CN107253988B

CN107253988B - Preparation method of human programmed death factor ligand PD-L2 protein

Info

Publication number: CN107253988B
Application number: CN201710592911.1A
Authority: CN
Inventors: 杨娟娟; 夏菁潞; 孟春; 刘照; 罗岭; 俞博彤
Original assignee: Fuzhou University
Current assignee: Fuzhou University
Priority date: 2017-07-19
Filing date: 2017-07-19
Publication date: 2021-01-29
Anticipated expiration: 2037-07-19
Also published as: CN107253988A

Abstract

The invention relates to a preparation method of human programmed death factor ligand PD-L2 (hPD-L2) protein, belonging to the technical field of preparation methods of recombinant proteins. The method adopts PCR technology to amplify the whole extracellular region, connects with pET-22b carrier, constructs fusion expression recombinant plasmid, and transfers into a prokaryotic expression system Rossetta^TM(DE3) host bacteria induce expression of hPD-L2 protein, obtain hPD-L2 protein expressed by supernatant, and then purify by using Ni-NTA column affinity chromatography to obtain protein with high purity, high stability and uniform conformation. The hPD-L2 protein prepared by the invention can be used as an antigen to immunize Balb/c female mice and is used for preparing monoclonal antibodies. The hPD-L2 protein prepared by the invention has the characteristics of simple and convenient process, short period, low cost, high purity and high uniformity of the obtained protein.

Description

Preparation method of human programmed death factor ligand PD-L2 protein

Technical Field

The invention belongs to the technical field of preparation methods of recombinant proteins, and particularly relates to a preparation method of a human-derived programmed death factor ligand hPD-L2 protein.

Background

PD-L2, the 5 th member of the B7 family, was named B7-DC or BTDC, and is one of the major ligands of Programmed Death factor 1 (PD-1). The B7 family are costimulatory molecules that can only signal unidirectionally from antigen presenting cells, APCs, to T cells. In the process of T lymphocyte proliferation, the PD-L2 signal path acts as a negative feedback regulation signal of immune response and plays an important role in immune regulation. After being combined with a PD-1 receptor on the surface of a T cell, PD-L2 regulates the proliferation and cytokine secretion of the T cell through a PD-1-PD-L2 signal channel, negatively regulates the activation of the T cell and promotes the apoptosis of the T cell, thereby inhibiting the immune escape of the tumor cell. The signal channel is used as an important cell cycle check point, plays a specific antigen-dependent negative regulation role, is one of target molecules of a drug interference mechanism and antitumor immunotherapy, and has potential clinical application value. hPD-L2 protein can be used as antigen to provide epitope for antibody binding, and the preparation of the protein is a precondition for the subsequent preparation of hPD-L2 monoclonal antibody and also lays a foundation for the preparation of monoclonal antibody.

Disclosure of Invention

In order to solve the problems, the invention provides a preparation method of human programmed death factor ligand PD-L2 protein.

The following technical scheme is adopted for the purpose:

a human programmed death factor ligand PD-L2 protein has an amino acid sequence and a nucleotide sequence shown in SEQ ID NO. 1-2.

The protein is represented by the following 1) -2):

1) protein with amino acid sequence and nucleotide sequence shown in SEQ ID NO. 1-2;

2) subjecting the amino acid sequence and/or nucleotide sequence shown in SEQ ID NO.1-2 to one and or several

Protein derived from 1) by substitution and/or deletion and/or addition of amino acid/nucleotide sequence and having the same function;

a preparation method of human programmed death factor ligand PD-L2 protein comprises the following steps:

1) the method comprises the steps of taking a full-length coding gene (the sequence number is NM 025239.3) of human programmed death factor ligand PD-L2 as a template, obtaining hPD-L2 whole extracellular segment gene by utilizing a PCR technology, simultaneously carrying out double enzyme digestion on a PCR product and a carrier pET-22b by utilizing Nde I and Xho I restriction enzyme, and connecting by utilizing T4 DNA ligase to obtain a connecting product;

2) preparing DH5 alpha competent cells, transforming the ligation products into DH5 alpha competent cells, selecting positive clones, sending the positive clones to a company for gene sequencing, and obtaining pET-22b-hPD-L2 recombinant plasmids after successful sequencing;

