CN111019952B

CN111019952B - Antifungal gene, polypeptide, recombinant protein, preparation method and application thereof

Info

Publication number: CN111019952B
Application number: CN202010155170.2A
Authority: CN
Inventors: 杨顶珑; 薛蕊; 赵建民
Original assignee: Yantai Institute of Coastal Zone Research of CAS
Current assignee: Yantai Institute of Coastal Zone Research of CAS
Priority date: 2020-03-09
Filing date: 2020-03-09
Publication date: 2020-06-26
Anticipated expiration: 2040-03-09
Also published as: CN111019952A

Abstract

The invention provides an antifungal gene, polypeptide, recombinant protein, and a preparation method and application thereof, wherein the antifungal gene is a Ruditapes philippinarum antifungal Rpmacin gene, and the nucleotide sequence of the gene is shown in SEQ ID No. 1; the amino acid sequence of the polypeptide is shown as SEQ ID NO. 2; the recombinant protein contains antifungal genes and expresses antifungal polypeptides. The invention has the beneficial effects that: the antifungal gene, the polypeptide and the recombinant protein can be applied to producing antibacterial drugs, vaccines or feed additives for vegetables, livestock and aquatic products, and have wide application prospect; the gene, the polypeptide, the recombinant protein, the preparation method and the application thereof can provide a foundation for further researching the immune defense mechanism of the Ruditapes philippinarum and lay a foundation for disease control, genetic breeding and feed additive research of the Ruditapes philippinarum.

Description

Antifungal gene, polypeptide, recombinant protein, preparation method and application thereof

Technical Field

The invention belongs to the technical field of biological gene engineering, relates to an antifungal shellfish polypeptide, a preparation method and application thereof, and particularly relates to an antifungal gene, a polypeptide, a recombinant protein, a preparation method and application thereof.

Background

Antimicrobial peptides (AMPs) are a class of endogenous small-molecule peptide active substances, directly participate in killing and eliminating infected pathogenic microorganisms, are important effector molecules of invertebrate innate immunity, and are receiving more and more attention as substitutes of traditional antibiotics. Because the AMPs are endogenous micromolecular polypeptides, AMPs have a series of advantages of no pollution, no antigenicity, strong pertinence, thermal stability, broad-spectrum antibiosis and the like, and have important application prospects in the research and development of disease-resistant feed additives, so that the research on AMPs becomes one of the most active fields.

Researchers have isolated a variety of AMPs encoding genes from prokaryotes and eukaryotes, which vary widely in structure and size. In different species, AMPs with different structures constitute a pool of AMPs to combat pathogens collectively. A variety of AMPs have been reported in marine invertebrates for structural and functional purposes, e.g., from two species of musselMytilus galloprovincialisAndMytilus edulis4 kinds of cationic cysteine AMPs are successfully separated, and are defensin-like polypeptides MGD-1 and MGD-2, myticins, mytilins (containing 8 cysteine residues) and mytimycins.

Macin is also a member of the large family of cysteine-rich cationic AMPs, originally isolated from the invertebrate leech. In leeches, it is usually expressed in immune-related tissues, such as neurons, and synthesis of the Macin protein is involved in immune responses and regeneration of the central nervous system. The research on the antibacterial mechanism and action mode of the leech Macin protein discovers that the initial antibacterial step is the aggregation of bacterial cells, the subsequent precipitation and the final lipopeptide interaction through electrostatic interaction and hydrophobic interaction. To date, only a few Macins have been reported in mollusks, e.g.Hyriopsis cumingiiAndMytilus galloprovincialishowever, the research on the function and antibacterial mechanism of marine bivalves Macin has not been studied deeply.

Ruditapes philippinarum (A)Ruditapes philippinarum) Is one of the cultured shellfish with the highest single yield in China, is one of the most common species of bivalves in the phylum mollusca, and is always an important research object for the research in multiple fields of evolution, development, ecological toxicology and the like. However, in recent years, a large number of deaths occur in Ruditapes philippinarum cultivation, which is mainly the result of the comprehensive action of factors such as pathogen invasion and environmental deterioration, so that the identification of immune molecules of Ruditapes philippinarum is urgently needed, and a basis is provided for disease control and health management of the cultivation industry.

