CN109517775A - The preparation method and application of Larimichthys crocea IFNc gene e. coli expression product - Google Patents
The preparation method and application of Larimichthys crocea IFNc gene e. coli expression product Download PDFInfo
- Publication number
- CN109517775A CN109517775A CN201811362411.XA CN201811362411A CN109517775A CN 109517775 A CN109517775 A CN 109517775A CN 201811362411 A CN201811362411 A CN 201811362411A CN 109517775 A CN109517775 A CN 109517775A
- Authority
- CN
- China
- Prior art keywords
- ifnc
- buffer
- larimichthys crocea
- gene
- coli
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/555—Interferons [IFN]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Gastroenterology & Hepatology (AREA)
- Physics & Mathematics (AREA)
- Toxicology (AREA)
- Plant Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The present invention relates to the preparation methods and application of a kind of Larimichthys crocea IFNc gene e. coli expression product, the present invention passes through molecular biology method, by crocea interferon c(IFNc gene) clone after be connected in coli expression carrier, pass through conversion, inducing expression, recombination expression product is obtained, specifically includes the following steps: the building of gene cloning, recombinant expression carrier, being transformed into Escherichia coli, IPTG induction and the purifying of expression product.Expression product obtained can induce Larimichthys crocea peripheral white blood cells and express antivirus protein gene such as Mx1, PKR and ISG15.
Description
Technical field
The invention belongs to genetic engineering fields, and in particular to a kind of system of Larimichthys crocea IFNc gene e. coli expression product
Preparation Method and application.
Background technique
Interferon (Interferon, IFN) is that one kind can induce vertebrate cells antiviral state, and prevent antiviral
Inductivity multigene family cell factor (the Robertsen B. The interferon system to play an important role in imperial
Of teleost fish [J] Fish Shellfish Immunol, 2006,20 (2): 172-191).Bony fish makees
Also possess the interferon system of comparatively perfect for low vertebrate.Fish IFN points areType IFN andType IFN two major classes,
Middle I type IFN coordinates due to host anti-virus is immunized because of it by more concern (Zhang YB, Gui JF. in specific manner
Molecular regulation of interferon antiviral response in fish [J]. Dev Comp
Immunol, 2012,38 (2): 193-202.).According to the quantity and distribution of cysteine in mature peptide, fish I type IFN divides
For groupIFN(mature peptide contains 2 conservative cysteines) and groupIFN(mature peptide contains 4 half conservative Guangs
Propylhomoserin).Group I IFN includes 4 subgroups of IFNa, IFNd, IFNe and IFNh, group II IFN include IFNb, IFNc and
3 subgroups of IFNf (Ding Y, Ao J, Huang X, Chen X. Identification of two subgroups
of type I IFNs in perciforme fish large yellow croaker Larimichthys crocea
provides novel insights into function and regulation of fish type I IFNs [J].
Front Immunol, 2016, 7:343.)。
Recent research result indicate that in addition to IFNd and IFNh (group I IFN), the white aunt in the Perciformes fish such as Atlantic Ocean
Fish, mandarin fish etc., there is also a kind of group II IFN, IFNc(Milne DJ, Campoverde C, Andree KB,
Chen X, Zou J, Secombes CJ. The discovery and comparative expression analysis
of three distinct type I interferons in the perciform fish, meagre
(Argyrosomus regius) [J]. Dev Comp Immunol, 2018, 84:123-132. Laghari ZA,
Chen SN, Li L, Huang B, Gan Z, Zhou Y, Huo HJ, Hou J, Nie P. Functional,
signalling and transcriptional differences of three distinct type I IFNs in a
perciform fish, the mandarin fish Siniperca chuatsi. Dev Comp Immunol. 2018,
84:94-108).IFNc is in constitutive expression in each detection tissue, after virus or its analog poly I:C induction stimulation
Its expression quantity significantly raises.Atlantic Ocean white Chinese croaker IFNc can induce the expression of itself and Interferon regulatory factor-3 and 7, and show
Out significantly reduce virus titer effect (Milne DJ, Campoverde C, Andree KB, Chen X, Zou J,
Secombes CJ. The discovery and comparative expression analysis of three
distinct type I interferons in the perciform fish, meagre (Argyrosomus regius) [J] Dev Comp Immunol, 2018,84:123-132.).
Summary of the invention
One of the objects of the present invention is to provide can high efficient expression Larimichthys crocea IFNc gene colibacillus engineering.
The second object of the present invention is to provide e. coli expression product and its preparation of a kind of Larimichthys crocea IFNc gene
Method.
The third object of the present invention is to provide the application of Larimichthys crocea IFNc recombinant protein.
To achieve the above object, the present invention adopts the following technical scheme:
A kind of colibacillus engineering of Larimichthys crocea IFNc gene, the engineering bacteria be Escherichia coli (Escherichia coli)
BL21/pET-43.1a-IFNc is preserved in China typical culture collection center on October 22nd, 2018, and deposit number is
CCTCC NO:M 2018697；The address of China typical culture collection center is China, Wuhan, Wuhan University.
