRRSV) nucleic acid vaccine and a preparation method thereof and relates to the technical field of biology. The porcine reproductive and respiratory syndrome virus nucleic acid vaccine contains a BPEI/PLGA nanoparticle adjuvant and recombinant plasmids carrying PRRSV ORF5 genes; the recombinant plasmids carrying the PRRSV ORF5 genes are adsorbed on the surface of the BPEI/PLGA nanoparticle adjuvant. The invention also provides the preparation method of the porcine reproductive and respiratory syndrome virus nucleic acid vaccine. The preparation method comprises the following steps of uniformly mixing the BPEI/PLGA nanoparticle adjuvant with the recombinant plasmids carrying the PRRSV ORF5 genes, and standing to obtain the porcine reproductive and respiratory syndrome virus nucleic acid vaccine. The porcine reproductive and respiratory syndrome virus nucleic acid vaccine provided by the invention is better in immune effect; the preparation method is simple and efficient.

Description

Porcine reproductive and respiratory syndrome virus nucleic acid vaccine and preparation method thereof
Technical field
The present invention relates to biological technical field, be specifically related to porcine reproductive and respiratory syndrome virus nucleic acid vaccine and preparation thereof Method.
Background technology
Porcine reproductive and respiratory syndrome virus (PRRSV) is the pathogen of Porcine reproductive and respiratory syndrome, mainly causes bosom Pregnant Sow abortion, premature labor, stillborn fetus, mummy tire increase, and piglet occurs that respiratory symptom and Preweaning death rate increase.This disease in Within 1987, find in the U.S. at first, and spread rapidly in the whole America, subsequently in short several years, extend over the entire globe rapidly each pig industry Flourishing countries and regions.Within 1996, Harbin veterinary institute is separated to PRRSV first, it was demonstrated that primary disease is deposited at home , and present epidemic status.At present, PRRSV each pig-raising countries the most all over the world, causes great economy to world's pig industry Loss.Degree of variation according to PRRSV gene is broadly divided into two genotype, i.e. Europe class (representative strains is Lelystadvios, LV) and american type (representative strains is VR-2332 strain), the domestic most of strain being separated to belongs to american type, but also has Europe The existence of continent type strain.Additionally, due to PRRSV easily occurs RNA restructuring and there is antigenic variation, therefore, pre-to PRRSV Anti-and control proposes serious challenge.
In recent years, along with development and the application of technique for gene engineering, grinding of the new generation vaccine such as nucleic acid vaccine, synthetic peptide vaccine System is increasingly becoming a big study hotspot of medical domain, but, the immune effect stability aspect still Shortcomings of nucleic acid vaccine, Even if using larger dose repeatedly immunity also cannot obtain ideal specific immune response.For these problems, domestic Outer scholar is made that substantial amounts of effort, and as by improving vaccine submission, genes of interest screening is modified, add immune molecule sequence with Express immune molecule in vitro and improve immune effect.Therefore, a kind of safely and effectively method is found to improve exempting from of DNA vaccination Epidemic disease effect becomes the Main way of current nucleic acid vaccine research field.
Summary of the invention
It is desirable to provide a kind of porcine reproductive and respiratory syndrome virus nucleic acid vaccine, immune effect is preferable.
It is a further object of the present invention to provide the preparation method of porcine reproductive and respiratory syndrome virus nucleic acid vaccine, the method Simply, efficiently.
The purpose of the present invention adopts the following technical scheme that realization.
A kind of porcine reproductive and respiratory syndrome virus nucleic acid vaccine, containing BPEI/PLGA nano-particle adjuvant with carry The recombiant plasmid of PRRSV ORF5 gene, described in carry the recombiant plasmid of PRRSV ORF5 gene and be adsorbed in BPEI/PLGA and receive Rice grain adjuvant surface.
Preferably in technical scheme, described BPEI/PLGA nano-particle is the polylactic acid-glycolic that branched polyethylene imine is modified Acetic acid copolymer, particle diameter is 100-600nm, described branched polyethylene imine and the quality of Poly(D,L-lactide-co-glycolide Ratio is 1:9-11.
Preferably in technical scheme, the preparation method of described BPEI/PLGA nano-particle comprises the following steps: by poly-breast Acid-co-glycolic acid is dissolved in dichloromethane, and branched polyethylene imine is dissolved in polyvinyl alcohol water solution, then both is mixed Conjunction, emulsifying, remove organic solvent, and centrifuging and taking precipitates, and lyophilization obtains BPEI/PLGA nano-particle.
Preferably in technical scheme, Poly(D,L-lactide-co-glycolide and the mass ratio 9-11:1 of branched polyethylene imine.
Preferably in technical scheme, described in carry the recombiant plasmid of PRRSV ORF5 gene be by PRRSV ORF5 gene Obtain after inserting pcDNA3.1 carrier.
Preferably in technical scheme, BPEI/PLGA nano-particle and the recombiant plasmid carrying PRRSV ORF5 gene Mass ratio is 10-12:2.
The present invention also provides for the preparation method of described porcine reproductive and respiratory syndrome virus nucleic acid vaccine, including walking as follows Rapid: BPEI/PLGA nano-particle adjuvant to be mixed homogeneously with the recombiant plasmid carrying PRRSV ORF5 gene, obtains after standing Described porcine reproductive and respiratory syndrome virus nucleic acid vaccine.
Preferably in technical scheme, carry the recombiant plasmid of PRRSV ORF5 gene and adopt and prepare with the following method: will take With the recombinant plasmid transformed host cell of PRRSV ORF5 gene, after cultivation, it is thus achieved that carry the weight of PRRSV ORF5 gene Group plasmid.
Preferably in technical scheme, described porcine reproductive and respiratory syndrome virus nucleic acid vaccine is lyophilized powder.
Beneficial effect
The present invention is by screening a large amount of adjuvants and PRRSV antigen epitope genes, it is thus achieved that with commercially available conventional attenuated live vaccines The nucleic acid vaccine that immune effect is suitable.Nano-particle adjuvant uniformity prepared by the present invention is preferable, can not only efficiently carry PRRSV ORF5 gene, reprinting are arrived intracellular, and are had immunoenhancement result.From the immune effect of mice and pig permissible Finding out, BPEI/PLGA of the present invention absorption nucleic acid vaccine can significantly improve the cell and humoral response of immune animal, tries at counteracting toxic substances In testing, immune animal is effectively protected, suitable with commercialized vaccine protected effect.