Aiming at the problems, the invention provides a Ruditapes philippinarum antifungal Rpmacin gene, polypeptide and recombinant protein as well as a preparation method and application thereof by taking Ruditapes philippinarum as a research object, and provides a brand-new method for solving the problems of serious diseases of the current aquaculture, ecological damage caused by abuse of antibiotics, drug residues of aquatic products and the like.

Disclosure of Invention

In order to make up the defects of the prior art, the invention provides an antifungal gene, polypeptide and recombinant protein, and a preparation method and application thereof, and provides a brand-new method for solving the problems of serious disease of current aquaculture, ecological damage caused by abuse of antibiotics, food drug residue and the like.

The invention provides an antifungal gene, which is a Ruditapes philippinarum antifungal Rpmacin gene, wherein the cDNA full-length nucleotide sequence of the gene is 691 bp, the open reading frame of the gene is 258 bp, 85 amino acids are coded, the 5 'non-coding region is 46bp in length, the 3' non-coding region is 387 bp in length, and a poly A tail is arranged; the nucleotide sequence of the antifungal Rpmacin gene is shown as SEQ ID number 1.

Further, the preparation method of the cDNA full-length nucleotide sequence of the antifungal gene comprises the following steps:

(1.1) cDNA Synthesis: extracting total RNA of Ruditapes philippinarum, purifying and reverse transcribing to obtain cDNA;

(1.2) generating a full-length cDNA of the antifungal gene: designing a primer, and constructing a gene library by using a PCR method; performing large-scale EST sequencing on the gene library to identify an Rpmacin EST gene; and generating the full-length cDNA of the antifungal gene by adopting a nested PCR strategy.

The invention also provides an antifungal polypeptide, and the amino acid sequence of the polypeptide is shown as SEQ ID number 2.

The invention also provides an antifungal recombinant protein, which contains the antifungal gene and expresses the antifungal polypeptide.

The invention also provides a preparation method of the antifungal recombinant protein, which comprises the following steps:

(2.1) obtaining of recombinant expression vector: connecting the Ruditapes philippinarum antifungal Rpmacin gene to a prokaryotic expression vector to obtain a recombinant expression vector;

(2.2) obtaining crude protein: transforming the recombinant expression vector to escherichia coli BL21(DE3) plysS, and obtaining a prokaryotic in-vitro recombinant expression protein crude product after induction expression;

(2.3) protein purification and renaturation: purifying the prokaryotic in-vitro recombinant expression protein crude product by nickel column affinity chromatography and dialyzing for renaturation to obtain the antifungal recombinant protein.

Further, the prokaryotic expression vector in the step (2.1) is pET30a (+).

The invention also provides an application of the antifungal gene, namely the antifungal gene is applied to the field of preparing antibacterial drugs, vaccines or feed additives.

The invention also provides application of the antifungal polypeptide, namely the application of the antifungal polypeptide in the field of preparing antibacterial drugs, vaccines or feed additives.

The invention also provides application of the antifungal recombinant protein, namely the antifungal recombinant protein is applied to the field of preparing antibacterial drugs, vaccines or feed additives.

The antifungal gene, the polypeptide and the recombinant protein provided by the invention, and the preparation method and the application thereof have the following advantages:

① the invention provides an antifungal gene, polypeptide, recombinant protein and their preparation method, which can be used in shellfish feed additive, antiviral drug, and vaccine development;

② the antifungal gene of the invention has cDNA full length of 691 bp, 85 amino acids encoded by open reading frame, presumed protein molecular weight of 9.48 kDa, theoretical isoelectric point of 5.18, prokaryotic recombinant expression vector pET30a (+) -Rpmacin constructed by the invention is transformed into Escherichia coli expression strain DE3 to obtain strain which stably expresses Rpmacin recombinant protein, and the recombinant protein with bioactivity is obtained after expression, purification and renaturation, and the biological function is verified in vitro, and the recombinant protein is identified to have good antifungal activity.

③ the antifungal gene, polypeptide and recombinant protein provided by the invention can be applied to the production of vegetable, livestock and aquatic antibacterial drugs, vaccines or feed additives, and have wide application prospects.

④ the invention provides an antifungal gene, polypeptide, recombinant protein, its preparation method and application, which can provide a foundation for further research on the immune defense mechanism of Ruditapes philippinarum, and lay a foundation for disease control, genetic breeding and feed additive research of Ruditapes philippinarum.