A kind of Larimichthys crocea IFNc gene colibacillus engineering has recombinantly expressed nucleotide sequence such as SEQ ID NO.1 institute
The gene shown.
The expression product of Larimichthys crocea IFNc gene Escherichia coli, preparation method the following steps are included:
(1) forward primer IFNc-F and reverse primer IFNc-R is utilized, coding is amplified the 28th to the 189th using round pcr
The Larimichthys crocea IFNc mature peptide genetic fragment of amino acids；
(2) the Larimichthys crocea IFNc mature peptide gene fragment clone for obtaining step (1) is to coli expression carrier pET-
43.1a obtains the recombinant expression carrier pET-43.1a-IFNc of the genetic fragment of IFNc containing Larimichthys crocea；
(3) recombinant expression carrier pET-43.1a-IFNc is converted into e. coli strain bl21, amoxicillin screening and survey
After sequence identification, the e. coli bl21 containing Larimichthys crocea IFNc genetic fragment/pET-43.1a-IFNc engineering bacteria is obtained；Meanwhile
Expression vector pET-43.1a converts e. coli strain bl21, and e. coli bl21/pET-43.1a of acquisition is as control bacterium
Strain；
(4) Escherichia coli pET-43.1a-IFNc engineering bacteria is in LB culture medium through 0.1 mM IPTG of final concentration induction, 16 oC
Shaken cultivation 12 hours, by culture, thalline were collected by centrifugation, and after being resuspended using Buffer A, thallus is collected in ultrasonication respectively
Lysate supernatant precipitating shows that Larimichthys crocea IFNc recombinant protein is after polyacrylamide gel electrophoresis SDS-PAGE analysis
Solubility expression；
(5) utilize the nickel ion metal chelate affinity chromatography medium column purification recombinant protein: be collected by centrifugation e. coli bl21/
Thallus in pET-43.1a-IFNc recombinant object, ice-cold PBS solution washing three times, are then resuspended with Buffer A
Thallus is placed in ultrasonication 15 minutes in mixture of ice and water, and upper prop after supernatant is collected by centrifugation, and 4 oC are combined 30 minutes, used respectively
Buffer B and the Buffer C(of pre-cooling wash column, are finally eluted with Buffer D, obtain Larimichthys crocea IFNc recombinant protein, purifying
Larimichthys crocea IFNc recombinant protein afterwards carries out 3 step dialysis, and finally dialyses through Buffer 1, Buffer 2, Buffer 3 respectively
Into the PBS buffer solution of pH7.4.
The Buffer A includes the reagent of following final concentration: 20 mM Tris-HCl, 150 mM NaCl, 0.5% v/v
Triton X-100 and 30 mM imidazoles, pH7.4；The Buffer B includes the reagent of following final concentration: 20 mM Tris-
HCl, 150 mM NaCl, 0.5% v/v Triton X-100,60 mM imidazoles, pH 7.4；The Buffer C includes following end
The reagent of concentration: 20 mM Tris-HCl, 150 mM NaCl, 60 mM imidazoles, pH 7.4；The Buffer D includes following end
The reagent of concentration: 20 mM Tris-HCl, 500 mM NaCl, 500 mM imidazoles, pH 7.4；The Buffer 1 includes following
The reagent of final concentration: 20 mM Tris-HCl, 150 mM NaCl, 250 mM imidazoles, pH 7.4；The Buffer 2 include with
The reagent of lower final concentration: 20 mM Tris-HCl, 150 mM NaCl, 100 mM imidazoles, pH 7.4；The Buffer 3 includes
The reagent of following final concentration: 20 mM Tris-HCl, 150 mM NaCl, pH 7.4.
The present invention has the advantages that
The e. coli expression product for the Larimichthys crocea IFNc gene that the present invention obtains is the Larimichthys crocea IFNc of about 73 kDa of molecular weight
Recombinant protein, the Larimichthys crocea IFNc recombinant protein is in final concentration of 10 ng/mL, not only in Larimichthys crocea peripheral blood cells and head
The expression of itself and Larimichthys crocea IFNd, IFNh is significantly induced in nephrocyte, also significant up-regulation antiviral gene Mx1, PKR and
The expression of ISG15.Also, the Larimichthys crocea IFNc recombinant protein can significantly inhibit grouper irido virus SGIV gene duplication,
The pathogenic change effect for inhibiting the metainfective grouper spleen cell of SGIV, shows good antiviral effect, for China's water
The prevention and treatment for producing animal virosis has wide application value and market prospects.
Detailed description of the invention
Fig. 1 is the SDS-PAGE analysis of the Larimichthys crocea IFNc recombinant protein of purifying, and wherein M swimming lane is protein molecular weight mark
It is quasi-；1 swimming lane is the Larimichthys crocea IFNc recombinant protein of purifying；The referred to Larimichthys crocea IFNc recombinant protein of arrow;2 swimming lanes are pure
The Nus recombinant protein of change；KD(kilodalton kilodalton) is represented.
Fig. 2 is the tune that Larimichthys crocea IFNc recombinant protein expresses antivirus protein gene in Larimichthys crocea peripheral white blood cells
Section effect；After the Larimichthys crocea IFNc recombinant protein of 10 ng/mL is handled Larimichthys crocea peripheral white blood cells 2,4 and 8 hours, at collection
It manages cell and detects the gene expression dose of wherein antiviral protein Mx1, PKR and ISG15, control using Real-time PCR
Albumen is the Nus recombinant protein of 10 ng/mL；The relative expression levels of said gene are internal reference standard using Larimichthys crocea β-actin
Change, multiple variation be Larimichthys crocea IFNc recombinant protein processing group in gene relative expression levels relative to Nus recombinant protein at
The multiple of gene relative expression levels in reason group.
Fig. 3 is the function of Larimichthys crocea IFNc anti-grouper irido virus in grouper spleen cell；Take 10 ng/mL's
After Larimichthys crocea IFNc recombinant protein pre-processes grouper spleen cell 2 hours, it is inoculated with grouper irido virus；24 is small after infection
When, the morphological change of micro- sem observation grouper spleen cell；Meanwhile the collection cell training in 12,24 and 48 hours after infection
Object is supported, and using Real-time PCR detection grouper irido virus Gene MCP, VP19, VP136 and ICP18 in grouper spleen
Expression in dirty cell；Reference protein is the Nus recombinant protein of 10 ng/mL；The relative expression levels of said gene utilize
Grouper β-actin is internal reference standardization, and multiple variation is gene relative expression in Larimichthys crocea IFNc recombinant protein processing group
Horizontally relative to the multiple of gene relative expression levels in Nus recombinant protein processing group.In triplicate, asterisk represents for every group of experiment
Statistical analysis has significant difference,* P < 0.05,** P< 0.01。
Specific embodiment
A kind of acquisition of the Larimichthys crocea IFNc gene cDNA of embodiment 1
Using the IFNc sequence and Larimichthys crocea genome (JRPU00000000) of other fish, predict to obtain after sequence alignment
Larimichthys crocea IFNc gene order.According to the Larimichthys crocea IFNc gene coded sequence design primer of prediction, it is polymerize with the primer
Enzyme chain reaction obtains the coding region sequence of Larimichthys crocea IFNc gene.570 nucleotide of the sequence encode one by 189
The protein of amino acid composition.
Shown in the Larimichthys crocea IFNc gene cDNA and its amino acid sequence SEQ ID NO.1 of deduction；Wherein, coding
1-27 amino acids are the Larimichthys crocea IFNc signal peptide of prediction.
A kind of acquisition of the Larimichthys crocea IFNc gene cDNA of embodiment 2
1. the building of the recombinant expression carrier BL21/pET-43.1a-IFNc of the gene of IFNc containing Larimichthys crocea
(1) PCR amplification of Larimichthys crocea IFNc mature peptide genetic fragment: anamorphic zone restrictive endonuclease EcoR I site
Forward primer IFNc-F:GGAATTCTGTCAGCTGGAAGGAGATC and reverse primer IFNc- with the site Hind III
R: CCCAAGCTTTTAGTGGACACCTCTCC；Use the PrimeSTAR of TAKARA company®HS DNA Polymerase is pressed
Book carries out PCR amplification, PCR system as directed are as follows:
PCR program is as follows:
Pcr amplification product carries out 1.5% agarose gel electrophoresis, deposition condition: 120 volts of voltage, the time 15 minutes.Use gel
Imager observation a, it is seen that size is the band of 570 nucleotide, is consistent with expection, then with the recycling examination of Omega company glue
Agent box recycles pcr amplification product.
(2) endonuclease reaction: the pcr amplification product and escherichia coli prokaryotic expression carrier pET-43.1a of recycling carry out respectively
Restriction endonuclease EcoR I and HindIII double digestion, endonuclease reaction system:
Digestion condition: 37 oC react 3 hours.Digestion products are recycled using Omega company plastic recovery kit.
(3) connection reaction: pcr amplification product and pET- after connecting double digestion using 4 DNA ligase of TAKARA company's T
43.1a carrier, linked system are as follows:
Reaction condition: 16 oC react 4 hours.
(4) connection product converts Invitrogen company Escherichia coliE.coli TOP10 competent cell, through bacterium colony PCR
Screening positive clone after expanding culture, extracts plasmid, and sequence verification using Omega company small amount plasmid extraction kit, from
And obtain the recombinant expression carrier pET-43.1a-IFNc of the genetic fragment of IFNc containing Larimichthys crocea.
2. the building of e. coli bl21/pET-43.1a-IFNc engineering bacteria
The recombinant expression plasmid pET-43.1a-IFNc of Larimichthys crocea IFNc genetic fragment conversion e. coli bl21 impression will be contained
Bacterium solution after conversion is coated on the LB plate containing 100 μ g/mL ampicillins by state cell, and 37 oC stationary cultures 16 are small
When, single colonie is grown, the e. coli bl21 containing Larimichthys crocea IFNc gene/pET-43.1a-IFNc engineering bacteria is obtained.
Culture medium prescription:
LB liquid medium: 10 g/L peptones, 5 g/L yeast extracts and 10 g/L sodium chloride.
LB plate: 10 g/L peptones, 5 g/L yeast extracts, 10 g/L sodium chloride and 15 g/L agar powders.
3 Larimichthys crocea IFNc gene of embodiment is purified in expression in escherichia coli and its expression product
1. the inducing expression and SDS-PAGE of Larimichthys crocea IFNc recombinant protein are analyzed
By the e. coli bl21 of above-mentioned building/pET-43.1a-IFNc engineering bacteria, picking single colonie is seeded to 5 mL containing 100 μ
In the LB liquid medium of g/mL ampicillin, 37 oC, 180 revs/min of overnight shaking cultures.Second day by volume 1:
100 ratios are inoculated in the LB liquid medium of 100 mL, 100 μ g/mL ampicillin containing final concentration, 37 oC, 180 turns/
Minute shaken cultivation.To culture OD600When to 0.4 ~ 0.5, it is added the IPTG inducible protein expression of final concentration of 0.1 mM, 37
DEG C continue shaken cultivation 4 hours, culture is centrifuged, collect thallus.
It is resuspended the thallus collected with 10 mL Buffer A, ultrasonication 10 minutes, then by lysate in 4 oC, 12000
Rev/min, it is centrifuged 20 minutes, collects lysate supernatant, and cracking liquid precipitate is resuspended with 10 mL Buffer A.Cellular lysate
Liquid, cellular lysate liquid supernatant, cellular lysate liquid precipitate respectively take 50 μ L, and isometric protein electrophoresis sample-loading buffer, boiling water is added
It boils 10 minutes, carries out concentration then as the SDS-PAGE electrophoresis of 15%(w/v).The results show that control strain BL21/pET-43.1a
Cellular lysate liquid in there is the protein band of 73 kDa of a treaty or so, be empty carrier pET-43.1a expressed by recombination
Albumen Nus.And then there is a treaty 100 in e. coli bl21/pET-43.1a-IFNc engineering bacteria cellular lysate liquid
The protein band of kDa or so illustrates that Larimichthys crocea IFNc recombinant protein is expressed in Escherichia coli.Rheum officinale is found simultaneously
During fish IFNc recombinant protein is primarily present in cellular lysate liquid supernatant, illustrate Larimichthys crocea IFNc recombinant protein in Escherichia coli
It is mainly solubility expression in BL21/pET-43.1a-IFNc engineering bacteria.It is subsequent to use soluble protein purification process based on this
Larimichthys crocea IFNc recombinant protein is purified.
Buffer A:20 mM Tris-HCl, 150 mM NaCl, 0.5%v/v Triton X-100 and 30 mM imidazoles,
pH 7.4
2. affinity chromatography purifies Larimichthys crocea IFNc recombinant protein
Recombination egg is carried out referring to the method that Invitrogen company nickel ion metal chelate affinity chromatography medium (Ni-NTA) is recommended
White purifying: 4 oC first, 5000 revs/min centrifugation 10 minutes collect 100 mL IPTG induction after e. coli bl21/
Thallus is resuspended with l0m LBuffer A in pET-43.1a-IFNc engineering bacteria thallus, and ultrasonication 15 minutes, then 4 oC,
12000 revs/min, it is centrifuged 0 minute collection cellular lysate liquid supernatant of l.
Column first is filled with l mL nickel ion metal chelate affinity chromatography medium, column is washed with 5 times of column volume distilled waters, adds 5
Times column volume Buffer A balances chromatographic column, and after liquid flow is net, the supernatant upper prop that will be collected in above-mentioned steps, 4 oC are incubated for 30
Minute.Column is washed with 10 mL Buffer B and Buffer C, washes respectively in sequence 5 times, washes away unbonded foreign protein.It uses again
1mL Buffer C elution destination protein, repeated collection 5 times.Meanwhile Nus recombinant protein is purified by identical method.
Buffer B:20 mM Tris-HCl, 150 mM NaCl, 0.5% Triton X-100 and 60 mM imidazoles, pH
7.4。
Buffer C:20 mM Tris-HCl, 150 mM NaCl and 60 mM imidazoles, pH 7.4.
Buffer D:20 mM Tris-HCl, 500 mM NaCl and 500 mM imidazoles, pH 7.4.
3. Larimichthys crocea IFNc recombinant protein is dialysed
Larimichthys crocea IFNc recombinant protein after purification carries out 3 step dialysis through Buffer 1, Buffer 2, Buffer 3 respectively, and
Into PBS(pH7.4), every step is not less than 4 hours for final dialysis.After dialysis, 4 oC, 12000 revs/min remove for centrifugation 30 minutes
Precipitating, while passing through identical method dialysis Nus recombinant protein.A small amount of progress SDS-PAGE electrophoretic analysis is taken, as the result is shown
The higher Larimichthys crocea IFNc recombinant protein of purity and Nus recombinant protein (Fig. 1) are arrived, remaining to be stored in -70 oC spare.
Buffer 1:20 mM Tris-HCl, 150 mM NaCl, 250 mM imidazoles, pH 7.4.
Buffer 2:20 mM Tris-HCl, 150 mM NaCl, 100 mM imidazoles, pH 7.4.
Buffer 3:20 mM Tris-HCl, 150 mM NaCl, pH 7.4.
4 Larimichthys crocea IFNc recombinant protein of embodiment analyzes Larimichthys crocea antiviral protein induced activity
(1) by Larimichthys crocea peripheral white blood cells with 1 × 106The cell density of a/mL is inoculated in 6 porocyte culture plates, every hole 2
ML Leibovitz's L15 culture medium (Gibico company), is incubated overnight in 25 oC biochemical cultivation cases.
(2) Larimichthys crocea IFNc recombinant protein is added in cell culture medium to final concentration of 10 ng/mL, after processing
2,4 and 8 hours collection cell cultures, using micro RNA extracts kit (SV total RNA Isolation System,
Promega company) cell total rna is extracted, and according to reverse transcriptase M-MLV(RNaseH, Takara company) specification progress is instead
Transcribe PCR.Meanwhile it is negative control group that the cell that Nus recombinant protein is handled, which is arranged,.
(3) by real-time fluorescence quantitative PCR (Real-time PCR) detect antivirus protein gene such as Mx1, PKR and
Expression of the ISG15 in Larimichthys crocea peripheral white blood cells.Real-time PCR is in Mastercycler ep gradient
Realplex4 fluorescence quantitative PCR instrument (Eppendorf company) is reacted, and condition is as follows: 95 oC initial denaturation, 30 s；95 ºC
5 s are denaturalized, 58 oC annealing 15 s, 72 oC extend 15 s and simultaneously obtain fluorescence, 40 circulations.Using β-actin as reference gene.
Each gene primer is as shown in table 1.Experimental result uses 2-ΔΔCTMethod is analyzed.
The results show that after the processing of Larimichthys crocea IFNc recombinant protein, Larimichthys crocea antiviral protein Mx1, PKR and ISG15's
Gene expression dose is significantly raised in Larimichthys crocea peripheral blood cells, and 4 hours after induction peak, and respectively compare
17.3 times, 5.4 times and 7.5 times (Fig. 2) of group.
Each gene primer table of 1 real-time fluorescence quantitative PCR of table
The antiviral activity of 5 Larimichthys crocea IFNc recombinant protein of embodiment is analyzed
(1) by grouper spleen cell with 1 × 106The cell density in a/hole is inoculated in 6 porocyte culture plates, every 2 mL of hole
Leibovitz's L15 culture medium (Gibico company), in 28 oC biochemical cultivation case culture 18 hours.
(2) Larimichthys crocea IFNc recombinant protein is added in cell culture medium to final concentration of 10 ng/mL, stationary incubation.2 is small
Shi Hou is inoculated with grouper irido virus with the ratio that infection multiplicity is 2.24 hours after infection, micro- sem observation grouper spleen
The cytopathicity change effect of cell.The cell that the processing of Nus recombinant protein is arranged is negative control group.
(3) simultaneously, 12,24 and 48 hours collection cell cultures after infection, use micro RNA extracts kit (SV
Total RNA Isolation System, Promega company) cell total rna is extracted, and according to reverse transcriptase M-MLV
(RNaseH, Takara company) specification carries out reverse transcription PCR.The cell that the processing of Nus recombinant protein is arranged is negative control
Group.
(4) by real-time fluorescence quantitative PCR (Real-time PCR) detect grouper irido virus Gene MCP, VP19,
Expression of the VP136 and ICP18 in grouper spleen cell.Real-time PCR is in Mastercycler ep
Gradient realplex4 fluorescence quantitative PCR instrument (Eppendorf company) is reacted, and condition is as follows: 95 oC initial denaturations 30
s；95 oC are denaturalized 5 s, and 58 oC annealing 15 s, 72 oC extend 15 s and simultaneously obtain fluorescence, 40 circulations.With grouper β-actin
As reference gene.The variation of its multiple is gene relative expression levels in Larimichthys crocea IFNc recombinant protein processing group relative to Nus
The multiple of gene relative expression levels in recombinant protein processing group.In triplicate, asterisk, which represents statistical analysis, to be had for every group of experiment
Significant difference,* P < 0.05,** P< 0.01.Each gene primer is as shown in table 2.Experimental result uses 2-ΔΔCTMethod is analyzed.
Each gene primer table of 2 real-time fluorescence quantitative PCR of table
Microscope, which is seen, to be looked into the results show that Larimichthys crocea IFNc recombinant protein can protect the grouper spleen of inoculation grouper irido virus
Cell.It shows as the shrinkage of Nus recombinant protein control group most cells to be rounded, and significantly cell plaque occurs.And rheum officinale
Fish IFNc recombinant protein group cellular morphology is more complete, without obvious plaque (Fig. 3 A).Real-time PCR is as the result is shown in rheum officinale
Fish IFNc recombinant protein processing after, grouper irido virus Gene MCP, VP19, VP136 and ICP18 gene expression dose exist
(Fig. 3 B) is suppressed significantly in grouper spleen cell.Show that Larimichthys crocea IFNc recombinant protein has apparent antiviral functions.
The foregoing is merely presently preferred embodiments of the present invention, all equivalent changes done according to scope of the present invention patent with
Modification, is all covered by the present invention.
SEQUENCE LISTING
<110>University Of Agriculture and Forestry In Fujian
<120>preparation method and application of Larimichthys crocea IFNc gene e. coli expression product
<130> 21
<160> 21
<170> PatentIn version 3.3
<210> 1
<211> 570
<212> DNA
<213>artificial sequence
<400> 1
atgacacttc agtcctcttc agtcctcctt gtcctcttgc agttctacag cctcaagctg 60
atggtggctg ccatgccgac ctgtcagctg gaaggagatc tggtccagtc ggcccaccac 120
ctgctcagag acctgggggc agattttcct gaacactgcc tgccgtacaa cgccaacatc 180
tcctttccaa gctctgcctt ccctgctgcc acagccaatc atcctcagtg ccacaaatca 240
ttatgggtgg tgcatgagtc cctgcgggag gcggggctag tattccagga caatgacata 300
cctgtcggag agggcggagt cacctggaac gaccagaaac tcgaagactt ccagaacttg 360
cagtaccgac tggtggagga agggagctgt ctgtccagtg tcaatggttc aggtgttttg 420
tcgtcttact tcagtaacgt gacggcagtt cttcaagagc aggacagtgc tgcctgtggc 480
tggatggctc tgaggagaga tctgctctgg gtcttaaagt ctgccctgca gaaacaccgc 540
acctgcttta cctggagagg tgtccactaa 570
<210> 2
<211> 26
<212> DNA
<213>artificial sequence
<400> 2
ggaattctgt cagctggaag gagatc 26
<210> 3
<211> 26
<212> DNA
<213>artificial sequence
<400> 3
cccaagcttt tagtggacac ctctcc 26
<210> 4
<211> 21
<212> DNA
<213>artificial sequence
<400> 4
tgttgcacta gggcagaaga g 21
<210> 5
<211> 21
<212> DNA
<213>artificial sequence
<400> 5
gaagcaggga gttcagcttc t 21
<210> 6
<211> 20
<212> DNA
<213>artificial sequence
<400> 6
gcacagaaga taggctcggt 20
<210> 7
<211> 20
<212> DNA
<213>artificial sequence
<400> 7
tgtctgacga actggtgtgg 20
<210> 8
<211> 20
<212> DNA
<213>artificial sequence
<400> 8
tgctggatgg aaagacccac 20
<210> 9
<211> 20
<212> DNA
<213>artificial sequence
<400> 9
atcagcagag agacccgaga 20
<210> 10
<211> 21
<212> DNA
<213>artificial sequence
<400> 10
gacctgacag actacctcat g 21
<210> 11
<211> 20
<212> DNA
<213>artificial sequence
<400> 11
ctccttcctg acctctccgt 20
<210> 12
<211> 20
<212> DNA
<213>artificial sequence
<400> 12
gcacgcttct ctcaccttca 20
<210> 13
<211> 19
<212> DNA
<213>artificial sequence
<400> 13
aacggcaacg ggagcacta 19
<210> 14
<211> 20
<212> DNA
<213>artificial sequence
<400> 14
cttgatgacg gaagcgtggt 20
<210> 15
<211> 23
<212> DNA
<213>artificial sequence
<400> 15
tgtcagagga cttggagaag gag 23
<210> 16
<211> 19
<212> DNA
<213>artificial sequence
<400> 16
gatgctgccg tgtgaactg 19
<210> 17
<211> 20
<212> DNA
<213>artificial sequence
<400> 17
gcacatcctt ggtggtgttg 20
<210> 18
<211> 19
<212> DNA
<213>artificial sequence
<400> 18
atcggatcta cgtggttgg 19
<210> 19
<211> 19
<212> DNA
<213>artificial sequence
<400> 19
ccgtcgtcgg tgtctattc 19
<210> 20
<211> 20
<212> DNA
<213>artificial sequence
<400> 20
tacgagctgc ctgacggaca 20
<210> 21
<211> 20
<212> DNA
<213>artificial sequence
<400> 21
ggctgtgatc tccttctgca 20
Claims (5)
1. a kind of colibacillus engineering of Larimichthys crocea IFNc gene, which is characterized in that the engineering bacteria is Escherichia coli
(Escherichia coli) BL21/pET-43.1a-IFNc, Chinese Typical Representative culture is preserved on October 22nd, 2018
Collection, deposit number are CCTCC NO:M 2018697.
2. a kind of Larimichthys crocea IFNc gene colibacillus engineering according to claim 1, which is characterized in that recombinant expression
Nucleotide sequence gene as shown in SEQ ID NO.1.
3. a kind of expression product of Larimichthys crocea IFNc gene Escherichia coli as claimed in claim 1 or 2, which is characterized in that system
Preparation Method the following steps are included:
(1) forward primer IFNc-F and reverse primer IFNc-R is utilized, coding is amplified the 28th to the 189th using round pcr
The Larimichthys crocea IFNc mature peptide genetic fragment of amino acids；
(2) the Larimichthys crocea IFNc mature peptide gene fragment clone for obtaining step (1) is to coli expression carrier pET-
43.1a obtains the recombinant expression carrier pET-43.1a-IFNc of the genetic fragment of IFNc containing Larimichthys crocea；
(3) recombinant expression carrier pET-43.1a-IFNc is converted into e. coli strain bl21, amoxicillin screening and survey
After sequence identification, the e. coli bl21 containing Larimichthys crocea IFNc genetic fragment/pET-43.1a-IFNc engineering bacteria is obtained；Meanwhile
Expression vector pET-43.1a converts e. coli strain bl21, and e. coli bl21/pET-43.1a of acquisition is as control bacterium
Strain；
(4) Escherichia coli pET-43.1a-IFNc engineering bacteria is in LB culture medium through 0.1 mM IPTG of final concentration induction, 16 oC
Shaken cultivation 12 hours, by culture, thalline were collected by centrifugation, and after being resuspended using Buffer A, thallus is collected in ultrasonication respectively
Lysate supernatant precipitating shows that Larimichthys crocea IFNc recombinant protein is after polyacrylamide gel electrophoresis SDS-PAGE analysis
Solubility expression；
(5) utilize the nickel ion metal chelate affinity chromatography medium column purification recombinant protein: be collected by centrifugation e. coli bl21/
Thallus in pET-43.1a-IFNc recombinant object, ice-cold PBS solution washing three times, are then resuspended with Buffer A
Thallus is placed in ultrasonication 15 minutes in mixture of ice and water, and upper prop after supernatant is collected by centrifugation, and 4 oC are combined 30 minutes；It uses respectively
Buffer B and the Buffer C of pre-cooling wash column, are finally eluted with Buffer D, obtain Larimichthys crocea IFNc recombinant protein, after purification
Larimichthys crocea IFNc recombinant protein respectively through Buffer 1, Buffer 2, Buffer 3 carry out 3 step dialysis, and finally dialyse to
In the PBS buffer solution of pH7.4.
4. the expression product of Larimichthys crocea IFNc gene Escherichia coli according to claim 3, which is characterized in that the Buffer
A includes the reagent of following final concentration: 20 mM Tris-HCl, 150 mM NaCl, 0.5%v/v Triton X-100 and 30 mM
Imidazoles, pH7.4；The Buffer B includes the reagent of following final concentration: 20 mM Tris-HCl, 150 mM NaCl, 0.5%
V/v Triton X-100,60 mM imidazoles, pH 7.4；The Buffer C includes the reagent of following final concentration: 20 mM
Tris-HCl, 150 mM NaCl, 60 mM imidazoles, pH 7.4；The Buffer D includes the reagent of following final concentration: 20 mM
Tris-HCl, 500 mM NaCl, 500 mM imidazoles, pH 7.4；The Buffer 1 includes the reagent of following final concentration: 20 mM
Tris-HCl, 150 mM NaCl, 250 mM imidazoles, pH 7.4；The Buffer 2 includes the reagent of following final concentration: 20 mM
Tris-HCl, 150 mM NaCl, 100 mM imidazoles, pH 7.4；The Buffer 3 includes the reagent of following final concentration: 20 mM
Tris-HCl, 150 mM NaCl, pH 7.4.
5. a kind of application of the expression product of Larimichthys crocea IFNc gene Escherichia coli as described in claim 3 or 4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811362411.XA CN109517775B (en) | 2018-11-15 | 2018-11-15 | Preparation method and application of large yellow croaker IFNc gene escherichia coli expression product |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811362411.XA CN109517775B (en) | 2018-11-15 | 2018-11-15 | Preparation method and application of large yellow croaker IFNc gene escherichia coli expression product |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109517775A true CN109517775A (en) | 2019-03-26 |
| CN109517775B CN109517775B (en) | 2021-02-26 |
Family
ID=65777889
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811362411.XA Active CN109517775B (en) | 2018-11-15 | 2018-11-15 | Preparation method and application of large yellow croaker IFNc gene escherichia coli expression product |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109517775B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112759637A (en) * | 2020-12-03 | 2021-05-07 | 广东海大畜牧兽医研究院有限公司 | Mandarin fish interferon gene, interferon protein mIFN, and preparation method and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102559695A (en) * | 2011-11-16 | 2012-07-11 | 集美大学 | Pseudosciaena crocea interferon (IFN) gene and cloning method thereof |
-
2018
- 2018-11-15 CN CN201811362411.XA patent/CN109517775B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102559695A (en) * | 2011-11-16 | 2012-07-11 | 集美大学 | Pseudosciaena crocea interferon (IFN) gene and cloning method thereof |
Non-Patent Citations (2)
| Title |
|---|
| DING Y等: "Identification of two subgroups of type I IFNs in perciforme fish large yellow croaker Larimichthys crocea provides novel insights into function and regulation of fish type I IFNs.", 《FRONT IMMUNOL》 * |
| 李蝉，等: "大黄鱼（Larimichthys crocea）I型干扰素基因的特征与表达分析", 《海洋与湖沼》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112759637A (en) * | 2020-12-03 | 2021-05-07 | 广东海大畜牧兽医研究院有限公司 | Mandarin fish interferon gene, interferon protein mIFN, and preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109517775B (en) | 2021-02-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111690054B (en) | Pinctada martensii Kunitz type serine protease inhibitor gene, encoded protein and application | |
| CN108314714B (en) | Verticillium dahliae secretory protein elicitor VdPE L1 and application thereof | |
| CN102304516B (en) | Pichia pastoris expression product of scygonadin and preparation method thereof | |
| CN104593388B (en) | Crucian herpesvirus disease JDORF25 vaccine as well as preparation method and application thereof | |
| CN110551732A (en) | Trachinotus ovatus antimicrobial peptide LEAP-2 gene and application thereof | |
| CN109627316B (en) | Grass carp IFN-gamma 2 gene, recombinant protein coded by same and application of gene | |
| CN108396030B (en) | Lifobinopenaeus antibacterial peptide gene Lv-BigPEN and recombinant protein and application thereof | |
| CN110982822A (en) | Procambarus clarkii anti-lipopolysaccharide factor gALF1 gene, gALF1 protein coded by same and application thereof | |
| KR970002670B1 (en) | Feline interferon and process for production thereof | |
| CN109517775A (en) | The preparation method and application of Larimichthys crocea IFNc gene e. coli expression product | |
| CN102993278B (en) | Purification method of methicillin-resistant staphylococcus aureus (MRSA) vaccine recombinant protein antigen FnbA1 | |
| CN105219788B (en) | The application of nematicidal albumen NEL in thuringiensis YBT1520 | |
| Li et al. | Characterization and functional study on Octopus ocellatus interleukin-17 | |
| CN114316012B (en) | Immune protein for resisting bacterial infection of koi and application | |
| CN108379559A (en) | Application of the grass carp interferon 1 in preparing antibacterials | |
| CN112402598A (en) | General subunit vaccine for riemerella anatipestifer infection | |
| CN110317813A (en) | Portunus trituberculatus Miers c-type agglutinin PtCLec2 gene and its coding albumen and application | |
| CN106929460A (en) | Large yellow croaker IL-17 C2 gene e. coli expression products and preparation method and application | |
| CN109438567A (en) | A kind of sturgeon anti pathologic immunity albumen and its preparation method and application | |
| CN111019952B (en) | Antifungal gene, polypeptide, recombinant protein, preparation method and application thereof | |
| CN111690636B (en) | Trypsin-like serine protease gene, encoded protein and application | |
| CN103215274A (en) | Epinephelus coioides interferon IFNgamma2 and preparation method and application thereof | |
| CN110437328B (en) | Porcine interferon alpha mutant YNS and preparation method and application thereof | |
| CN113121672A (en) | Soluble prokaryotic expression and purification method of cat interferon gamma and application | |
| CN109134629B (en) | Botrytis cinerea secretory protein elicitor BcXyl1 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20190326 Assignee: Fuzhou Elite Biotechnology Co.,Ltd. Assignor: FUJIAN AGRICULTURE AND FORESTRY University Contract record no.: X2021350000002 Denomination of invention: Preparation and application of E.coli Expression Product of ifnc gene of Pseudosciaena crocea Granted publication date: 20210226 License type: Common License Record date: 20210624 |