Accompanying drawing explanation
Fig. 1 is the scanning electron microscope of BPEI/PLGA nano-particle.
Fig. 2 be BPEI/PLGA absorption nucleic acid vaccine on immune mouse humoral immunization and the impact of cellular immunization, wherein PcDNA3.1, pcDNA3.1-SynORF5, PLGA-DNA, BPEI-DNA, BPEI/PLGA-DNA represent that each group of immunity is little respectively Mus.Wherein, " * " represents P < 0.05；" * * " represents P < 0.01；" * * * " represents P < 0.001.
Fig. 3 be BPEI/PLGA absorption nucleic acid vaccine on immune swine humoral immunization and the impact of cellular immunization, wherein PBS, PcDNA3.1-SynORF5, BPEI/PLGA-DNA, JXA1-R represent each group of material inoculated respectively.Wherein, " * " represent P < 0.05；" * * " represents P < 0.01；" * * * " represents P < 0.001.
Fig. 4 is the BPEI/PLGA absorption nucleic acid vaccine impact of breaking up immune swine t lymphocyte subset type, wherein PBS, PcDNA3.1-SynORF5, BPEI/PLGA-DNA, JXA1-R represent each group of material inoculated respectively.Fig. 4 A is CD3+CD4+T drenches Bar kinetics of cells trendgram, Fig. 4 B is CD3+CD8+T lymphocyte dynamic change trend figure." * " represents P < 0.05；“**” Represent P < 0.01；" * * * " represents P < 0.001.
Fig. 5 be BPEI/PLGA absorption nucleic acid vaccine on after immune swine counteracting toxic substances rectal temperature change impact, wherein PBS, PcDNA3.1-SynORF5, BPEI/PLGA-DNA, JXA1-R represent each group of material inoculated respectively.
Fig. 6 be BPEI/PLGA adsorb the nucleic acid vaccine impact on immune group counteracting toxic substances restrovirus mass formed by blood stasis, wherein PBS, PcDNA3.1-SynORF5, BPEI/PLGA-DNA, JXA1-R represent each group of material inoculated respectively.
Fig. 7 is that BPEI/PLGA absorption nucleic acid vaccine is on the impact of various pulmonary lesions, wherein A, B, C, D after immune group counteracting toxic substances The most corresponding PBS blank group, independent nucleic acid vaccine group, BPEI/PLGA absorption nucleic acid vaccine group and commercialized vaccine group.
Detailed description of the invention
Embodiment 1 prepares porcine reproductive and respiratory syndrome virus nucleic acid vaccine
From multiple adjuvant and porcine reproductive and respiratory syndrome virus antigen epitope genes compounding, screen with BPEI/ PLGA nano-particle and the carrier nucleic acid vaccine as active component carrying the ORF5 gene encoding PRRSV GP5 albumen.
1. the recombiant plasmid of PRRSV ORF5 gene is carried in preparation
The ORF5 gene (GeneBank accession number: HQ832104) of coding PRRSV GP5 albumen is inserted pcDNA3.1 carry Body, it is thus achieved that carry the recombiant plasmid of PRRSV ORF5 gene.Carry the recombiant plasmid named restructuring matter of PRRSV ORF5 gene Grain pcDNA3.1-SynORF5, construction method concrete steps list of references Immunogenicity of the highly pathogenic porcine reproductive and respiratory syndrome virus GP5protein Encoded by a synthetic ORF5gene, is published in Vaccine, and 18,27 (13): 1957-1963.
The amplification of recombiant plasmid pcDNA3.1-SynORF5 and qualification: by pcDNA3.1-SynORF5 transformed competence colibacillus large intestine Bacillus Trans5 α, expands after clone, and with (limited purchased from sky root biochemical technology (Beijing) without the big extraction reagent kit of endotoxin plasmid Company, article No.: DP117) pcDNA3.1-SynORF5 is extracted, it is thus achieved that a large amount of recombiant plasmid pcDNA3.1-SynORF5. Recombiant plasmid pcDNA3.1-SynORF5 extracts product and identifies through the Xho I and Kpn I laggard row agarose gel electrophoresis of enzyme action.
2. preparation BPEI/PLGA adsorbs nucleic acid vaccine
(1) prepare BPEI/PLGA nano-particle by the double emulsion solvent volatility process of improvement, and DNA is adsorbed in BPEI/ PLGA nano grain surface obtains BPEI/PLGA and adsorbs nucleic acid vaccine.
The preparation of BPEI/PLGA nano-particle: by PLGA (Poly(D,L-lactide-co-glycolide, the number-average molecular weight of 10mg Being 38,000-54,000, wherein the mass ratio of lactic acid and hydroxyacetic acid is 50:50, purchased from sigma-aldrich, and article No.: 71, 990-0) it is dissolved in the dichloromethane of 5mL, and 1mg BPEI (branched polyethylene imine, molecular weight: 25,000, purchased from aldrich Chemistry, article No.: 408727) be dissolved in PVA that 5mL concentration is 20g/L (polyvinyl alcohol, molecular weight is 9,000-10,000, Purchased from sigma-aldrich, article No.: 360627) in aqueous solution, above two solution is mixed, with IKA emulsification instrument 15, 000rpm emulsifying 10min.Then solution good for emulsifying is added in the PVA aqueous solution of 50mL, 5g/L, after mixing, use IKA emulsifying Instrument 15,000rpm emulsifying 2min, it is stirred overnight to remove organic solvent by solution 200rpm good for emulsifying；15,000rpm subsequently Centrifugal 30min, takes precipitation, is washed with deionized water 3 times, then vacuum lyophilization, obtains the PLGA that BPEI modifies, in nanometer Granular, it is abbreviated as BPEI/PLGA nano-particle.In BPEI/PLGA nano-particle, BPEI physical absorption is in PLGA surface.BPEI/ The scanning electron microscope (SEM) photograph of PLGA nano-particle is as shown in Figure 1, it can be seen that the particle diameter of nano-particle is 100-600 nanometer, and particle diameter is relatively For uniformly.BPEI/PLGA nano-particle is put-20 DEG C of preservations and is saved backup for a long time.
The preparation of BPEI/PLGA absorption nucleic acid vaccine: BPEI/PLGA nano-particle is dissolved in the present embodiment title 1 and prepares Recombiant plasmid pcDNA3.1-SynORF5 solution (1 μ g/ μ L) in, the mass ratio of BPEI/PLGA nano-particle and recombiant plasmid For 11:2, vortex 30s mix homogeneously, stand 30min under room temperature (18-25 DEG C), can be used for direct immunization or vacuum lyophilization, Obtain BPEI/PLGA absorption nucleic acid vaccine (being designated as BPEI/PLGA-DNA), put-20 DEG C and save backup.
(2) BPEI/PLGA adsorbs nucleic acid vaccine consumption: mice, 650 μ g/ are only；Pig, 3.25mg/ head.
3. prepare control vaccine
(1) PLGA adsorbs nucleic acid vaccine
The PLGA of 10mg is dissolved in the dichloromethane of 5mL, is subsequently added to the PVA aqueous solution of 5mL 20g/L, mixed Close, with IKA emulsification instrument 15,000rpm emulsifying 10min.Then solution good for emulsifying is added the PVA aqueous solution to 50mL, 5g/L In, mixing, with IKA emulsification instrument 15,000rpm emulsifying 2min, it is stirred overnight to remove organic molten by solution 200rpm good for emulsifying Agent；Subsequently 15,000rpm is centrifuged 30min, takes precipitation, is washed with deionized water 3 times, obtains PLGA nano-particle.By PLGA nanometer Granule is dissolved in the recombiant plasmid pcDNA3.1-SynORF5 solution (1 μ g/ μ L) of title 1 preparation, and the mass ratio of PLGA with DNA is 10:2, vortex 30s, left at room temperature 30min, obtain PLGA absorption nucleic acid vaccine (being designated as PLGA-DNA).