Drawings

FIG. 1 is a diagram showing the alignment of amino acids translated from CDS region of an antifungal gene with other species Macin proteins in example 1 of the present invention;

FIG. 2 is a graph showing the results of the induction of expression, purification and Western Blot of an antifungal recombinant protein in example 2 of the present invention; wherein Line1 and Line 2 represent recombinant proteins induced and expressed by IPTG, Line3 represents purified recombinant proteins, and Line4 represents Western Blot detection results of the recombinant proteins;

FIG. 3 is a graph showing the bactericidal kinetics of yeast by an antifungal recombinant protein in example 3 of the present invention;

FIG. 4 shows the results of ELISA on yeast binding activity of an antifungal recombinant protein in example 3 of the present invention;

FIG. 5 is SEM images of yeasts without and after incubation with a fungal recombinant protein in example 3 of the present invention; wherein A is a saccharomycete SEM image after incubation without adopting the antifungal recombinant protein of the invention, and B is a saccharomycete SEM image after incubation with the antifungal recombinant protein of the invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention are clearly and completely described, and it is obvious that the described embodiments are a part of the embodiments of the present invention, but not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1

A preparation method of a full-length nucleotide sequence of antifungal gene (Ruditapes philippicin gene) cDNA comprises the following steps:

(1) cDNA Synthesis

① extracting Ruditapes philippinarum total RNA, extracting Ruditapes philippinarum blood cell total RNA by Trizol reagent method (Invitrogen company), determining total RNA integrity by 1.2% agarose gel electrophoresis, and detecting total RNA concentration by Nanodrop 2000;

② Total RNA purification by treating with RQ1 DNase (Promega, USA) to remove DNA contamination and complete RNA purification;

③ reverse transcription to obtain cDNA 25. mu.L of a reverse transcription reaction system containing 2. mu.g of total RNA, 200 UM-MLV and 0.5. mu.M oligo dT primer was reacted at 42 ℃ for 1 hour to synthesize cDNA by reverse transcription, followed by 5 min at 95 ℃ to inactivate the enzyme.

(2) Generation of full-length cDNA for antifungal Gene: designing a primer, and constructing a gene library by using a PCR method; performing large-scale EST sequencing on the gene library to identify an Rpmacin EST gene; full-length cDNAs (P1 and P2, Table 1) were generated using a nested PCR strategy, with the following steps:

① first round PCR, pre-denaturation at 94 ℃ for 5 min, followed by 35 cycles of 94 ℃ denaturation for 30 s, 60 ℃ annealing for 30 s, 72 ℃ extension for 1 min, and final extension at 72 ℃ for 10 min;

② second round PCR, 1 μ L of the first round PCR product is used as template to perform the second round PCR, P2 and dT are used as primers, the reaction program is the same as the first round PCR;

③ recovering PCR amplification product, which is to use 1.5% agarose gel electrophoresis, use a gel imaging system to photograph and observe the result and recover the PCR amplification product according to the instructions of the agarose gel DNA recovery kit;

④ connection, connecting the recovered PCR amplification product to a PMD19T vector, transforming escherichia coli competence trans5 α, and selecting a single clone for sequencing;

⑤ sequence analysis, the obtained sequence is determined to be the full length of Rpmacin gene cDNA sequence after NCBI website is subjected to Blast analysis, the CDS region is translated to obtain amino acid sequence and is subjected to bioinformatics analysis, and the result of multi-sequence comparison is shown in figure 1.

TABLE 1 primer List

Primer and method for producing the same	Sequence (5 '-3')	Primer information
			P1	GAGTTAGGATACAATACTGGCACA	3’ RACE primer
P2	CAACAAAGTGGGACAGAAGCA	3’ RACE primer

Example 2

A preparation method of antifungal recombinant protein (Ruditapes philippinarum antifungal Rpmacin recombinant protein) comprises the following steps:

(1) obtaining of recombinant expression vectors

① connecting with T vector, designing primers at two ends of a sequence fragment of a coded mature peptide segment in a Philippine clam antifungal Rpmacin gene cDNA sequence, adding a BamHI enzyme cutting site to an upstream primer, adding a Hind Ш enzyme cutting site to a downstream primer, performing PCR amplification to obtain a PCR product 2, performing agarose gel electrophoresis on the PCR product 2, purifying and recovering the PCR product, connecting the PCR product 2 into a PMD19T vector, converting escherichia coli competent trans5 α, and selecting a single clone to perform colony PCR verification and sequencing to determine the correctness of the sequence;