3) preparation of Rosseta^TM(DE3) by transforming the pET-22b-hPD-L2 recombinant plasmid obtained in step 2) into Rosseta^TM(DE3) obtaining a single colony of the recombinant bacterium in a competent cell;

4) single colonies were picked, cultured overnight at 37 ℃ in 10 mL of LB medium containing 50. mu.g/mL kanamycin and 35. mu.g/mL chloramphenicol, and the inoculum was adjusted to 1:100 volume ratio into 1L containing 50 u g/mL kanamycin and 35 u g/mL chloramphenicol LB medium, cultured to OD_{600 nm}The value is between 0.6 and 0.8, then IPTG with the final concentration of 0.8 mM is added for induction at 22 ℃ for 8 hours, and thalli are collected;

5) resuspending the thalli in lysis buffer PBS, ultrasonically crushing, centrifuging, and collecting supernatant;

6) purifying the supernatant obtained in the step 5) by using a Ni-NTA column affinity chromatography;

7) putting the target protein eluent collected in the step 6) into a dialysis bag, and performing protein dialysis by using a PBS buffer solution;

8) putting the hPD-L2 protein solution dialyzed in the step 7) into a concentration tube for concentration to obtain hPD-L2 protein with high concentration;

9) detecting the obtained hPD-L2 protein by using a Western-Blot technology;

10) the hPD-L2 protein obtained in step 8) was determined by using the circular dichroism technique (CD), and the experimental results show that: the secondary structure of the recombinant protein is better folded, and beta folding is taken as a main part.

The gene fragment of hPD-L2 has the length of 600 bp and codes 200 amino acids.

The volume ratio of the ligation product to DH5 alpha competent cells in step 2) was 1: 3; the recombinant plasmid and Rosseta in the step 3)^TM(DE3) ratio of competent cell volumes of 1: 60.

the lysis buffer PBS in the step 5) contains: 122 mM NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄，2 mM KH₂PO₄，pH 7.4。

The invention has the advantages that: using prokaryotic cells Rossetta^TM(DE3) host bacteria inducible expression of proteinsThe human programmed death factor ligand PD-L2 protein can be stably and efficiently obtained, and the obtained protein has the characteristics of high purity, high yield, good uniformity and the like. The preparation method of the human programmed death factor ligand PD-L2 protein adopted by the invention has the advantages of simple and convenient flow, short period, low cost and the like.

Drawings

FIG. 1: and (3) identifying the PCR result of the hPD-L2 protein extracellular domain gene by agarose gel electrophoresis. Lane lane

1: PD-L2, PCR amplification product.

FIG. 2: 15% polyacrylamide gel electrophoresis (SDS-PAGE) identifies the induction expression result of hPD-L2 recombinant protein. Lane 1: total bacterial protein disrupted prior to induction; lane 2: inducing for 8 h to break total protein of whole bacteria; lane 3: inducing for 8 h to break the centrifuged precipitate; lane 4: the supernatant after centrifugation was disrupted by induction for 8 h.

FIG. 3: hPD-L2 SDS-PAGE pattern after recombinant protein purification. Lane 1: hPD-L2 inclusion body dissolving solution; lane 2: flowing the liquid through the column; lanes 3-6 are the wash and eluent, respectively, with imidazole concentrations in order: 10 mM, 20 mM, 30mM, 50mM, 250 mM.

FIG. 4: WB result of monoclonal antibody detection hPD-L2 protein.

FIG. 5: CD determination hPD-L2 protein secondary structure folding, and the experimental result shows that: the protein presents a positive peak at 192 nm and has an obvious negative peak at 218 nm, which indicates that the secondary structure of the hPD-L2 protein is folded well and exists in a conformation mainly based on beta folding.

Detailed Description

The following detailed description of specific embodiments of the present invention is provided in conjunction with examples, but it should be understood that the scope of the present invention is not limited to the specific embodiments.