(2) BPEI adsorbs nucleic acid vaccine
1mg BPEI is dissolved in recombiant plasmid pcDNA3.1-SynORF5 solution (1 μ g/ μ L) prepared by title 1, BPEI It is 1:2 with the mass ratio of DNA, vortex 30s mix homogeneously, left at room temperature 30min, obtain BPEI absorption nucleic acid vaccine and (be designated as BPEI-DNA)。
Embodiment 2 nucleic acid vaccine immune effect to mice
The BPEI/PLGA absorption nucleic acid vaccine, PLGA absorption nucleic acid vaccine and the BPEI that use embodiment 1 preparation adsorb nucleic acid Vaccine carries out immunity inoculation experiment respectively.
1, mouse immune packet
35 Balb/c mices are randomly divided into 5 groups: blank group (inoculation empty plasmid pcDNA3.1), simple nucleic acid vaccine group (inoculation pcDNA3.1-SynORF5), PLGA absorption nucleic acid vaccine group (inoculation PLGA-DNA), BPEI absorption nucleic acid vaccine group (connect Plant BPEI-DNA) and BPEI/PLGA absorption nucleic acid vaccine group (inoculation BPEI/PLGA-DNA).
2, mouse immune mode: use the immunization ways retreating intramuscular injection, often organizes each dosage of inoculation as shown in table 1, Every minor tick 2 weeks, altogether immunity 2 times.
The immunity packet of table 1 mice and dosage of inoculation
Packet Vaccine Dosage of inoculation
Blank group Empty plasmid pcDNA3.1 100 μ g/ are only
Simple nucleic acid vaccine group (matched group) pcDNA3.1-SynORF5 100 μ g/ are only
PLGA absorption nucleic acid vaccine group (matched group) PLGA-DNA 600 μ g/ are only
BPEI absorption nucleic acid vaccine (matched group) BPEI-DNA 150 μ g/ are only
BPEI/PLGA absorption nucleic acid vaccine group (experimental group) BPEI/PLGA-DNA 650 μ g/ are only
3, index system
Detection head exempts from latter 14 days, 28 days and the neutralizing antibody of 42 days.Detection head exempts from latter 42 days mouse lymphocyte propagation and lives Property, IFN-γ mRNA and IFN-γ level.
(1) nucleic acid vaccine impact on immune mouse GP5 neutralizing antibody
GP5 neutralizing antibody detection method: each group mice carries out eyeball blood sampling, separates and collects serum, inactivates 30min through 56 DEG C After, on 96 porocyte plates, with the DMEM culture fluid of 13.37mg/mL, (DMEM powder is purchased from Gibco company, and culture fluid is according to saying Bright book is prepared) serum is made continuous doubling dilution, from 1:2 to 1:256, each dilution factor makees 4 repetitions, every hole 50 μ L.With DMEM culture fluid will survey TCID50PRRSV be diluted to 100TCID50, join in all culture hole added with tested serum, Every hole 50 μ L, puts 37 DEG C, 5%CO2Incubator acts on 1h.Then in every hole, drip 100 μ L Marc-145 cell suspension (2-5×105Individual/mL), after shaking up gently, put back to and incubator continues cultivate 4-6 days.It is simultaneously provided with serum toxicity control, mark Zhunyin, positive serum controls, and virus control and normal cell controls.Observe and record CPE (cytopathy) situation by sky, Until result is stable.Under comparison establishment condition, by Reed-Muench Liang Shi method, calculate the specificity of the anti-PRRSV of tested serum The titre of neutralizing antibody, can protect cell not occur the serum highly diluted multiple of pathological changes as tested blood serum sample completely Neutralization titer.
GP5 neutralizing antibody testing result: result is shown in that Fig. 2 A, head exempt from latter 14th day, and matched group and experimental group all can induce product Raw neutralizing antibody, but NAT is the highest, between two groups, difference is not notable (P > 0.05).Head exempts from the rear 28th and 42 My god, two groups of neutralizing antibody persistent levels increase, and head exempts from latter 42nd day, the NAT that BPEI/PLGA-DNA induction produces Up to 1:19.43, it is significantly higher than the NAT (1:10.67) that pcDNA3.1-SynORF5 induction produces, significant difference (P<0.05)；And the neutralizing antibody level produced is induced simultaneously above PLGA-DNA (1:13.33) or BPEI-DNA (1:16).Table Bright BPEI/PLGA can be obviously enhanced the level of nucleic acid vaccine inducing producing specificity neutralizing antibody.
(2) impact that mouse lymphocyte is bred by nucleic acid vaccine
The preparation of splenocyte suspension: after final immunization 28 days, dislocation of cervical vertebra method is put to death mice, is put in 70% ethanol and soak Bubble 3-5min whole body sterilization, takes out mice and is placed on sterilized petri dishes so that right side is sleeping, and left dorsal abdomen intersection skin of sterilizing is aseptic Take out spleen, be placed in the RPMI-1640 culture fluid (incomplete RPMI-1640) without Ox blood serum cleaning once, proceed to aseptic In homogenizer, add a little not exclusively RPMI-1640, be lightly ground.Then the mixing of incomplete RPMI-1640 is added, the most quiet Putting 2-3min, after spleen tissue block sinks, gentle aspiration supernatant enters in 10mL centrifuge tube, and 1000rpm is centrifuged 10min, abandons Clearly, the aseptic NH of 5mL is added4Cl aqueous solution, 1000rpm is centrifuged 10min, precipitates with the RPMI-containing 10% calf serum (FCS) 1640 (complete RPMI-1640) adjusts cell concentration is 4 × 106Individual/mL, obtains splenocyte suspension.
Add in the 96 each holes of porocyte culture plate the 20 complete RPMI-1640s of μ L or purification through UV irradiation inactivation PRRSV make stimulate former, respectively as control wells or test hole, respectively set 4 repeat comparison..Then by splenocyte suspension Add in each hole, 100 μ L in every hole.96 porocyte culture plates are placed 37 DEG C, 5%CO2Incubator is cultivated 72h.Then every hole Adding 20 μ L MTT (tetrazolium bromide, purchased from Nanjing assistant research fellow Bioisystech Co., Ltd, article No.: 0793), mixing continues to cultivate 4-6h After, every hole adds 100 μ L DMSO (dimethyl sulfoxide, purchased from Nanjing assistant research fellow Bioisystech Co., Ltd, article No.: 0231) mixing, OD is surveyed with automatic enzyme mark analyzer492nmValue.Judge that lymphopoiesis drips with stimulation index (Stimulation Index, SI) Degree.The calculating of SI value: test hole OD492nmAverage/control wells OD492nmAverage.
Result is shown in Fig. 2 B, matched group all can inducing mouse spleen lymphocyte proliferation, but BPEI/PLGA-DNA induction produce The strongest lymphopoiesis (SI:6.173), is significantly stronger than simple nucleic acid vaccine group (SI:4.105), difference extremely notable (P < 0.001), illustrate that BPEI/PLGA nano-particle can be with the propagation of significant stimulation immune mouse splenocyte as adjuvant.