② constructing recombinant expression vector, extracting plasmid from the strain determined by sequencing, carrying out double enzyme digestion by BamHI and Hind Ш, recovering target fragment, connecting again into prokaryotic expression vector pET30a (+) by T4 ligase, obtaining recombinant expression vector pET30a (+) -Rpmacin, transforming into escherichia coli competence trans5 α, selecting monoclonal bacteria, carrying out colony PCR verification and sequencing to determine the correctness of the sequence.

(2) Obtaining a crude protein:

① transformation and expression strain, extracting recombinant plasmid from the strain determined by sequencing, transforming and expressing strain BL21(DE3) (purchased from Invitrogen company), culturing overnight, selecting positive single clone, performing colony PCR verification, screening to obtain positive transformation and expression strain, and storing glycerol with the final concentration of 30% at-80 ℃.

② determination of induced expression concentration, taking 3 positive transformation expression strains, shaking the strains overnight, inoculating 4 tubes of LB culture medium containing kanamycin the next day according to the proportion of 1%, each tube being 10 mL, culturing at 37 ℃ and 200 rpm for 3 h to OD 600 of 0.6-0.8, adding IPTG to the 3 tubes respectively until the final concentration is 0.1 mM, 0.5 mM and 1 mM, and taking 1 tube as an uninduced control, continuing shaking at 37 ℃ and 200 rpm for 5h, sucking 1mL of bacterial liquid, centrifuging at 8000rpm for 10min, discarding supernatant, adding sterilized water 40 μ L, adding 10 μ L of 5 × SDS-PAGE loading buffer (+ β -mercaptoethanol), boiling water for 10min, SDS-PAGE, staining 20min, decolorizing the destaining solution to be clean, observing and analyzing whether to express and determining the induction conditions, when IPTG induction concentration is 0.1 mM, the induction result is as shown in Lane 1-2 of figure 2, and the induction concentration is 0.1 mM.

③ inducing expression, taking 3 positive transformation expression strains, shaking the strains overnight, inoculating 200 mL of LB culture medium containing kanamycin according to the proportion of 1% the next day, culturing at the temperature of 37 ℃ and 200 rpm for 3 h until the OD 600 is 0.6-0.8, adding IPTG (isopropyl-beta-D) to the final concentration of 0.1 mM, continuing to shake the strains at the temperature of 37 ℃ and 200 rpm for 5h, centrifuging at the speed of 8000rpm for 10min, discarding supernatant and collecting the strains, washing and resuspending the strains by using Buffer I, transferring the strains to a 50 mL centrifuge tube with the volume of 20 mL, temporarily storing the strains in a centrifuge tube at the temperature of 4 ℃ for about 20min until the strains are clarified, and centrifuging the crushed strains at the speed of 10000 rpm for 10min at the temperature of 4 ℃ to collect the supernatant, namely the crude protein.

(3) Protein purification and renaturation

① Nickel column affinity chromatography purification, adopting traditional nickel column passing method to purify protein, hanging 0.2M nickel sulfate column for 1-2 h, then passing 50 ml ultrapure water and 50 ml Buffer I column, incubating the supernatant containing crude protein for 20min, slowly passing column, balancing with 50 ml Buffer I, passing the column with impurity protein eluent to remove impurity protein, eluting His label protein with eluent, detecting by SDS-PAGE, and temporarily storing the eluent containing target protein at 4 deg.C.

② dialysis renaturation, adding eluent into dialysis bag, dialyzing with renaturation liquid containing gradient urea to remove urea, dialyzing with renaturation liquid only containing Tris, quick freezing renaturation protein with liquid nitrogen, storing at-80 deg.C, SDS-PAGE electrophoresis analyzing and detecting purified protein concentration with BCA kit, the protein purification result is shown in Lane 3 of figure 2.

(4) Antibody preparation and Western-blot detection

The renaturation protein is dialyzed by ultrapure water to remove Tris, and then is frozen and dried for immunizing a mouse with the age of 6 weeks. 100 mu g of Rpmacin and complete Freund's adjuvant are mixed and emulsified for intraperitoneal injection of mice, and after two weeks, 100 mu g of Rpmacin and incomplete Freund's adjuvant are mixed and emulsified for inoculation of mice. The third and fourth injections were administered in tail vein at intervals of one week, each 50. mu.g. Antisera were collected from sacrificed mice 7 days after the last injection.

