CN102776222A - Preparation and application of fused oral interferon for fowl - Google Patents

Abstract

Preparation and application of a fused oral interferon for fowl are disclosed. On the basis of the conserved sequences of fowl interferon alpha and gamma genes, the interferon alpha gene having great antiviral effect and the interferon gamma gene capable of improving the immunity of the organism and enhancing the constitution of the organism are fused for expression, so that the expressed alpha+gamma fused interferon has the synergetic functions of the two. In the mean time, a dunaliella bioreactor is used as an expression system; apart from that the system is capable of expressing exogenous genes, own advantages such as rich nutrition, nontoxicity, harmlessness and the like of dunaliella are also utilized; consequently, a gene algae plant for multiple purposes is obtained; the fused oral interferon for fowl prepared from the genetically modified algae plant can be applied to the fields such as prevention or treatment of fowl viroses, fowl breeding, related feed processing industry and the like; and the fused oral interferon for fowl is good in effect, green and environment-friendly, and also low in cost.

Description

One stud bird is with the preparation and the application thereof of pattern of fusion oraferon

Technical field

The present invention relates to field of biological pharmacy, specifically a stud bird is with its application of preparation of pattern of fusion Interferon, rabbit.

Background technology

At present, maximum to the harm of China bird aquaculture, also one type of disease the most rambunctious is communicable virus disease.Be directed to such disease of bird, never have the efficacious therapy ways and means, wherein vaccine inoculation is that the current avian viral diseases that prevents breaks out and popular major measure and key link.But along with vaccine prevention failure or inoculate untimely, the often outburst of some virus diseases in bird is cultured, infectivity and mortality ratio are high, some can reach 100%.In case during wild virus property disease, biotechnological formulations such as Interferon, rabbit are the choice drugs of treating in the market.But the Interferon, rabbit of current application market is main with the unit price type, and belongs to injection-type more, and it uses complex operation, cost is high, time-consuming, and effect is not ideal.And the production of current bird Interferon, rabbit is main with prokaryotic expression system mainly, also utilizes the eukaryotic cell expression system.Prokaryotic expression system exists and can not carry out proteinic transcribing and the posttranslational modification function, and mostly expression product be inclusion body in the insoluble born of the same parents, yields poorly, and needs complicated processes such as processing purifying; The eukaryotic cell expression system exists that cost costliness, conditional request are harsh, protein is vulnerable to pollute and purification difficult and be difficult to shortcoming such as mass-producing, has all limited the application of the two system.Therefore, seek the main R&D direction that the new compound Interferon, rabbit of bio-reactor production multivalence becomes present Interferon, rabbit.

The salt algae ( Dunaliella salina) be a kind of unicellular eucaryon algae that lives in the salt water; Himself has the incomparable advantage of many other reactor drums; As: 1) salt algae itself is nutritious, is rich in compositions such as β-Hu Luobusu, VITAMINs and protein, has high nutritive value and medical value; 2) Halophila is biological in photosynthetic autotrophs, can directly adopt open large scale culturing, and it is cheap to cultivate cost, and productive expense is low; 3) salt algae itself is nontoxic, is a kind of natural healthcare products, can enhance immunity power and resistibility; 4) the salt algae is a kind of natural protoplastis, and it is simple to operate that it is carried out genetic transformation; 5) cultivation of salt algae is safe and reliable, can not pollute environment.6) Halophila has and transcribes and translate the back to proteic working ability in eukaryote, can produce nearly natural highly active protein.

Summary of the invention

In view of production and the present condition for application of present fowl with Interferon, rabbit; The present invention provides the preparation method of a stud bird with the pattern of fusion oraferon; Prepared pattern of fusion oraferon can the antiviral therapy disease, improve body immunizing power, improve bird body meat quality.The prevention and the treatment succeeded in developing avian viral diseases of this product all are of great practical significance, and have huge economic benefit and commercial value.