(3) nucleic acid vaccine is to immune mouse splenocyte IFN-γ mrna expression level and the shadow of IFN-γ secretion level Ring
Detection method: add 20 μ L purification in the 24 each holes of porocyte plate irradiates the PRRSV after going out through ultraviolet, then 4 × 10 will be diluted to complete RPMI-16406The splenocyte suspension of individual/mL adds in each hole, every hole 1ml.By 24 holes Tissue Culture Plate places 37 DEG C, 5%CO2After incubator cultivates 18 or 72h, the upper cleer and peaceful cell of results respectively.Wherein supernatant utilizes Mice IFN-γ ELISA kit (Wuhan Boster Biological Technology Co., Ltd.) detects each group of mouse spleen lymphocyte IFN-γ Content.Cell is used for extracting RNA, utilizes ultra-violet analysis photometer to survey RNA concentration, then according to conventional method detection mice IFN- The expression of γ mRNA.First, carry out reverse transcription with the RNA extracted for template and obtain cDNA, 20 μ L reverse transcription systems contain 0.4μgRNA.Then with cDNA product as template, ABI7500 quantitative real time PCR Instrument is utilized to carry out real-time fluorescence relative quantification PCR, with Mouse-β-actin gene as internal reference, detection primer is shown in Table 2.
The table 2 primer used in detection mouse spleen lymphocyte IFN-γ mrna expression level
Testing result: see Fig. 2 C and 2D.Matched group and experimental group all can improve turning of IFN-γ mRNA relative to blank group Record expression, wherein BPEI/PLGA absorption nucleic acid vaccine group is compared with blank group and simple nucleic acid vaccine group, and difference is the most aobvious Write (P < 0.001)；And the transcriptional expression level of BPEI/PLGA absorption nucleic acid vaccine group IFN-γ mRNA is significantly higher than PLGA absorption Nucleic acid vaccine group and PLGA adsorb nucleic acid vaccine group.Correspond, the IFN-γ of BPEI/PLGA absorption nucleic acid vaccine group induction Secretion level (678.833pg/mL) compared with blank group (28.433pg/mL) and simple nucleic acid vaccine group (268.5pg/mL), Difference is the most notable (P < 0.001)；The IFN-γ secretion level of BPEI/PLGA absorption nucleic acid vaccine group induction is significantly higher than PLGA Absorption nucleic acid vaccine group and BPEI adsorb nucleic acid vaccine, significant difference (P < 0.01).Illustrate that BPEI/PLGA nano-particle is as epidemic disease Seedling adjuvant, compared with BPEI or PLGA, can be obviously enhanced the cellullar immunologic response that nucleic acid vaccine induction produces.
Embodiment 3 nucleic acid vaccine immune effect to pig
Use the BPEI/PLGA absorption nucleic acid vaccine of embodiment 1 preparation, commercialized vaccine (the big China in Guangdong agriculture animal health High-pathogenicity porcine reproductive and the respiration syndrome live vaccine that product limited company produces, JXA1-R strain) carry out immunity respectively and connect Plant experiment.
1, pig immunity packet
20 3 week old pigs (PRRSV antigen and antibody are feminine gender) are randomly divided into 4 groups: (inoculation PBS delays blank group Rush liquid), BPEI/PLGA absorption nucleic acid vaccine group (inoculation BPEI/PLGA-DNA) and (inoculation of simple nucleic acid vaccine group And commercialized vaccine group pcDNA3.1-SynORF5).Often 5 pigs of group, use the mode of musculi colli injection to carry out immunity, commodity Changing vaccine and only carry out immunity when experimental group initial immunity, other respectively organizes all immunity 2 times, every minor tick 2 weeks.Immunizing dose is shown in Table 3。
The packet of table 3 pig and immunizing dose
2, pig body protest test
Head exempts from latter 28th day, and all packet pigs carry out counteracting toxic substances, and (GeneBank logs in musculi colli injection JSKM strain Number: HQ832104) 2mL, TCID50It is 10-5.0/mL。
3, immune effect
Index system: GP5 specific antibody level and PRRSV neutralizing antibody level, lymphocyte proliferation activity, IFN-γ MRNA and IFN-γ level, t lymphocyte subset type level of differentiation, rectal temperature, viremia and lung tissue disease after pig counteracting toxic substances Change level.
(1) nucleic acid vaccine is on immune swine GP5 specific antibody and the impact of PRRSV neutralizing antibody
GP5 specific antibody level detection method: concrete steps list of references (Enhanced immunogenicity of The modified GP5of porcine reproductive and respiratory syndrome virus is published in Virus Genes,32(1):5-11。
GP5 specific antibody level testing result: see Fig. 3 A.Head exempts from latter 14th, 28,35 days, and BPEI/PLGA adsorbs nucleic acid The GP5 specific antibody level that vaccine group and the induction of commercialized vaccine group produce gradually rises, and head exempts from latter 35th day, and two groups special Property antibody horizontal respectively reaches 1:800 and 1:960.But, head exempt from after the 42nd day, two group-specific antibody levels the most under Fall, may be relevant at pig proliferation in vivo with PRRSV.At all time points, BPEI/PLGA absorption nucleic acid vaccine induction produces GP5 specific antibody level is slightly below commercialized vaccine, but difference is not the most notable (P > 0.05).BPEI/PLGA nanometer is described Granule can strengthen the level of nucleic acid vaccine inducing producing specificity antibody as adjuvant, and compared with commercialized vaccine, lures The GP5 specific antibody level zero difference (P > 0.05) that artificial deliviery is raw.
Blood-serum P RRSV neutralizing antibody level detection method: exempt from latter 14th, 28,35,42 and 49 days respectively at head, to each group Pig carries out vena cava anterior blood sampling, separates and collects serum, after 56 DEG C of inactivation 30min, on 96 porocyte plates, uses DMEM cell Continuous doubling dilution made by serum by culture fluid, and dilution factor is 1:2 to 1:256, and each dilution factor makees 4 repetitions, every hole 50 μ L.With DMEM culture fluid will survey TCID50PRRSV be diluted to 100TCID50, join in all culture hole added with tested serum, Every hole 50 μ L, 37 DEG C, 5%CO2Incubator acts on 1h.Then in every hole, drip 100 μ L Marc-145 cell suspension (2-5×105Individual/mL), after shaking up gently, put back to and incubator continues cultivate 4-6 days.It is simultaneously provided with serum toxicity control, mark Zhunyin, positive serum controls, and virus control and normal cell controls.Observe by sky and record CPE situation, until result is steady Fixed.Under comparison establishment condition, by Reed-Muench Liang Shi method, calculate the specificity neutralizing antibody of the anti-PRRSV of tested serum Titre, can protect cell that the serum highly diluted multiple neutralization effect as tested blood serum sample of pathological changes does not occur completely Valency.