Throughout the specification and claims, unless explicitly stated otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or component but not the exclusion of any other element or component.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1

The method specifically comprises the following steps:

1) hPD-L2 gene acquisition and molecular cloning and recombinant plasmid pET-22b-hPD-L2 construction: the invention relates to the preparation of hPD-L2 protein extracellular domain protein, which has the base number of about 560 bp and the molecular weight of about 22 kDa. Primer design software Primer premier 5.0 was used to design the upstream Primer for the extracellular domain of hPD-L2 protein: 5' GGACTGCCATATGTTCACAGTGACAGTCC 3' (cleavage site, Nde I) and the downstream primer: 5' AATCTCGAGGTCAATGCTGGCCAAAG 3' (cleavage site, Xho I). Taking 1.5 μ L of total length gene (sequence number NM 025239.3) of artificially synthesized hPD-L2, adding 1 μ L of each primer forward and reverse primers, adding 15 μ L of 2 XDNTP, 2 μ L of PCR DNA polymerase, and finally adding 4.5 μ L of ddH₂And O, mixing uniformly and carrying out a PCR amplification experiment.

The PCR amplification conditions are pre-denaturation at 95 ℃ for 4 min, denaturation at 95 ℃ for 30 s, annealing at 65 ℃ for 30 s and extension at 72 ℃ for 60 s, and the cycle is repeated for 35 times. The PCR experiment result (shown in figure 1) was identified by 1% agarose gel electrophoresis, and the PCR product was purified by cutting a fragment of about 560 bp in size and using a SanPrep column DNA gel recovery kit. According to the standard double digestion system of Takara, 16. mu.L of the purified PCR product, 1. mu.L of restriction enzyme Nde I, 1. mu.L of restriction enzyme Xho I, and 2. mu.L of 10 Xbuffer H were mixed, allowed to stand at 22 ℃ for 3-4 hours, and then 2. mu.L of 10 Xloading Buffer was added to terminate the reaction. The pET-22b vector was subjected to double digestion in the same manner. And purifying the double enzyme digestion product by using a PCR cleaning kit. And connecting the purified products by the following steps: mu.L of the PCR product after double digestion, 8. mu.L of the vector pET-22b after double digestion, 2. mu.L of T4 DNA ligase (Takara) and 2. mu.L of T4 DNA ligase buffer (Takara) were mixed and reacted at 16 ℃ for 16 hours.

2) Empty DH 5. alpha. E.coli stored at-80 ℃ was taken as LB solidStreaking is carried out on the culture medium, and the culture medium is placed in a constant-temperature incubator at 22 ℃ for 12-16 h. Single colonies were picked from the plate and inoculated into 50 mL LB liquid medium, cultured at 22 ℃ for about 2 hours with shaking at 200 rpm, until logarithmic phase (OD)_{600 nm}About 0.6); collecting bacteria liquid by using a sterilized 50 mL centrifugal tube, placing the bacteria liquid on ice for 15 min (the bacteria can keep the maximum activity at low temperature when the bacteria are in logarithmic phase all the time), and centrifuging the bacteria liquid at 4 ℃ and 4000 rpm for 10 min; discarding the supernatant, collecting the thallus, adding 0.4 volume times of Buffer TFB I (pH 5.8, 300 mM potassium acetate, 100 mM potassium chloride, 10 mM calcium chloride, 50mM manganese chloride tetrahydrate and 15% glycerol), blowing uniformly to resuspend the thallus, placing on ice for 20 min, and centrifuging at 4 ℃ and 4000 rpm for 10 min; the supernatant was discarded and the collected cells were pipetted into a 0.04 volume Buffer TFB II (pH 1.5, 10 mM Mops, 75 mM CaCl) pipette₂10 mM KCl, 15% glycerol), after the suspension of the cells was blown evenly, the cells were placed on ice for 20 min and dispensed into sterilized 1.5 mL centrifuge tubes, 60. mu.L each. Rosseta was prepared according to the same procedure^TM(DE3) competent cells. And (2) transforming 20 mu L of the enzyme-linked product into 60 mu L of DH5 alpha super competent cells, lightly blowing and uniformly mixing, placing on ice for 30 min, carrying out heat shock in a 42 ℃ water bath kettle for 90 s, quickly taking out after heat shock, placing in an ice box for ice bath for 2 min, adding 800 mu L of LB culture medium containing 50 mu g/mL kanamycin resistance, culturing on a 22 ℃ 200 rpm shaking table for about 45 min, carrying out centrifugation at 4 ℃ and 4000 rpm for 2 min, taking out 600 mu L of supernatant under aseptic conditions, uniformly blowing the residual liquid, coating on an agarose plate containing 50 mu g/mL kanamycin resistance, culturing overnight, picking single bacterial colony, culturing in 5 mL of LB culture medium containing 50 mu g/mL kanamycin resistance overnight, extracting plasmids by using a plasmid extraction kit, and carrying out double enzyme digestion verification. And (4) sending the recombinant bacteria with positive results of double enzyme digestion verification to a sequencing company for further plasmid sequencing.