One stud bird is with the preparation and the application thereof of pattern of fusion oraferon, and its concrete steps are following:

The preparation of step 1, fowl α, IFN-gene: α, IFN-gene to the listed chicken of global common sequence DB GenBank, duck and three kinds of animals of goose carry out sequence alignment respectively; Preferences in conjunction with salt frustule genome codon; Base sequence to three kinds of the two genes of animal is transformed modification, synthetic three kinds of IFN-sequence (sequence table sequence 1), IFN-sequences (sequence table sequence 2) that bird is general.According to gene order, the difference design specific primers is through method amplification fowl α, the IFN-gene of PCR;

Step 2, conversion salt frustule construction of eukaryotic expression vector: fowl α, IFN-gene fragment through pcr amplification are connected with the pMD18-T cloning vector respectively; Through downcutting α, γ gene fragment respectively after the double digestion evaluation separately and the evaluation of checking order, successively the two gene is connected on the carrier for expression of eukaryon pBI-through the T4 ligase enzyme; The recombinant vectors pBI-α+γ that builds is used for the conversion to the salt frustule;

Step 3, recombinant expression vector transform the salt frustule: the recombinant plasmid that builds is passed through granulated glass sphere conversion method efficiently, or transform the salt frustule through existing particle bombardment, electric shocking method, liposome mediated-method or UW importing method.Salt frustule after the conversion is cultivated through selecting screening of medium, finally obtains positive transformant.The positive algae of picking falls to carrying out enlarged culturing respectively, supplies follow-up molecular biology identification used;

Step 4, to transforming the screening and the molecular biology identification of algae strain: extract the total RNA of genome of transgenic alga strain, carry out the RT-PCR amplification and identify, integrate and expression status in the hope of finding out goal gene to being incorporated into goal gene in the salt algae genome.Simultaneously, utilize western blot technology to expressing to such an extent that protein product carries out the biochemical activity analysis;

The preparation of step 5, pattern of fusion oraferon will identify that correct transgenic alga strain is inoculated in natural sea-water algal culture pond by 1% inoculum size, carries out open large-scale cultivation.Cultivated about 10-14 days, when frustule concentration reaches 10 ⁶Individual/as during ml,, promptly to obtain the pattern of fusion oraferon through quiescent setting or centrifugal collection frond, can carry out next step step 6 or step 7 technology according to different purposes;

Step 6, being applied as in prevention or treatment avian viral diseases reach this purposes; Can adopt following technical scheme: coldcondition adopts ultrasonic grinding down; Cracked salt frond adds in 5% the ratio that accounts for chicken drinking-water volume, joins existing usefulness at present, is controlled in the 0.5-2h and has drunk;

Step 7, reach this purposes as a kind of functional feedstuff additive being applied as in bird aquaculture and feed processing industry; Can adopt following technical scheme: with this transgenic alga strain directly or through concentrating, cryodrying, granulation, pulverizing or processing such as mix with other nutritive ingredient after, add in the poultry feed Ingredient.Addition is 1-7%, and adding form can be for solid forms such as pulvis, granules, also can be semi-solid forms such as paste, pill, also can be liquid form.

Beneficial effect

1, the prepared Interferon, rabbit of the present invention is the divalence Interferon, rabbit of pattern of fusion, is that interferon alpha, the gamma gene sequences that utilizes the bird conservative property stronger is the basis, and the α gene has strong antivirus action, can play the purpose of treatment virus disease; The γ gene can be regulated the effect of body physique, enhancing body immunizing power, and the two gene is carried out amalgamation and expression α+γ, can play the synergy of said two devices effect, and therapeutic action is better.

2, the present invention has overcome the deficiency that current Interferon, rabbit production system exists, utilized collect multiple advantage for salt frustule all over the body as expression system.Interferon alpha+γ gene transformation salt frustule is prepared the transgenic alga strain.The course of processing that this transgenic alga strain need not induce, separate and purification etc. is complicated, can be directly as the active interferon formulation poultry of throwing something and feeding, operating process is easy, and is time saving and energy saving.Simultaneously; The advantage of salt algae self also is able to utilize, and can play the effect of " strain is used more ", promptly can play outside antiviral, the enhance immunity power; Can also accelerate body the speed of growth, improve advantages such as meat quality, be a kind of nutritious green anti-virus formulation.

3, the prepared interferon formulation of the present invention can adopt natural open industrialized culture, and not only output is high, with low cost for it, and is not subject to the pollution of external microbe, and biological safety is good.