Serum neutralizing antibody horizontal detection result: see Fig. 3 B.Head exempts from latter 14th and 28 day, and BPEI/PLGA adsorbs nucleic acid epidemic disease The NAT that Seedling group and the induction of commercialized vaccine group produce gradually rises, and head exempts from latter 28th day, two groups of neutralizing antibody water Flat respectively 1:21.33 and 1:18.67；Head exempt from after the 35th day, neutralizing antibody level all declines, may with neutralize in pig body PRRSV is relevant, and then neutralizing antibody level presents again ascendant trend.At all time points, BPEI/PLGA adsorbs nucleic acid vaccine group The most close with the neutralizing antibody level that the induction of commercialized vaccine group produces, difference is the most notable.Show BPEI/PLGA nanometer Grain can be obviously enhanced the specificity neutralizing antibody level that nucleic acid vaccine induction produces.
(2) nucleic acid vaccine is to immune swine lymphopoiesis, PBMCs IFN-γ mrna expression level and IFN-γ secretion Level impact
The separation of immune swine peripheral blood mononuclear macrophage (PBMCs): exempt from latter 28 days and 42 days, aseptic collection respectively at head The vena cava anterior anticoagulation of pig, is carried out with the RPMI-1640 culture fluid culture fluid (incomplete RPMI-1640) without Ox blood serum 1:1 mixes, and takes 5mL mixed liquor and is carefully added into (10mL altogether) on the cell separation liquid liquid level of 5mL；With 500g (about 1800rpm) centrifugal 20min；Now in centrifuge tube, cell is divided into four layers from top to bottom: ground floor is plasma layer；The second layer is ring Shape milky buffy coat；Third layer is transparent separation liquid layer；4th layer is red blood cell layer.2mL needle injector is used to receive Collection second layer cell (about 2mL) is put in the centrifuge tube of 10mL, and adding incomplete RPMI-1640 to cumulative volume is 10mL, fully After mixing, being centrifuged 5min with 500g, supernatant discarded stays sedimentation cell, uses 5mL NH4Cl aqueous solution hangs again, 700rpm from Heart 5min, the full RPMI-1640 that cannots be used up washs 3 times, and 700rpm is centrifuged 5min, finally uses the RPMI-containing 10% Ox blood serum 1640 (complete 1640) culture fluid is resuspended, and adjusting concentration is 4 × 106Individual/mL, obtains PBMCs suspension.
Pig lymphocyte proliferation test methods: add in the 96 each holes of porocyte culture plate the 20 complete RPMI-1640s of μ L or It is former that the PRRSV through UV irradiation inactivation of purification makees stimulation, respectively as control wells or test hole, respectively sets 4 and repeats comparison. Then PBMCs suspension is added in each hole, 100 μ L in every hole.96 porocyte culture plates are placed 37 DEG C, 5%CO2Incubator is trained Support 72h.Then every hole adds 20 μ L MTT, and after mixing continues to cultivate 4-6h, every hole adds 100 μ L DMSO mixings, uses automatic enzyme OD surveyed by mark analyzer492nmValue.Lymphopoiesis titre is judged with stimulation index (Stimulation Index, SI).SI value Calculate: test hole OD492nmAverage/control wells OD492nmAverage.
Pig lymphocyte proliferation test testing result: see Fig. 3 C.Head exempts from latter 28th day, and BPEI/PLGA adsorbs nucleic acid vaccine The lymphopoiesis (SI:1.18) of group induction is slightly below commercialized vaccine group (SI:1.39), but difference is the most notable；Head exempts from Latter 42nd day, the lymphopoiesis (SI:1.28) of BPEI/PLGA absorption nucleic acid vaccine group induction was slightly above commercialized vaccine group (SI:1.23), difference is the most notable.Illustrating, BPEI/PLGA nano-particle, can be with immune stimulatory mice spleen lymph as adjuvant The propagation of cell, and propagation level is suitable with commercialized vaccine.
Immune swine PBMCs IFN-γ mrna expression level and the detection method of IFN-γ secretion level: in 24 porocyte plates Add 20 μ L purification in each hole irradiates the PRRSV after going out through ultraviolet, then adds in each hole by PBMCs suspension, every hole 1mL.24 porocyte culture plates are placed 37 DEG C, 5%CO2After incubator cultivates 18 or 72h, harvesting or supernatant respectively, its Middle supernatant utilizes porcine IFN γ ELISA kit (purchased from Wuhan excellent Er Sheng commerce and trade company limited, article No.: SEA049Po) detection each Group IFN-γ content, cell is used for extracting RNA to detect PBMCs IFN-γ mrna expression level, and detection method is with embodiment 1 In, difference is in real-time fluorescence relative quantification PCR primer and the reference gene used, and is specifically shown in Table 4.
The table 4 primer used in detection porcine IFN γ mrna expression level
IFN-γ mrna expression level and IFN-γ secretion horizontal detection result: see Fig. 3 D and E.Head exempts from latter 28th day, business The IFN-γ mRNA level in-site (2.824) of product vaccine group induction adsorbs nucleic acid vaccine group (2.418) though being higher than BPEI/PLGA, but It is that difference is not notable (P > 0.05)；And head exempts from latter 42nd day, the IFN-γ mRNA water of BPEI/PLGA absorption nucleic acid vaccine group induction Flat (1.925) are significantly higher than commercialized vaccine group (1.696), significant difference (P < 0.01)；Head exempts from latter 28th and 42 day, BPEI/ PLGA absorption nucleic acid vaccine group and the expression of commercialized vaccine group IFN-γ are all sufficiently close to, difference notable (P > 0.05).Illustrate that BPEI/PLGA nano-particle is answered as vaccine adjuvant, the cellular immunization that can strengthen nucleic acid vaccine induction generation Answer, and the cellullar immunologic response level of BPEI/PLGA absorption nucleic acid vaccine induction generation and commercialized vaccine are without significant difference.
CD4+And CD8+T cell subclass detection method: take 1 × 106The PBMCs of individual preparation adds in 1.5mL centrifuge tube, uses 1mL fluorescence washing liquid (pH7.4, concentration be 0.15M PBS in be added with final concentration of 2% new-born calf serum), 1500rpm is centrifuged 3-5min, abandons supernatant, with 300 μ L fluorescence washing liquid re-suspended cells, is separately added into the mouse-anti pig CD3 of FITC labelling Antibody (purchased from Southern Biotech company of the U.S., article No.: 4510-2), the mouse-anti pig CD8 antibody of PE labelling is (purchased from the U.S. Southern Biotech company, article No.: 4515-09) and the mouse-anti pig CD4 fluorescent antibody of SPRD labelling (purchased from the U.S. Southern Biotech company, article No.: 4520-13), fully after mixing, 4 DEG C of lucifuges hatch 30min；Use fluorescence wash liquid 2 times, each 1mL, 1500rpm are centrifuged 5min, abandon supernatant；Pipe floor cells preserves liquid with 500 μ L fluorescence, and (pH7.4, concentration are The PBS of 0.15M is added with the glucose of final concentration of 2%, the formaldehyde of 1% and the NaN of 0.1%3) resuspended, utilize CD3 in 5000-10000 cell of flow cytomery+CD4+, CD3+CD8+Positive cell number.