3) Taking the recombinant plasmid pET-22b-hPD-L2 with correct sequencing, and converting the recombinant plasmid into Rosseta^TM(DE3) in competent cells. Selecting a single clone, inoculating the single clone into 10 mL LB culture medium containing 50 ug/mL kanamycin, culturing the inoculum overnight, inoculating the inoculum according to a volume ratio of 1:100 to 1L LB culture medium containing 50 ug/mL kanamycinCulturing in culture medium at 37 deg.C for 2.5-3 hr to OD_{600 nm}The value is between 0.6 and 0.8, IPTG is added to a final concentration of 0.8 mM, and the shaking culture is continued at 200 rpm at 22 ℃ for 8 h. The cells were collected by centrifugation at 8000 g for 5 min at 4 ℃. The cells were washed twice with PBS buffer, resuspended in 50 mL PBS, and sonicated under the following conditions: the amplitude transformer of the ultrasonic crusher is inserted into one third of the liquid level, the power is 10%, the operation lasts for 2 s, the operation stops for 3 s, and the crushing lasts for 45 min. After the crushing is finished, samples are taken as crushed whole bacteria, the remaining bacteria are centrifuged for 10 min at 12000 g at 4 ℃, supernatant is collected, sediment is discarded, and the supernatant and the sediment are sampled and stored in a refrigerator at 4 ℃.

4) The expression of hPD-L2 protein was detected by SDS-PAGE: treating the whole bacteria, the supernatant and the precipitate which are crushed in the step 3) and the sample before induction, and loading. The concentration of the protein sample is carried out by using a constant voltage of 100V and the separation of the protein sample is carried out by using a constant voltage of 120V in the electrophoresis process. And (3) taking down the gel after electrophoresis, placing the gel in a staining solution, staining at 60 ℃ for about 1 h (adopting a coop staining method), placing the gel in a decolorizing solution for decolorizing, and taking a picture of the gel after decolorizing (shown in figure 2).

5) And (3) purifying hPD-L2 protein by Ni-NTA column affinity chromatography:

a) placing 5 mL of Ni-NTA filler in a glass column, and naturally settling for 30 min;

b) using 30 mL ddH₂O washing the column, then equilibrating the column with 30 mL of equilibration solution (pH 8.5, 100 mM Tris-HCl, 300 mM NaCl) at a flow rate of 3 s per drop;

c) 13000 g of hPD-L2 protein sample to be subjected to column chromatography is centrifuged for 15 min at 4 ℃, supernatant is collected and filtered by a filter membrane of 0.45 mu m, and the sample is subjected to loading;

d) loading the filtered protein, collecting the flow-through sample on ice at the flow rate of 2-3 s per drop;

e) hPD-L2 protein was washed and eluted with buffers of different imidazole concentrations at a flow rate of 3 s per drop.

6) Packing the hPD-L2 recombinant protein obtained by purification in the step 5) into a pretreated dialysis bag, and dialyzing in PBS buffer solution for 3 times.

7) And (3) taking the protein solution in the dialysis bag obtained in the step 6), and concentrating in a concentration tube to obtain hPD-L2 protein with high concentration (10 mg/mL).