4, the ingenious close ties that exist between salt algae, poultry, the Interferon, rabbit three of having utilized of the present invention: Interferon, rabbit has stronger antivirus action; Virus can infect poultry; Poultry again can be with the salt algae as feed ingredient, and the salt algae is an ideal green expression system.For this reason, but the engineering algae strain through transgenic means preparations need not purification processing just the administered through oral mode directly throw something and feed, convenient and swift, avoided the disadvantageous effect of modes such as injection.The direct administered through oral administering mode of the active interferon formulation of this natural green carries out, and does not at home and abroad appear in the newspapers as yet.

5, the interferon formulation of the present invention's preparation can not only be able to use as antivirus medicine for birds; And can be used as a kind of multi-functional fodder additives again and in bird aquaculture and feed processing industry, be able to use, and this additive has advantages such as residual, the no resistance of no any poison pair, environmental protection.

Description of drawings

Fig. 1 is that the pcr amplification product sepharose of fowl α gene detects electrophorogram;

Among the figure: the left side is molecular weight 2000 Marker, and the right side is a PCR product sample

Fig. 2 is that the pcr amplification product sepharose of fowl γ gene detects electrophorogram;

Among the figure: M is molecular weight 2000 Marker; B is a blank; P is two multiple PCR product samples;

Fig. 3 is a pBI-α recombinant plasmid XbaWith BamHThe double digestion sepharose detects electrophorogram;

Among the figure: the left side is a dna fragmentation behind the pBI-α recombinant plasmid double digestion, and the right side is Marker;

Fig. 4 is pBI-α+γ recombinant plasmid BamHWith SacThe double digestion sepharose detects electrophorogram;

Among the figure: the left side is a dna fragmentation behind pBI-α+γ recombinant plasmid double digestion, and the right side is Marker;

Fig. 5 is for transforming the carrier for expression of eukaryon pBI-α+γ structural representation of salt frustule

Fig. 6 is the solid medium screening and culturing figure as a result of transgenic alga strain;

Among the figure: the negative control group of left side plate, promptly the growing state of wild-type salt frustule does not have single algae and drops out existing; The right side plate is for transforming the growing state of algae strain, the visible growth that has a plurality of single algaes to fall;

Fig. 7 is for carrying out the pcr amplification evaluation figure of α gene to positive transformant;

Among the figure: M is molecular weight 2000 Marker; The negative contrast of W, i.e. the salt algae strain of wild-type; T1, T2 are respectively the positive transformant of two strains;

Fig. 8 is for to carry out Western blot analytical results figure to expression product;

Among the figure: the left side is albumen Marker, the interferon protein band of right side for merging.

Embodiment

The method that provides in " fine works molecular biology experiment guide (the 4th edition) " of the used genetically engineered elementary operation of the present invention technology by scientific publication publication in 2005 is carried out, or operates according to the working instructions of purchase reagent, product.

The embodiment of the invention relates to following material:

PMD18-T cloning vector, pBI-carrier for expression of eukaryon are bought the precious biological ltd in Dalian; The intestinal bacteria competence is bought the precious biological ltd in Dalian; Restriction enzyme Xba, BamH, SacAvailable from the precious biological ltd in Dalian; The T4 dna ligase is available from the precious biological ltd in Dalian; Trizol reagent is bought the company in American I nvitrogen; PCR cleaning agents box and glue reclaim test kit available from U.S. Axygene company; The synthetic of Auele Specific Primer synthesized by the biological ltd of the living worker in Shanghai;

One stud bird is with the preparation and the application thereof of pattern of fusion oraferon, and its concrete steps are following:

The amplification of step 1, fowl α, IFN-gene

1) preparation of fowl alpha-IFN gene

Alpha-IFN gene (accession number is respectively DQ226092, EF053034 and AY524422) to the listed chicken of global common sequence DB GenBank, duck and goose carries out sequence alignment; In conjunction with the genomic codon-bias of salt algae expression system; Gene order to three kinds of animals is transformed modification, and the amino acid that the frequency of occurrences is higher is assigned to corresponding position, avoids stopping the appearance with non-coding base combination; Synthetic the promotor of three kinds of general for animal be ATG; Terminator is the IFN-sequence (sequence table sequence 1) of TAA, goes out a pair of primer, upstream primer: 5 ' according to this sequences Design TCTAGAATGGCTGGGCCATCAGCCCC3 ', downstream primer: 5 ' GGATCCCGTGTTGGTGCGGGT 3 ', underscore indication are that the upstream and downstream primer is introduced respectively XbaWith BamHRestriction enzyme site.Adopt following response procedures to carry out pcr amplification then: 94 ℃ of preparatory sex change 5min, 30 circulations (72 ℃ are extended 70S for 94 ℃ of sex change 40S, 53 ℃ of annealing 40S), termination reaction behind 72 ℃ of extension 10min.The PCR product identifies that through 1% agarose gel electrophoresis the result demonstrates the gene fragment (result is as shown in Figure 1) of the about 600bp of size;

2) preparation of fowl IFN-gene

IFN-gene (accession number is respectively AY163160, AY166850 and AY524421) to chicken, duck and the goose of global common sequence DB GenBank login carries out sequence alignment; In conjunction with the genomic codon-bias of salt algae expression system; The amino acid that the frequency of occurrences is higher is assigned to corresponding position; Synthetic the promotor of three kinds of general for animal be ATG; Terminator is the IFN-sequence (sequence table sequence 2) of TAA, goes out a pair of primer, upstream primer: 5 ' according to this sequences Design GGATCCACTTGCACTACCCAGACTTAC3 ', downstream primer: 5 ' GAGCTCTTACGTGTTGGTGCGGGTGA 3 ', underscore indication are that the upstream and downstream primer is introduced respectively BamHWith SacRestriction enzyme site.Adopt following condition to carry out pcr amplification then: 94 ℃ become 4 min in advance, 28 circulations (72 ℃ are extended 100S for 94 ℃ of sex change 45 S, 56 ℃ of annealing 50S), termination reaction behind 72 ℃ of extension 10min.The PCR product identifies that through 1% agarose gel electrophoresis the result demonstrates the gene fragment (result is as shown in Figure 2) of the about 500bp of size.

The clone of step 2, PCR product and evaluation

1) clone of interferon alpha, γ gene fragment

Before the PCR product connects the pMD18-T cloning vector, the purifying and recovering of advanced performing PCR product.Adopt PCR cleaning agents box to reclaim α, γ gene fragment respectively, operate according to appended specification sheets.Recovery is obtained α fragment gene fragment adopt restriction enzyme XbaWith BamHCarry out double digestion, the γ gene fragment adopts restriction enzyme BamHWith SacCarry out double digestion; Connect with the pMD18-T cloning vector of the identical double digestion of process respectively then, linked system is following: 10 times of T4 dna ligases of 2 μ l damping fluid, 1 μ l pMD18-T carrier; 7 μ l α or γ gene fragment; 1 μ l T4 DNA ligase enzyme replenishes ddH2O to TV 20 μ l, and ligation system is then placed in 16 ℃ of water-baths and spent the night.

2) enzyme of reorganization pMD18-T-α (or γ) the cloning vector evaluation of cutting and check order

Adopt CaCl ₂The heat shock method is converted into the intestinal bacteria competence with cloning vector pMD18-T-α (or γ), adopts blue hickie screening, 37 ℃ of incubated overnight.The picking positive colony adopts alkaline lysis to extract plasmid in a small amount after the enlarged culturing then, plasmid is carried out double digestion respectively identify that (recombinant plasmid pMD18-T-α adopts restriction enzyme XbaWith BamHCarry out double digestion, recombinant plasmid pMD18-T-γ uses restriction enzyme BamHWith SacCarry out double digestion), can detection cut out the gene fragment of expection.Choosing enzyme then cuts and identifies that correct positive colony sends Shanghai and give birth to the evaluation of checking order of the biological ltd of worker.