CD4+And CD8+T cell subclass testing result: see Fig. 4 A and 4B.Head exempts from latter 14th, 28,35 and 42 days, separates and obtains PBMCs utilize fluorescent antibody to be marked, utilize flow cytomery CD3+CD4+And CD3+CD8+T lymphocyte is dynamic Change.Head exempts from latter 28th day, BPEI/PLGA absorption nucleic acid vaccine group and commercialized vaccine group CD3+CD4+T percentage of lymphocyte reaches To peak, respectively 30.08% and 25.77%, between two groups, difference is extremely notable (P < 0.001)；Head exempt from after the 35th day, two groups CD3+CD4+T percentage of lymphocyte all occur decline, may with PRRSV in pig body relevant；Head exempts from latter 42nd day, BPEI/ PLGA adsorbs nucleic acid vaccine group CD3+CD4+T percentage of lymphocyte continuous decrease, and commercialized vaccine group CD3+CD4+T lymph is thin Born of the same parents' ratio is slightly gone up.Head exempts from latter 35th day, BPEI/PLGA absorption nucleic acid vaccine group and commercialized vaccine group CD3+CD8+T lymph Cell proportion reaches peak, respectively 41.2% and 29.56%, both significant differences (P < 0.05)；Head exempt from after the 42nd day, two Group CD3+CD8+All there is downward trend in T percentage of lymphocyte.Illustrate that BPEI/PLGA granule, as vaccine adjuvant, can improve CD3+CD4+And CD3+CD8+The ratio of T lymphocyte, and then enhancing body is to the ability of viral infection resisting.
(3) clinical manifestation and rectal temperature detection after counteracting toxic substances
Two exempt from latter 14 days to carry out pig body challenge test.After counteracting toxic substances, every day carries out clinicing symptom observation, and every morning, animal Feed later hour, animal measures rectal temperature when being in rest state.According to each group of five temperature of pig body average value measured, paint Temperature changing trend curve processed, the reference index evaluated as vaccine immunity protection.
Result is shown in Fig. 5.Head carries out protest test to pig on the 28th day after exempting from, after counteracting toxic substances, and PBS blank group pig body temperature Rise substantially, within after counteracting toxic substances the 7th day, be quickly raised to 41 DEG C, and show certain clinical symptoms, show as inappetence, spirit Depressed, by hair slightly disorderly, blepharoedema, exaggerated respiration increases the weight of, and ventral breathing occur in indivedual pigs, after mild diarrhea, and counteracting toxic substances the Within 18 days, there is a pig that death occurs；Simple nucleic acid vaccine group pig body temperature rises, and after counteracting toxic substances, the 6th day body temperature reaches more than 40 DEG C, And persistently raise, pig shows as being off one's feed, lassitude etc.；And BPEI/PLGA absorption nucleic acid vaccine group pig body temperature becomes Change trend is similar with commercialized vaccine immune group, and after only head exempts from, the 37th and 45 day pig mean body temperature reaches more than 40.5 DEG C, faces Bed performance is slight, and the persistent period is short.Commercialized vaccine immune group body temperature slightly raises, but is not above 40 DEG C, without the most clinical Performance.Showing, BPEI/PLGA nano-particle is as nucleic acid vaccine adjuvant, it is provided that certain immune protective efficiency.
(4) viremia detection
After head exempts from, within the 28th, 31,33,35,38,42 and 49 days, gather blood respectively, separate serum, take 200 μ L serum and carry Taking RNA and reverse transcription is cDNA, utilize the carrying capacity of Probe qRT-PCR method detection PRRSV virus, amplified fragments is positioned at ORF7.Wherein Real time-PCR reaction system is formulated as follows:
Wherein Primer F sequence is: TCAGCTGTGCCAAATGCTGG, Primer R sequence is: AAATGGGGCTTCTCCGGGTTTT, TaqManProbe is FAM-TCCCGGTCCCTTGCCTCTGGA-TARAM.Required reagent Purchased from Takara company.
Result is shown in Fig. 6.In simple nucleic acid vaccine group serum, viral RNA carrying capacity changes with PBS blank group as seen from Figure 6 Trend is consistent, and after exempting from except head, the 31st beyond the highest heavens, and remaining each time point is compared with BPEI/PLGA absorption nucleic acid vaccine group, sick in serum Poison content difference is notable (P < 0.05), BPEI/PLGA absorption nucleic acid vaccine group and viral RNA carrying capacity in commercialized vaccine group serum Variation tendency is consistent, and only head exempts from latter 38th and 42 day, viral level significant difference (P < 0.05), remaining time point in serum Difference is not notable (P > 0.05).Show that BPEI/PLGA absorption nucleic acid vaccine group can suppress after pig counteracting toxic substances to a certain extent Virus propagation in pig blood, provides immune protective efficiency for body.
(5) lung pathology inspection
Use conventional method that each group of immunity pig is dissected, make lung tissue pathological section.Result is shown in Fig. 7, can All there occurs pathological change with the lungs of four groups of pigs after seeing counteracting toxic substances, the lung tissue pathological change of PBS blank group pig is Substantially, showing as alveolar wall thickening, lymphocytic infiltration, interstitial broadens；Simple nucleic acid vaccine group lung tissue change is taken second place, table Being now that alveolar wall is thickening, interstitial broadens；And BPEI/PLGA absorption nucleic acid vaccine group and commercialized vaccine group are showed only as slight Interstitial broadens, without other significant changes.Showing, BPEI/PLGA nano-particle, as nucleic acid vaccine adjuvant, can make pig body obtain More immunoprotection.
In sum, BPEI/PLGA nano-particle is on the one hand as the presentation system of PRRSV DNA vaccination, it is to avoid DNA quilt Degraded, on the other hand plays the activity of adjuvant, to improve the immunogenicity of DNA vaccination.From the immune effect of mice and pig It can be seen that BPEI/PLGA of the present invention absorption nucleic acid vaccine can significantly improve the cell and humoral response of immune animal, attacking Immune animal is effectively protected by poison test, suitable with commercialized vaccine protected effect.