Example 2

The detection of hPD-L2 protein by using Western-Blot technology comprises the following specific operation steps:

1) separating the hPD-L2 protein sample obtained after purification by 15% SDS-PAGE, taking down gel after electrophoresis, making the gel and PVDF membrane into a sandwich shape, and transferring the membrane by a wet transfer method;

2) after the electrotransfer is finished, taking down the PVDF membrane, adding 5% BSA-TBST (protein surface facing downwards), and sealing for 1 h through shaking (65 rpm) on a 22 ℃ shaking table to eliminate a non-specific background;

3) after blocking, washing 5% BSA-TBST by using TBST, adding a purchased PD-L2 antibody as a primary antibody, and carrying out shake incubation (60 rpm) for 1 h or 4 ℃ overnight (12-16 h) on a decoloring shaking table to ensure that the primary antibody is specifically combined with hPD-L2 protein;

4) recovering primary antibody, washing with TBST in shaker for 5 min 3 times (60 rpm);

5) adding a secondary antibody, and incubating for 1 h at 60 rpm in a decoloring shaker to ensure that the secondary antibody is fully combined with the primary antibody;

6) recovering the secondary antibody, washing with TBST in a shaker for 5 min 3 times (60 rpm);

7) incubate 3 min with ECL color kit (200. mu.L reagent A/sheet + 200. mu.L reagent B/sheet). Removing the reaction solution, transferring to a preservative film, tabletting, developing and fixing. After fixing, the film is naturally dried, a Canon camera shoots the film, and the experimental results are recorded (as shown in figure 4).

Example 3

The secondary structure folding condition of hPD-L2 protein is determined by using a circular dichroism technology, and the specific operation steps are as follows:

1) the high purity hPD-L2 protein obtained was diluted to buffer pH 7.6, 20 mM Tris-HCl, final concentration: centrifuging at 12000 g for 10 min at 0.5 mg/mL, and taking the supernatant for later use.

2) The round two chromatography instrument (CD) was opened and allowed to stand at room temperature for 30 min.

3) Placing the hPD-L2 protein sample prepared in the step 1) into a quartz cuvette for determination, and recording a spectrogram, wherein the experimental result shows that: the obtained hPD-L2 protein has better secondary structure folding and takes beta folding as the main (as shown in figure 5).

SEQUENCE LISTING

<110> Fuzhou university

<120> preparation method of human-derived programmed death factor ligand PD-L2 protein

<130> 4

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 201

<212> PRT

<213> hPD-L2 amino acid sequence

<400> 1

Leu Phe Thr Val Thr Val Pro Lys Glu Leu Tyr Ile Ile Glu His Gly

1 5 10 15

Ser Asn Val Thr Leu Glu Cys Asn Phe Asp Thr Gly Ser His Val Asn

20 25 30

Leu Gly Ala Ile Thr Ala Ser Leu Gln Lys Val Glu Asn Asp Thr Ser

35 40 45

Pro His Arg Glu Arg Ala Thr Leu Leu Glu Glu Gln Leu Pro Leu Gly

50 55 60

Lys Ala Ser Phe His Ile Pro Gln Val Gln Val Arg Asp Glu Gly Gln

65 70 75 80

Tyr Gln Cys Ile Ile Ile Tyr Gly Val Ala Trp Asp Tyr Lys Tyr Leu

85 90 95

Thr Leu Lys Val Lys Ala Ser Tyr Arg Lys Ile Asn Thr His Ile Leu

100 105 110

Lys Val Pro Glu Thr Asp Glu Val Glu Leu Thr Cys Gln Ala Thr Gly

115 120 125

Tyr Pro Leu Ala Glu Val Ser Trp Pro Asn Val Ser Val Pro Ala Asn

130 135 140

Thr Ser His Ser Arg Thr Pro Glu Gly Leu Tyr Gln Val Thr Ser Val

145 150 155 160

Leu Arg Leu Lys Pro Pro Pro Gly Arg Asn Phe Ser Cys Val Phe Trp

165 170 175

Asn Thr His Val Arg Glu Leu Thr Leu Ala Ser Ile Asp Leu Gln Ser

180 185 190

Gln Met Glu Pro Arg Thr His Pro Thr

195 200

<210> 2

<211> 603

<212> DNA

<213> hPD-L2 nucleotide sequence

<400> 2

ttattcacag tgacagtccc taaggaactg tacataatag agcatggcag caatgtgacc 60

ctggaatgca actttgacac tggaagtcat gtgaaccttg gagcaataac agccagtttg 120

caaaaggtgg aaaatgatac atccccacac cgtgaaagag ccactttgct ggaggagcag 180

ctgcccctag ggaaggcctc gttccacata cctcaagtcc aagtgaggga cgaaggacag 240

taccaatgca taatcatcta tggggtcgcc tgggactaca agtacctgac tctgaaagtc 300

aaagcttcct acaggaaaat aaacactcac atcctaaagg ttccagaaac agatgaggta 360

gagctcacct gccaggctac aggttatcct ctggcagaag tatcctggcc aaacgtcagc 420

gttcctgcca acaccagcca ctccaggacc cctgaaggcc tctaccaggt caccagtgtt 480

ctgcgcctaa agccaccccc tggcagaaac ttcagctgtg tgttctggaa tactcacgtg 540

agggaactta ctttggccag cattgacctt caaagtcaga tggaacccag gacccatcca 600

act 603

<210> 3

<211> 29

<212> DNA

<213> Artificial sequence

<400> 3

ggactgccat atgttcacag tgacagtcc 29

<210> 4

<211> 26

<212> DNA

<213> Artificial sequence

<400> 4

aatctcgagg tcaatgctgg ccaaag 26

Claims

1. A preparation method of human programmed death factor ligand PD-L2 protein is characterized in that:

a) through the acquisition and cloning of hPD-L2 gene and the construction of recombinant plasmid pET-22 b-hPD-L2;

b) preparation ofRosseta ^TM(DE3), transferring the recombinant plasmid obtained in a) into the competent cell to obtain a recombinant strain;

c) inducing the recombinant strain obtained in the step b) for 8 hours at the temperature of 22 ℃ and the rpm of 200 and under the condition of 0.8 mM isopropyl thiogalactoside to obtain the mass expression of hPD-L2 protein;

d) purifying c) by adopting Ni-NTA column affinity chromatography to obtain hPD-L2 recombinant protein with higher purity; concentrating the purified recombinant protein by using a concentration tube to obtain hPD-L2 recombinant protein with high concentration;

the specific method comprises the following steps:

1) taking the full-length coding gene of the human programmed death factor ligand PD-L2 as a template, and utilizing the PCR technology

Obtaining hPD-L2 whole extracellular segment gene by operationNdeI andXhothe PCR product is simultaneously subjected to double enzyme digestion by the restriction enzyme I and the vector pET-22b, and T4 DNA ligase is used for carrying out ligation to obtain a ligation product;

3) preparation ofRosseta ^TM(DE3) by transforming the pET-22b-hPD-L2 recombinant plasmid obtained in step 2) into competent cellsRosseta ^TM(DE3) obtaining a single colony of the recombinant bacterium in a competent cell;

4) single colonies were picked and plated on 10 mL LB containing 50. mu.g/mL kanamycin and 35. mu.g/mL chloramphenicol

And (3) culturing the culture medium at 37 ℃ overnight to obtain an inoculum, wherein the inoculum is prepared according to the following ratio of 1:100 volume ratio into 1L containing 50 u g/mL kanamycin and 35 u g/mL chloramphenicol LB medium, cultured to OD_{600 nm}The value is between 0.6 and 0.8, then IPTG with the final concentration of 0.8 mM is added for induction at 22 ℃ for 8 hours, and thalli are collected;

8) putting the hPD-L2 protein solution dialyzed in the step 7) into a concentration tube for concentration to obtain hPD-L2 protein;

the amino acid of the hPD-L2 protein is shown as SEQ ID NO. 1.

2. The preparation method of the human programmed death factor ligand PD-L2 protein according to claim 1

The method is characterized in that: the gene fragment of hPD-L2 has the length of 600 bp, codes 200 amino acids, and has a nucleotide sequence shown in SEQ ID NO. 2.

3. The preparation method of the human programmed death factor ligand PD-L2 protein according to claim 1

The method is characterized in that: the volume ratio of the ligation product to DH5 alpha competent cells in step 2) was 1: 3; the recombinant plasmid in the step 3) andRosseta ^TM(DE3) ratio of competent cell volumes of 1: 60.

4. the method for preparing human-derived programmed death factor ligand hPD-L2 protein according to claim 1

The method is characterized in that: the lysis buffer PBS in the step 5) contains: 122 mM NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄，2 mM KH₂PO₄，pH 7.4。