Carrying out SDS-PAGE electrophoresis on the protein sample, cutting the protein sample into a proper size, preparing filter paper and a nitrocellulose membrane with proper size, and after the substances are soaked in the electrotransformation liquid, sequentially arranging the substances from the negative electrode to the positive electrode in a protein transfer tank: sponge, three-layer filter paper, albumin glue, nitrocellulose membrane, three-layer filter paper and sponge. When putting a layer, tweezers are needed to remove air bubbles. Putting the glued board into a film rotating groove, adding electric rotating liquid, putting the film rotating groove into an ice box, and rotating the film for 2 hours at a current of 200 mA; and (3) sealing: placing the membrane in a clean box, and sealing with 5% skimmed milk on a shaker for 2 hr; primary antibody incubation: the membrane was washed 2 times with TBST for 5 min each time, at a rate of 1: 3000 adding antiserum, and incubating for 2 h on a shaking table; secondary antibody incubation (rabbit anti-mouse IgG-HRP antibody): TBST membrane washing 3 times, each time for 5 min, according to 1:5000 adding secondary antibody, and incubating for 2 h on a shaking table; color development: washing the membrane for 3 times by TBST, 5 min each time, dripping ECL developing solution, developing in a color developing instrument and storing the photo. The Western-blot detection result is shown in Lane 4 of FIG. 2.

Example 3

An activity detection method of a fungus recombinant protein (Ruditapes philippinarum antifungal Rpmacin recombinant protein) specifically comprises the following steps:

(1) kinetics of sterilization

After harvesting the yeast by centrifugation, it was resuspended after 3 washes with PBS buffer (pH 7.4), incubated at 37 ℃ with Rpmacin recombinant protein at a concentration of 1 × MIC 2 × 10⁷Individual yeast cells, a control group, were tested in PBS instead of Rpmacin recombinant protein at 0, 10, 30, 60, 160, 400, 1000 min after incubation, respectively, the number of surviving yeasts was expressed in Colony Forming Units (CFU), and the time-dependent graph of bactericidal kinetics was plotted against the logarithm of viable counts. The experiment was performed in 3 replicates.

As shown in FIG. 3, compared with the control group, 70% or more of the yeasts were killed within 60 min after the yeast and Rpmacin recombinant protein were incubated at a concentration of 1 × MIC, and the sterilization ratio reached 85% or more when the incubation was performed for 400 min.

(2) Binding experiments with fungi

The fungal (yeast) binding capacity of the rRpmacin was tested by ELISA. The 96-well plates were inoculated with yeast and incubated overnight at 4 ℃ for coating, blocked by incubation with 3% BSA in PBS for 1 h at 37 ℃, and washed 3 times with PBST. The Rpmacin recombinant protein solutions at concentrations of 0, 1.5, 3, 6, 12 μ g/mL were added and incubated at 18 ℃ for 3 hours. This was followed by sequential incubation with Rpmacin primary antibody (1: 1000) and goat anti-mouse Ig secondary antibody (1: 5000) (Southern Biotech, USA). Finally, the pNPP matrix solution is added, incubated at room temperature in the dark and the absorbance is measured at 405 nm. As a control, 3 replicates were set up for each experiment, replacing the Rpmacin recombinant protein solution with 100 μ L bicarbonate buffer.

The results are shown in fig. 4, where the Rpmacin recombinant protein can directly dose-dependently bind to yeast in vitro compared to the control group.

(3) Observation by scanning electron microscope

Yeast was cultured in a medium, treated with Rpmacin recombinant protein at a concentration of 1 × MIC for 60 min at room temperature, and fixed on a cover glass, fixed with 2.5% glutaraldehyde (w/v) in 0.1M sodium phosphate buffer for 30 min, followed by dehydration with gradient ethanol, after critical point drying and gold plating of the sample, surface morphology change of the yeast was observed by a scanning electron microscope (SEM, Hitachi S-4800, Japan), and the results are shown in FIG. 5.

In the figure, the yeast in the control group is smooth and round, and the surface is not obviously cracked; after the recombinant Rpmacin protein is incubated, cells shrink, the cell surface is obviously rough and cracked, namely the recombinant Rpmacin protein changes the integrity of the cell membrane of the yeast.

(4) Control of cucumber and cabbage downy mildew

An experiment for inhibiting downy mildew of Chinese cabbage and cucumber by using an antibacterial VpBDef-2 recombinant protein of a targeted bacterial nucleic acid specifically comprises the steps of spraying 1 × MIC Rpmacin recombinant protein on the surfaces of leaves of the Chinese cabbage and the cucumber, performing a toxicity attack experiment by using Bremia lactucae, counting the ratio of the attack of vegetables in an experimental group to those in a control group, wherein the vegetables in the control group are not sprayed with the Rpmacin recombinant protein.

The experimental result is shown in fig. 5, and the Rpmacin recombinant protein sprayed on the surface can inhibit downy mildew of cabbage or cucumber caused by Bremia lactucae, and the morbidity is respectively reduced by 23% and 30%.

It should be understood that the above-described specific embodiments are merely illustrative of the present invention and are not intended to limit the present invention. Obvious variations or modifications which are within the spirit of the invention are possible within the scope of the invention.

Sequence listing

<110> institute of tobacco pipe coastal zone of Chinese academy of sciences

<120> antifungal gene, polypeptide, recombinant protein, preparation method and application thereof

<130>2020

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>691

<212>DNA

<213> Ruditapes philippinarum (Ruditapes philippinarum)

<400>1

gctgttattt cagtttcgag gctttgcaga aagtaagata taagtcatga acaagctgat 60

aataatatcg attgttgccg tgttaatgat gtgctccgta attccaagag gagaggcatt 120

tatcgttaca tgttatgaaa catggtcccg atgcactggt tggagctccg gcggaacagg 180

ttggctgtgg aaatcatgcc cagacaggtg tgaggagtta ggatacaata ctggcacatg 240

tagattagct ccgtctgatt gcccgctggc acgacaagcg taccaatgtc agtgtgaaga 300

ctaagctcta aaaggagtgg tagtaatcgt atttgtcaga gaaacaaact gttaaaaaca 360

acttttatgt gaaataaacc ggacaaaaat caaagtttaa atgacaaatt tattacaaag 420

atttctaaca ttttttctta cttgcaacaa agtgggacag aagcaaagtt ttatcctttt 480

agacgaaatg taataacaat ataactttaa atgcttttgt tatatattctatttcggttt 540

tgctatgtag ctgcgtttct tgcattttga aaaataaaaa gaaatcaact attttgatca 600

tcatttgcga gaaatacatt tgctatatat ttttaacaaa tgttatcaaa taaataatac 660

ggacatacaa aacacaaaaa aaaaaaaaaa a 691

<210>2

<211>85

<212>PRT

<213> Ruditapes philippinarum (Ruditapes philippinarum)

<400>2

Met Asn Lys Leu Ile Ile Ile Ser Ile Val Ala Val Leu Met Met Cys

1 5 10 15

Ser Val Ile Pro Arg Gly Glu Ala Phe Ile Val Thr Cys Tyr Glu Thr

20 25 30

Trp Ser Arg Cys Thr Gly Trp Ser Ser Gly Gly Thr Gly Trp Leu Trp

35 40 45

Lys Ser Cys Pro Asp Arg Cys Glu Glu Leu Gly Tyr Asn Thr Gly Thr

50 55 60

Cys Arg Leu Ala Pro Ser Asp Cys Pro Leu Ala Arg Gln Ala Tyr Gln

65 70 75 80

Cys Gln Cys Glu Asp

85

<210>3

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

gagttaggat acaatactgg caca 24

<210>4

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

caacaaagtg ggacagaagc a 21

Claims

1. An application of antifungal recombinant protein in the field of preparing antifungal drugs, vaccines or feed additives is characterized in that the fungus is saccharomycete or Bremia lactucae;

the antifungal recombinant protein is coded by an antifungal gene and expresses antifungal polypeptide;

the antifungal gene is a Ruditapes philippinarum antifungal Rpmacin gene, and the nucleotide sequence of the antifungal Rpmacin gene is shown as SEQ ID number 1;

the amino acid sequence of the polypeptide is shown as SEQ ID number 2.