Claims (9)

1. a porcine reproductive and respiratory syndrome virus nucleic acid vaccine, it is characterised in that containing BPEI/PLGA nano-particle adjuvant With carry the recombiant plasmid of PRRSV ORF5 gene, described in carry the recombiant plasmid of PRRSV ORF5 gene and be adsorbed in BPEI/PLGA nano-particle adjuvant surface.
Porcine reproductive and respiratory syndrome virus nucleic acid vaccine the most according to claim 1, it is characterised in that described BPEI/PLGA Nano-particle is the Poly(D,L-lactide-co-glycolide that branched polyethylene imine is modified, and particle diameter is 100-600 nm, described branched Polymine is 1:9-11 with the mass ratio of Poly(D,L-lactide-co-glycolide.
Porcine reproductive and respiratory syndrome virus nucleic acid vaccine the most according to claim 1 or claim 2, it is characterised in that described BPEI/ The preparation method of PLGA nano-particle comprises the following steps: Poly(D,L-lactide-co-glycolide is dissolved in dichloromethane, by branched Polymine is dissolved in polyvinyl alcohol water solution, then by both mixing, emulsifying, removes organic solvent, and centrifuging and taking precipitates, freezing It is dried, obtains BPEI/PLGA nano-particle.
Porcine reproductive and respiratory syndrome virus nucleic acid vaccine the most according to claim 3, it is characterised in that polylactic acid-glycolic base second Acid copolymer and the mass ratio 9-11:1 of branched polyethylene imine.
Porcine reproductive and respiratory syndrome virus nucleic acid vaccine the most according to claim 4, it is characterised in that described in carry The recombiant plasmid of PRRSV ORF5 gene obtains after PRRSV ORF5 gene is inserted pcDNA3.1 carrier.
Porcine reproductive and respiratory syndrome virus nucleic acid vaccine the most according to claim 5, it is characterised in that BPEI/PLGA nanometer Granule is 10-12:2 with the mass ratio of the recombiant plasmid carrying PRRSV ORF5 gene.
7. the preparation method of porcine reproductive and respiratory syndrome virus nucleic acid vaccine described in claim 1, it is characterised in that include as Lower step: BPEI/PLGA nano-particle adjuvant is mixed homogeneously, after standing with the recombiant plasmid carrying PRRSV ORF5 gene Obtain described porcine reproductive and respiratory syndrome virus nucleic acid vaccine.
The preparation method of porcine reproductive and respiratory syndrome virus nucleic acid vaccine the most according to claim 7, it is characterised in that take Adopt with the recombiant plasmid of PRRSV ORF5 gene and prepare with the following method: the recombiant plasmid of PRRSV ORF5 gene will be carried Transformed host cell, after cultivation, it is thus achieved that carry the recombiant plasmid of PRRSV ORF5 gene.
9. according to the preparation method of porcine reproductive and respiratory syndrome virus nucleic acid vaccine described in claim 7 or 8, it is characterised in that Described porcine reproductive and respiratory syndrome virus nucleic acid vaccine is lyophilized powder.
CN201610450557.4A 2016-06-21 2016-06-21 Porcine reproductive and respiratory syndrome virus nucleic acid vaccine and preparation method thereof Pending CN106039302A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610450557.4A CN106039302A (en) 2016-06-21 2016-06-21 Porcine reproductive and respiratory syndrome virus nucleic acid vaccine and preparation method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610450557.4A CN106039302A (en) 2016-06-21 2016-06-21 Porcine reproductive and respiratory syndrome virus nucleic acid vaccine and preparation method thereof