Step 3, conversion salt frustule pBI-α+γ Construction of eukaryotic

Enzyme cut and check order identify and to carry out double digestion respectively by all correct recombinant vectors pMD18-T-α (or γ) (recombinant plasmid pMD18-T-α adopts restriction enzyme XbaWith BamHCarry out double digestion, recombinant plasmid pMD18-T-γ restriction enzyme BamHWith SacCarry out double digestion), adopt Axygene company glue to reclaim test kit then and reclaim interferon alpha, γ gene fragment, operate according to its appended specification sheets; Earlier eukaryotic vector pBI-is carried out restriction enzyme XbaWith BamHDouble digestion, the enzyme system of cutting is: 1.5 μ l XbaEnzyme, 1.5 μ l BamHEnzyme, 7 μ l pBI-carriers, 2 μ l buffer mend and add water to TV 20 μ l, cut in 37 ℃ of water-bath enzymes and spend the night, and reclaim test kit through glue then and reclaim carrier segments.The alpha gene fragment that reclaims is connected with carrier segments pBI-.Linked system is: 2 μ l pBI-carriers, and 10 μ l alpha gene fragments, 10 times of T4 dna ligases of 2 μ l damping fluid, T4 dna ligase 1.5 μ l mend and add water to TV 20 μ l, connect in 16 ℃ of water-baths then and spend the night;

Adopt CaCl next day ₂The heat shock method is transformed into the intestinal bacteria competence with this linked system respectively, adopts blue hickie screening, carries out the extraction of plasmid after the positive bacterium colony of picking is cultivated.Extract plasmid and adopt restriction enzyme XbaWith BamHCarry out double digestion and identify that enzyme cuts system and condition is the same, the result is as shown in Figure 3, has cut out the fragment of about 600bp.Identify that correct recombinant plasmid carries out BamHWith SacDouble digestion, the enzyme system of cutting is: 1.5 μ l SacEnzyme, 1.5 μ l BamHEnzyme, 7 μ l pBI-α carriers, 10 times of restriction enzyme buffer of 2 μ l mend and add water to TV 20 μ l, cut in 37 ℃ of water-bath enzymes and spend the night, and reclaim test kit through glue then and reclaim carrier segments.The carrier segments that reclaims is connected with the γ gene fragment, and linked system and condition are connected with alpha gene fragment, then recombinant plasmid are carried out restriction enzyme BamHWith SacDouble digestion is identified (shown in Figure 4), finally successfully makes up pBI-α+γ carrier for expression of eukaryon, and the structure of this carrier is as shown in Figure 5.

The conversion of step 4, salt frustule and the screening and culturing of transformant

Adopt the granulated glass sphere conversion method that recombinant plasmid pBI-α+γ is transformed frustule, main operational steps is following: collect the salt frustule 800 μ l of logarithmic phase, cell concn is 10 ⁶Individual cell/ml adds 150 μ l, 20% polyoxyethylene glycol and 90 μ l recombinant plasmids (concentration is 0.55 μ g/ μ l) then, under the condition that 300 mg granulated glass spherees exist, in rotating speed 2400 rpm vortexs 12 s, accomplishes conversion process.After treating the complete sedimentation of granulated glass sphere, transformation system is secretly cultivated 12h with the PKS substratum, 3 days (light: dark than being 12:12) is cultivated in normal illumination then.Adopt the centrifugal 5min of 2000rpm to collect the salt frustule, select substratum to carry out screening and culturing the cell applying solid, the appearance (as shown in Figure 6) that falls until visible single algae.Simultaneously, be provided with negative control group in the conversion process, promptly do not add the conversion operation group of recombinant plasmid, the experimental implementation process of this group is identical.

Step 5, express alpha+γ fused interferon transform the molecular biology identification of algae strain

At first the positive single algae of picking falls from the solid culture plate of screening, and inoculation 5ml PKS liquid nutrient medium test tube was cultivated 7 days.Inoculate the Erlenmeyer flask enlarged culturing by 10% inoculum size then, be cultured to cell concn and reach 10 ⁵Individual/during ml, centrifugal collection salt frond.Utilize Trizol reagent, operate, extract the total RNA that transforms back salt algae, adopt the method for RT-PCR to carry out the amplification of α gene, with integration and the expression of finding out goal gene according to its appended specification sheets.The PCR product is identified through 1% sepharose, can be accessed that specificity is stronger, the gene fragment of big or small accord with expectation (as shown in Figure 7).The presentation of results goal gene has been incorporated in the genome of salt algae, and has obtained effective transcriptional expression.Simultaneously, utilize Western blot that the target protein that merges is carried out the biological activity analysis.The result shows, is that the 40KD place demonstrates special band at molecular weight, explains that the α+γ fused interferon of expressing keeps its natural biological function (as shown in Figure 8).

Step 6, transgenic alga strain are as the application of antiviral in avian viral diseases prevention and treatment

1) acts on the chicken body with cracked transgenic saline frond through water way, carry out antiviral prevention protection experiment

Respectively transgenic saline algae and unconverted wild salt frustule are carried out centrifugal collection, coldcondition adopts ultrasonic grinding down, and parameter is 400W, and broken 10S is 3S at interval, broken 20 times altogether.Cracked salt frond adds in 5% the ratio that accounts for chicken drinking-water volume, joins existing usefulness at present, preferably is controlled in the 0.5-2h and has drunk.Under the condition of normally feeding, give whole day and repeatedly drink water, continuous application 3 days.Select the healthy SPF chicken of 15 ages in days, be divided into three groups at random, 20 every group, establish three groups of repetitions for every group.The A group: the blank group, in the chicken breeding process, give normal general tap water, do not add the salt frustule; The B group: negative control group in the breeding process of chicken, contains the tap water of 5% wild-type salt frond; The C group, the treatment comparative group in the breeding process of chicken, contains the tap water of 5% transgenic saline frond.Used group is on the basis of repeatedly drinking water for three days on end, and the 4th day begins, and three treated animal unifications are thrown something and fed and contained the infectious bursal disease material, and water way such as above-mentioned carrying out were drunk 7 days continuously, write down every group of chicken incidence every day.

Experimental result (as shown in table 1): the sickness rate of blank group and negative control group chicken reaches 100%; The cumulative mortality of the two is respectively 56.5% and 53.5%; And the not morbidity and dead of treatment group chicken; Show that the transgenic saline algae strain through water way effect chicken body, reaches 100% to its Effective Vate of Protection that carries out prophylaxis of viral diseases.

The method of calculation of treatment group protection ratio: protection ratio=(1-treatment group death toll/treatment treated animal sum) * 100%

The method of calculation of blank group mortality ratio: mortality ratio=(blank group death toll/blank treated animal sum) * 100%

The method of calculation of negative control group chicken death rate: mortality ratio=(negative control group death toll/negative control treated animal sum) * 100%

The strain of table 1 transgenic alga is through the antiviral prevention protection experiment of water way to the chicken body

2) directly the transgenic saline frond of live body is admixed feed, the administered through oral mode acts on the duck body, carries out antiviral result of treatment and identifies

Transgenic saline algae and unconverted wild salt algae are carried out centrifugal collection respectively, and the ratio that accounts for feed 5% according to salt frustule weight in wet base is added in the duck feed and is gone, and fully waits behind the mixing to feed.The 5 age in days ducks that suffer from initial stage (infecting in 1 day) viral hepatitis that will pass through laboratory diagnosis are divided into three groups at random, 10 every group, establish three groups of repetitions for every group.A group: the blank group to the duck normal feed of throwing something and feeding, does not add the salt frustule; B group: negative control group, duck thrown something and fed contains the feed of 7% wild-type salt frond; The C group is treated comparative group, and duck is thrown something and fed contains the feed of 7% transgenic saline frond.Used group is divided to throw something and feed for three times every day, throws something and feeds continuously 7 days, writes down every group of chicken incidence every day.

Experimental result (as shown in table 2): the cumulative mortality of blank group and negative control group reaches 87% and 83% respectively; The cumulative mortality of treatment group is about 20%; Show that this α+γ fused interferon has stronger antiviral therapy effect, makes mortality ratio effectively reduce 65%.

The method of calculation of blank group mortality ratio: mortality ratio=(blank group death toll/blank treated animal sum) * 100%

The method of calculation of negative control group mortality ratio: mortality ratio=(negative control group death toll/negative control treated animal sum) * 100%

The method of calculation of treatment group mortality ratio: mortality ratio=(treatment group death toll/treatment treated animal sum) * 100%

Table 2 transgenic alga strain administered through oral mode is identified the antiviral therapy effect of duck body

Step 7, transgenic alga strain are as the application of fodder additives in the bird aquaculture

Get the transgenic saline frustule, after the centrifugal collection, process forms such as Powdered, particulate state and expanded shape under the coldcondition, also can with the mixed of sticky agent gelatin according to 1:1, process the paste fluid form, press 7% amount of feed proportion and add the animal of throwing something and feeding behind the mixing; Also can join in some other fodder additives component: like VITAMINs, inhibitor, protein powder, pharmaceutical compositions etc., and add by 2% amount that accounts for feed behind its mixing, throw something and feed behind the mixing.Use the cultivated animals of this fodder additives, its growth is very fast, weight increase, and the plumage look obviously bright-coloured is, glossy naturally, and meat taste is good, and is delicate smooth.

Described in the present invention salt algae is the common salt algae that do not make a variation, and all can obtain through general salt algae plant or other cell biological laboratories;

Described intestinal bacteria competence is the Bacillus coli communis competence, buys and can obtain through market;

Described pMD18-T cloning vector and pBI-carrier for expression of eukaryon are general carrier, can buy through market to obtain;

The composition of described PKS substratum: contain 1.5 mol sodium-chlor in every liter of PKS substratum, 10 m mol saltpetre, 50 m mol sodium hydrogencarbonates; 5 m mol MAGNESIUM SULPHATE HEPTAHYDRATE 99.5s, 0.4 mmol potassium primary phosphate, 2 μ mol ferric chloride (FeCl36H2O)s; 5 μ mol YD 30s, 7 μ mol, four water manganous chloride, 1 μ mol copper chloride dihydrate; 1 μ mol zinc chloride, 1 μ mol CoCL2,1 μ mol, four water ammonium molybdates; 185 μ mol boric acid, 0.2 mmol calcium chloride _,Surplus is a water;

Described solid is selected the composition of substratum: every liter of substratum contains 1.5 mol sodium-chlor, 10 m mol saltpetre, 50 m mol sodium hydrogencarbonates, 5 m mol MAGNESIUM SULPHATE HEPTAHYDRATE 99.5s; 0.4 the mmol potassium primary phosphate, 2 μ mol ferric chloride (FeCl36H2O)s, 5 μ mol YD 30s; 7 μ mol, four water manganous chloride, 1 μ mol copper chloride dihydrate, 1 μ mol zinc chloride; 1 μ mol CoCL2,1 μ mol, four water ammonium molybdates, 185 μ mol boric acid; 0.2 mmol calcium chloride, 10g agar powder and 3mg grass fourth phosphine, surplus is a water;

The composition of described 20% polyoxyethylene glycol: contain the 20g polyoxyethylene glycol in every 100ml water;

SEQUENCE?LISTING

 

< 110>University Of Science and Technology Of He'nan

 

< 120>one stud birds are with the preparation and the application thereof of pattern of fusion oraferon

 

<130> 1

 

<160> 2

 

<170> PatentIn?version?3.5

 

<210> 1

<211> 576

<212> DNA

< 213>artificial sequence

 

<400> 1

atggctgggc?catcagcccc?accaccacca?gccatctaca?gcatcctggc?gctcacgctc 60

 

ctcctgacgc?ctctcgccaa?cgccgcctcc?tgctgccccc?tgcgcctcca?ccacagcgcc 120

 

ttcttctggg?acagcagcca?gcagctctgc?aacatggctc?ccagccccac?acagccctgc 180

 

ccgcagcaac?acgcgccttg?ctccttcccg?gacaccctcc?tggacaccac?tagcacgcag 240

 

caagccgcac?acaccaccct?ccacctcctc?caacacctct?tcgacaccct?cagcagcccc 300

 

agcacccccg?cgcactggct?ccacaccgca?cgccacgacc?tcctcaacca?gctccagcac 360

 

cacatccacc?acctcgagcg?ctgcttccca?gccgacgcca?cgcgcttcca?caggcgaggg 420

 

ccccgcaacc?ttcacctcag?caccaacaag?tacttcggct?gcatcctaca?cttcatccag 480

 

aacgacaact?acagcccctg?cgcatgggac?cacgtccgcc?tcgaggctca?cgcctgcttc 540

 

cagcgcatcc?accgcctcac?ccgcaccaac?acgtaa 576

 

 

<210> 2

<211> 435

<212> DNA

< 213>artificial sequence

 

<400> 2

atgacttgca?ctacccagac?ttacaacttg?ctcgttgtct?ccgtcatcat?gttttattat 60

 

ggacgaagtg?caagtagtct?aagtcaactt?caacatcaag?tagatatagc?gaaactgaaa 120

 

gctaacttta?gttcaagtga?ttcagctgta?gctgacggtg?ttcctataat?taaagtgaaa 180

 

ctgaagaact?tgagagagga?aaatcagatc?aggatcatac?tgagccagat?tgtttcgttg 240

 

tacatgctaa?agcttgcaaa?catgtacaag?acaaagccgc?acaccaaaca?catatctgag 300

 

gagctctata?ctctgaaaaa?caaccttcct?gatggcgtga?agaaggtgaa?agtgatcctg 360

 

gtcagcatca?aacaggtgct?ggtgaatact?ccgagtttca?aaaggaacat?gagccagtct 420

 

agatgcagat?gttaa 435

 

 

Claims (3)

1. a stud bird is characterized in that with the preparation of pattern of fusion oraferon: its concrete preparation process is following:

1) preparation of fowl α, IFN-gene: design two pairs of Auele Specific Primers respectively: fowl alpha-IFN gene primer sequence is: upstream primer: 5 ' TCTAGAATGGCTGGGCCATCAGCCCC3 ', downstream primer: 5 ' GGATCCCGTGTTGGTGCGGGT 3 ', underscore indication are that the upstream and downstream primer is introduced respectively XbaWith BamThe H restriction enzyme site; The IFN-gene-based because of primer sequence is: upstream primer: 5 ' GGATCCACTTGCACTACCCAGACTTAC3 ', downstream primer: 5 ' GAGCTCTTACGTGTTGGTGCGGGTGA 3 ', underscore indication are that the upstream and downstream primer is introduced respectively BamH with SacRestriction enzyme site, the method through PCR amplifies fowl alpha-IFN gene and fowl IFN-gene respectively then; Fowl alpha-IFN gene sequence such as sequence table sequence 1, fowl IFN-gene order such as sequence table sequence 2;

2) transform salt frustule construction of eukaryotic expression vector: fowl α, IFN-gene fragment through pcr amplification are connected with the pMD18-T cloning vector respectively; Through downcutting α, γ gene fragment respectively after the double digestion evaluation separately and the evaluation of checking order, successively the two gene is connected on the carrier for expression of eukaryon pBI-through the T4 ligase enzyme; The recombinant vectors pBI-α+γ that builds is used for the conversion to the salt frustule;

3) recombinant expression vector transforms the salt frustule: the recombinant plasmid that builds is passed through the granulated glass sphere conversion method, or transform the salt frustule through particle bombardment, electric shocking method, liposome mediated-method or UW importing method; Salt frustule after the conversion selects screening of medium to cultivate through solid, and the final positive that obtains transforms the algae strain; Enlarged culturing is carried out in the positive algae strain of picking, supplies follow-up molecular biology identification used;

4) to transforming the screening and the molecular biology identification of algae strain: the total RNA of genome that extracts the transgenic alga strain; Goal gene to being incorporated in the salt algae genome carries out RT-PCR amplification evaluation; Integrate and expression status in the hope of finding out goal gene; Simultaneously, utilize western blot technology to expressing to such an extent that protein product carries out the biochemical activity analysis;

5) preparation of pattern of fusion oraferon will identify that correct transgenic alga strain is inoculated in natural sea-water algal culture pond by 1% inoculum size, carry out open large-scale cultivation, cultivate 10-14 days, when frustule concentration reaches 10 ⁶Individual/as during ml,, promptly to obtain the pattern of fusion oraferon through quiescent setting or centrifugal collection frond.

2. the prepared fowl of claim 1 is characterized in that: be applied to the prevention or the treatment of avian viral diseases as a kind of antiviral with the application of pattern of fusion oraferon.

3. the prepared fowl of claim 1 is characterized in that: be applied to poultry farming as a kind of functional feedstuff additive with the application of pattern of fusion oraferon.

Images