Publications (1)

Publication Number Publication Date
CN106039302A true CN106039302A (en) 2016-10-26

Family

ID=57168642

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610450557.4A Pending CN106039302A (en) 2016-06-21 2016-06-21 Porcine reproductive and respiratory syndrome virus nucleic acid vaccine and preparation method thereof

Country Status (1)

Country Link
CN (1) CN106039302A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106798920A (en) * 2017-01-23 2017-06-06 北京康宝利华生物科技有限公司 A kind of compound immunological adjuvant and its preparation method and application

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101084011A (en) * 2004-11-19 2007-12-05 英特威国际有限公司 Porcine reproductive and respiratory syndrome virus strains and compositions
WO2009020334A2 (en) * 2007-08-07 2009-02-12 Korea Research Institute Of Bioscience And Biotechnology Porous polymer particles immobilized with charged molecules and method for preparing the same
CN101392261A (en) * 2008-08-12 2009-03-25 华中农业大学 Modified highly pathogenic porcine reproductive and respiratory syndrome virus ORF5 gene and application
CN102321638A (en) * 2011-09-06 2012-01-18 南京农业大学 New porcine reproductive and respiratory syndrome virus ORF5 modified gene and application thereof
CN102362861A (en) * 2011-11-04 2012-02-29 无锡中科光远生物材料有限公司 Hollow composite nanoparticle with core-shell structure and preparation method thereof
CN103028114A (en) * 2012-12-28 2013-04-10 贵州大学 Nucleic acid vaccine, immunoadjuvant of nucleic acid vaccine, and preparation methods of nucleic acid vaccine and immunoadjuvan
CN103432100A (en) * 2013-08-22 2013-12-11 东华大学 Method for preparing polyethyleneimine modified PLGA (poly(lactic-co-glycolic acid)) loading hollow micro-capsules based on polyethylene glycol and folic acid grafting

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101084011A (en) * 2004-11-19 2007-12-05 英特威国际有限公司 Porcine reproductive and respiratory syndrome virus strains and compositions
WO2009020334A2 (en) * 2007-08-07 2009-02-12 Korea Research Institute Of Bioscience And Biotechnology Porous polymer particles immobilized with charged molecules and method for preparing the same
CN101392261A (en) * 2008-08-12 2009-03-25 华中农业大学 Modified highly pathogenic porcine reproductive and respiratory syndrome virus ORF5 gene and application
CN102321638A (en) * 2011-09-06 2012-01-18 南京农业大学 New porcine reproductive and respiratory syndrome virus ORF5 modified gene and application thereof
CN102362861A (en) * 2011-11-04 2012-02-29 无锡中科光远生物材料有限公司 Hollow composite nanoparticle with core-shell structure and preparation method thereof
CN103028114A (en) * 2012-12-28 2013-04-10 贵州大学 Nucleic acid vaccine, immunoadjuvant of nucleic acid vaccine, and preparation methods of nucleic acid vaccine and immunoadjuvan
CN103432100A (en) * 2013-08-22 2013-12-11 东华大学 Method for preparing polyethyleneimine modified PLGA (poly(lactic-co-glycolic acid)) loading hollow micro-capsules based on polyethylene glycol and folic acid grafting

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BIN LI 等: "Enhanced protective efficacy of a PRRSV DNA vaccine by absorption onto biodegradable PLGA/BPEI nanoparticle", 《THE JOURNAL OF IMMUNOLOGY》 *
C.E. MORA-HUERTAS等: "Polymer-based nanocapsules for drug delivery", 《INTERNATIONAL JOURNAL OF PHARMACEUTICS》 *
EUN JIN SEO等: "Efficient Production of Retroviruses Using PLGA/bPEI DNA Nanoparticles and Application for Reprogramming Somatic Cells", 《PLOS ONE》 *
张勇等: "改良自乳化溶剂挥发法制备MePEG-PLGA纳米粒的研究", 《分析测试学报》 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106798920A (en) * 2017-01-23 2017-06-06 北京康宝利华生物科技有限公司 A kind of compound immunological adjuvant and its preparation method and application

Similar Documents

Publication Publication Date Title
CN106148287B (en) Porcine epidemic diarrhea virus strain and vaccine composition, preparation method and application thereof
CN1940063A (en) Pseudo-rabies gE/gI-gene loss poison strain, killed vaccine containing it and use
CN104513827A (en) Porcine epizootic diarrhea virus strain, attenuated vaccine strain thereof and application thereof
CN104099301B (en) Coxsackie virus A16 type virus strain, application, vaccine and preparation method thereof
CN109536460A (en) A kind of CV-A10 virus seed culture of viruses and its inactivated vaccine for human
CN103509761B (en) Recombinant porcine pseudorabies virus strain used for expression of porcine circovirus type II (PCV2) ORF2 gene, and preparation method thereof
CN111876391A (en) Feline panleukopenia virus FPV BJ05 strain and application thereof
CN104928260A (en) Infectious bovine rhinotracheitis virus IBRV-JN03 isolate and application thereof
CN111073863A (en) Porcine epidemic diarrhea and porcine delta coronavirus bivalent attenuated vaccine and preparation method thereof
CN102727883B (en) Combined live vaccine against porcine reproductive and respiratory syndrome and swine fever, and application thereof
CN101914502B (en) I-type canine adenovirus attenuated vaccine strain and application thereof
CN109609467A (en) A kind of CV-A6 virus seed culture of viruses and its inactivated vaccine for human
CN105802921B (en) Recombinant pseudorabies virus variant strain for expressing classical swine fever virus E2protein and construction method and application thereof
CN111647568A (en) Reverse genetic vaccine strain of novel variant strain of chicken infectious bursal disease virus and application thereof
CN106039302A (en) Porcine reproductive and respiratory syndrome virus nucleic acid vaccine and preparation method thereof
CN104087559A (en) Infectious bursal disease virus, inactivated vaccine for infectious bursal disease virus and preparation method of vaccine
CN103937817A (en) Newcastle disease virus YT strain as well as whole genome sequence and application thereof
CN103923885A (en) Infectious bursal disease virus Vero cell-adapted strain and application thereof
CN113174374B (en) Bovine viral diarrhea virus attenuated strain and application thereof
CN106929480A (en) Porcine reproductive and respiratory syndrome virus strain and its application
CN115161291A (en) Cat parvovirus strain and application thereof
CN109010818A (en) A kind of bivalent vaccine composition and its preparation method and application prevented and/or treat Infection of Porcine circovirus
CN107893056A (en) The type vaccine strain of bovid herpesvirus 5 I and its application
CN1242065C (en) Pig breeding and respiratory syndrome recombined adenovirus and vaccine
CN104388399B (en) PRRSV attenuated strain which is capable of inducing pig body to relatively early generate interferon and neutralizing antibody and possesses wide-spectrum immunogenicity

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination