CN107253988A - A kind of preparation method of people's source program death factors part PD L2 albumen - Google Patents
A kind of preparation method of people's source program death factors part PD L2 albumen Download PDFInfo
- Publication number
- CN107253988A CN107253988A CN201710592911.1A CN201710592911A CN107253988A CN 107253988 A CN107253988 A CN 107253988A CN 201710592911 A CN201710592911 A CN 201710592911A CN 107253988 A CN107253988 A CN 107253988A
- Authority
- CN
- China
- Prior art keywords
- hpd
- albumen
- people
- source program
- recombinant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/70532—B7 molecules, e.g. CD80, CD86
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a kind of people's source program death factors part PD L2（hPD‑L2）The preparation method of albumen, belongs to the preparation method technical field of recombinant protein.This method is expanded using round pcr to whole extracellular region, and is attached with pET 22b carriers, is built amalgamation and expression recombinant plasmid, is transferred to prokaryotic expression system RossetaTM(DE3) Host Strains induced expression hPD L2 albumen, obtains the hPD L2 albumen of supernatant expression, then using Ni NTA post affinitive layer purifications, obtains the homogeneous albumen of high-purity, high stability, conformation.HPD L2 albumen prepared by the present invention can be as antigen immune Balb/c female mices, for preparing monoclonal antibody.The characteristics of hPD L2 albumen prepared by the present invention has the purity of protein height that simple flow, cycle are short, cost is low, obtain and high homogeneity.
Description
Technical field
The invention belongs to the preparation method technical field of recombinant protein, and in particular to a kind of people's source program death factors are matched somebody with somebody
The preparation method of body hPD-L2 albumen.
Background technology
PD-L2 was once named as B7-DC or BTDC, and was the programmed death factor 1 as the 5th member of B7 families
（Programmed Death- 1, PD-1）One of major ligand.B7 families are only can be unidirectional from antigen presenting cell APC
Signal is transmitted to the costimulatory molecules of T cell.During T lymphopoiesis, PD-L2 signal paths serve as immune response and born
Property feedback adjustment signal, serves highly important in terms of immunological regulation.PD-L2 is combined with the PD-1 acceptors on T cell surface
Afterwards by PD-1-PD-L2 signal paths modulating T cell propagation and cytokine secretion, negativity regulatory T-cell activates and promotes T
Apoptosis, so as to suppress the immunologic escape of tumour cell.The signal path is played as important cell cycle checkpoint
Specific antigen dependence negativity regulating and controlling effect, is one of target molecule of drug intervention mechanism and anti-tumor immunotherapy,
With potential clinical value.HPD-L2 albumen can provide the epitope of antibody binding as antigen, and the preparation of the albumen is
Precondition prepared by follow-up hPD-L2 monoclonal antibodies, also lays the foundation for the preparation of monoclonal antibody.
The content of the invention
In order to solve the above problems, the present invention provides a kind of preparation of people's source program death factors part PD-L2 albumen
Method.
Adopted the following technical scheme that for this：
A kind of people's source program death factors part PD-L2 albumen, amino acid sequence and nucleotide sequence such as SEQ ID NO.1-2
It is shown.
Described protein is following 1) -2) shown in protein：
1) protein that amino acid sequence and nucleotide sequence are constituted as shown in SEQ ID NO.1-2 respectively；
2) amino acid sequence shown in SEQ ID NO.1-2 and/or nucleotide sequence are carried out one and/or several
The substitution of amino acid/nucleotide sequence and/or missing and/or addition and the albumen as derived from 1) with identical function
Matter；
A kind of preparation method of people's source program death factors part PD-L2 albumen, using following steps：
1) with people's source program death factors part PD-L2 total length encoding gene（Serial No. NM 025239.3）For mould
Plate, the whole extracellular fragment genes of hPD-L2 are obtained using round pcr, using Nde I and Xho I restriction enzymes while double digestion
PCR primer and carrier pET-22b, are attached using T4 DNA ligases, obtain connection product；
2) DH5 α competent cells are prepared, connection product is converted to DH5 α competent cells, picking positive colony, public affairs are delivered to
Department carries out gene sequencing, is sequenced successfully, obtains pET-22b-hPD-L2 recombinant plasmids;
3) Rosseta is preparedTM(DE3) competent cell, by step 2) the pET-22b-hPD-L2 recombinant plasmids that obtain turn
Change to RossetaTM(DE3) in competent cell, the single bacterium colony of recombinant bacterium is obtained；
4) picking single bacterium colony, contains the LB culture mediums of 50 μ g/mL kanamycins and 35 μ g/mL chloramphenicol, 37 in 10 mL
Incubated overnight inoculation liquid under the conditions of DEG C, inoculation liquid is according to 1：100 volume ratio accesses 1 L and contains 50 μ g/mL kanamycins and 35
In the LB culture mediums of μ g/mL chloramphenicol, culture to OD600 nmIt is worth between 0.6-0.8, then to add final concentration of 0.8 mM's
IPTG induces 8 h in 22 DEG C, collects thalline；
5) above-mentioned thalline is resuspended in lysis buffer PBS, ultrasonication, centrifuged, collect supernatant；
6) by step 5) obtain supernatant, utilize Ni-NTA posts affinity chromatography purifying；
7) by step 6) in collect destination protein eluent put into bag filter in, utilize PBS carry out albumen dialysis；
8) by step 7) in dialyse after hPD-L2 protein liquids be placed in concentration tube concentrate, obtain high concentration hPD-L2 albumen；
9) the hPD-L2 albumen obtained using Western-Blot technology for detection；
10) circular dichroism spectra technology is utilized（CD）Determination step 8) middle acquisition hPD-L2 albumen, test result indicates that：The restructuring egg
White secondary structure is folded preferably, based on β-pleated sheet.
The genetic fragment length of the hPD-L2 is 600 bp, encodes 200 amino acid.
The step 2) in connection product and DH5 α competent cells volume ratio be 1：3；The step 3) middle restructuring matter
Grain and RossetaTM(DE3) competent cell volume ratio is 1：60.
The step 5) in contain in lysis buffer PBS：122 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4,
2 mM KH2PO4, pH 7.4.
The advantage of the invention is that：Using prokaryotic RossetaTM(DE3) Host Strains induction expression protein, Neng Gouwen
Fixed efficient acquisition people's source program death factors part PD-L2 albumen, and the albumen obtained has purity high, yield is high,
The features such as one property is good.The preparation method of people's source program death factors part PD-L2 albumen of the present invention has flow
The easy, cycle is short, low cost and other advantages.
Brief description of the drawings
Fig. 1：Agarose gel electrophoresis identifies the PCR results of hPD-L2 ectodomain genes.Swimming lane
1：PD-L2, pcr amplification product.
Fig. 2：15% polyacrylamide gel electrophoresis（SDS-PAGE）Identify the induced expression result of hPD-L2 recombinant proteins
Figure.Swimming lane 1：Broken full bacterium total protein before induction；Swimming lane 2：Induce the full bacterium total protein crushed after 8 h；Swimming lane 3：Induce 8 h
Precipitation after broken centrifugation；Swimming lane 4：Induce the supernatant after the broken centrifugations of 8 h.
Fig. 3：SDS-PAGE figures after hPD-L2 recombinant protein purifications.Swimming lane 1：HPD-L2 solubilization of inclusion bodies liquid；Swimming lane 2：
Cross post and flow through liquid；Swimming lane 3-6 is respectively to wash miscellaneous and eluent, and imidazole concentration is followed successively by：10 mM、20 mM、30mM、50mM、
250mM。
Fig. 4：Monoclonal antibody detects the WB result figures of hPD-L2 albumen.
Fig. 5：CD determines hPD-L2 Protein secondary structures and folded, test result indicates that：Posivtive spike is presented in 192 nm in the albumen,
There is an obvious negative peak at 218 nm, illustrate that hPD-L2 Protein secondary structures are folded preferable, and it is main based on β-pleated sheet
Conformation is present.
Embodiment
The embodiment of the present invention is described in detail with reference to embodiment, it is to be understood that the present invention
Protection domain is not limited by embodiment.
Explicitly indicated that unless otherwise other, otherwise in entire disclosure and claims, term " comprising " or its change
Change as "comprising" or " including " etc. will be understood to comprise stated element or part, and and other non-excluded yuan
Part or other components.
Experimental method used in following embodiments is conventional method unless otherwise specified.
Material, reagent used in following embodiments etc., unless otherwise specified, are commercially obtained.
Embodiment 1
Specifically use following steps：
1）The structure of the acquisition of hPD-L2 genes and molecular cloning and recombinant plasmid pET-22b-hPD-L2：The present invention relates to
Prepared by the albumen of the ectodomain of hPD-L2 albumen, its base number is about 560 bp, and molecular weight of albumen is about 22 kDa.Utilize
The sense primer of the ectodomain of the design hPD-L2 albumen of primer-design software Primer premier 5.0：5’
GGACTGCCATATGTTCACAGTGACAGTCC3’ （Restriction enzyme site, Nde I）And anti-sense primer：5’
AATCTCGAGGTCAATGCTGGCCAAAG3’（Restriction enzyme site, Xho I）.Take artificial synthesized hPD-L2 full-length genes（Sequence
Number be NM 025239.3）1.5 μ L, above-mentioned each 1 μ L of the positive anti-primer of primer, add 15 μ L 2 × dNTP, 2 μ L PCR DNA
Polymerase, is eventually adding 4.5 μ L ddH2O, is mixed, and enters performing PCR amplification experiment.
PCR amplification conditions are 95 DEG C of pre-degenerations 4 min, 95 DEG C of denaturation 30 s, 65 DEG C of 30 s of annealing, 72 DEG C of extensions 60
S, is circulated 35 times altogether.PCR experiment result is identified using 1% agarose gel electrophoresis（As shown in Figure 1）, cut clip size
For 560 bp or so fragment, SanPrep pillar DNA glue reclaim kits PCR primers are utilized.According to Takara companies
Standard double digestion system, the PCR primer of the 16 above-mentioned purifying of μ L is taken, in 1 μ L restriction enzyme Nde I, 1 μ L is restricted
Enzyme cutting Xho I, 2 μ L 10 × Buffer H, are mixed, and are stood 3-4 h in 22 DEG C, are then added 2 10 × Loading of μ L
Buffer terminating reactions.Double digestion is carried out to pET-22b carriers after the same method.Using PCR cleaning agents box to double enzymes
Product is cut to be purified.It is attached for product after purification, step is：The μ L of PCR primer 8 after double digestion, double digestion
μ L, the T4 DNA ligases of carrier pET-22b 8 afterwards（Takara）2 μ L, T4 DNA ligases buffer（Takara） 2 μ
L, is mixed, and 16 h are reacted in 16 DEG C.
2）Take the empty DH5 α Escherichia coli of -80 DEG C of preservations to be rule on LB solid mediums, be put in 22 DEG C of perseverances
12 ~ 16 h are cultivated in warm incubator.From picking single bacterium colony is inoculated in 50 mL LB fluid nutrient mediums on flat board, 22 DEG C, 200
H of rpm shaken cultivations 2 or so, until exponential phase（OD600 nmFor 0.6 or so）；Bacterium is collected with 50 mL centrifuge tubes of sterilizing
Liquid, places 15 min on ice（Low temperature makes thalline be constantly in exponential phase, and thalline can keep maximum vigor）, 4 DEG C,
4000 rpm centrifuge 10 min；Supernatant is discarded, thalline is collected, the Buffer TFB I of 0.4 times of volume are added（PH 5.8,300
MM potassium acetates, 100 mM potassium chloride, 10 mM calcium chloride, 50 mM tetrahydrate manganese chlorides, 15% glycerine）, blow even resuspension thalline
Place 20 min, 4 DEG C, 4000 rpm centrifugations, 10 min on ice afterwards；Discard supernatant and collect thalline, drawn with liquid-transfering gun and add 0.04
The Buffer TFB II of times volume（PH 1.5,10 mM Mops, 75 mM CaCl2, 10 mM KCl, 15% glycerine）, blow even
20 min are placed on ice after thalline is resuspended, and are divided in 1.5 mL centrifuge tubes of sterilizing, often the μ L of pipe 60.Make after the same method
Standby RossetaTM（DE3）Competent cell.20 μ L enzyme connect product things are taken to convert into the 60 super competent cells of μ L DH5 α, gently
Mixing is played in featheriness, and rapid take out after the s of heat shock 90 in 30 min, 42 DEG C of water-baths, thermal shock is placed on ice and is put into ice bath 2 in ice chest
Min, adds the LB culture mediums that 800 μ L contain 50 μ g/mL kalamycin resistances, in culture on 22 DEG C, 200 rpm shaking table
45 min or so, 4 DEG C, 4000 rpm are centrifuged and are taken out 600 μ L of supernatant under 2 min, aseptic condition, and remaining liq blows even, is coated on
On agarose plate containing 50 μ g/mL kalamycin resistances, overnight incubation, picking single bacterium colony contains 50 μ g/mL in 5 mL
In the LB culture mediums of kalamycin resistance, incubated overnight extracts plasmid using plasmid extraction kit, carries out double digestion checking.
The recombinant bacterium for the positive findings verified for double digestion, delivers to sequencing company and carries out further plasmid order-checking.
3）Take the correct recombinant plasmid pET-22b-hPD-L2 of sequencing, conversion to RossetaTM（DE3）In competent cell.
Picking monoclonal, is inoculated in the LB culture mediums that 10 mL contain 50 μ g/mL kanamycins, incubated overnight inoculation liquid, inoculation liquid
According to 1:100 volume ratio is inoculated into the LB culture mediums that 1 L contains 50 μ g/mL kanamycins, in 37 DEG C of concussion and cultivates
2.5-3 h to OD600 nmIt is worth between 0.6-0.8, final concentration of 0.8 mM IPTG to be added, under the conditions of 22 DEG C, 200 rpm
Continue the h of shaken cultivation 8.4 DEG C, 8000 g centrifugation 5 min collection thalline.Using PBS washing thalline twice, Ran Houli
Thalline, ultrasonication is resuspended with 50 mL PBS, broken condition is：The ultrasonic transformer insertion liquid level 1/3rd of Ultrasonic Cell Disruptor
Place, power 10%, work 2 s, stops 3 s, broken to continue 45 min.Sampling is used as broken full bacterium, remaining bacterium after broken end
12000 g centrifuge 10 min at 4 DEG C of body, collect supernatant, discard precipitation, and supernatant with being stored in 4 DEG C of ice after precipitation sampling
Case.
4) SDS-PAGE detects the expression of hPD-L2 albumen：By step 3) in crush full bacterium, supernatant precipitation with
And the sample before induction is handled, loading.Concentration and the constant pressure of protein sample are carried out using the V of constant pressure 100 in electrophoresis process
120 V carry out the separation of protein sample.Electrophoresis is removed gel after finishing and is placed in dyeing liquor, is dyed at 60 DEG C（Examine dye method dye
Color）1 h or so, is put into destainer and is decolourized, and the gel decolourized is taken pictures（As shown in Figure 2）.
5) Ni-NTA posts affinitive layer purification hPD-L2 albumen：
A) 5 mL Ni-NTA fillers are taken to be placed in glass column, the min of natural subsidence 30；
B) 30 mL ddH is utilized2O cleans pillar, then with 30 mL equilibrium liquids（PH 8.5,100 mM Tris-HCl, 300
mM NaCl）Pillar is balanced, the s of flow velocity 3 often drips；
C) hPD-L2 protein samples 13000 g, 4 DEG C of 15 min of centrifugation of post will be treated, supernatant, 0.45 μm of filter membrane is collected
Filtered, treat loading；
D) flow velocity for often dripping the albumen loading after filtering, 2-3 s, collects flow through sample on ice；
E) miscellaneous and elution hPD-L2 albumen, the flow velocity that 3 s often drip are washed with the buffer solution of different imidazole concentrations.
6) by step 5) bag filter that the hPD-L2 recombinant proteins threading obtained has been pre-processed is purified, it is placed in PBS
It is middle to dialyse 3 times.
7) step 6 is taken) protein solution in bag filter, concentration tube concentration is placed in, high concentration is obtained（10 mg/mL）'s
HPD-L2 albumen.
Embodiment 2
Using Western-Blot technology for detection hPD-L2 albumen, concrete operation step is as follows：
1) to the hPD-L2 protein samples obtained after purification, separated using 15% SDS-PAGE, electrophoresis is removed after terminating
Glue, makes " sandwich " shape with pvdf membrane, transferring film is carried out with wet robin；
2) electricity turns to finish, and removes pvdf membrane, and adding 5% BSA-TBST, (albumen is face-down）, swayed in 22 C shaking tables（65
rpm）1 h is closed, to eliminate non-specific background；
3) 5% BSA-TBST is washed in closing off with TBST after terminating, and the PD-L2 antibody of purchase is added as primary antibody, in decolorization swinging table
Sway incubation（60 rpm）1 h or 4 C is incubated overnight（12-16 h）, primary antibody is combined with hPD-L2 protein-specifics；
4) primary antibody is reclaimed, is washed with TBST in shaking table 3 times（60 rpm）, 5 min every time；
5) secondary antibody is added, is incubated in decolorization swinging table（60 rpm）1 h, makes secondary antibody fully be combined with primary antibody；
6) secondary antibody is reclaimed, is washed with TBST in shaking table 3 times（60 rpm）, 5 min every time；
7) ECL colour reagent boxes are used（200 μ L reagent As/+ 200 μ L reagent B/）It is incubated 3 min.Remove reaction solution, turn
Move on preservative film, tabletting developing fixing.Spontaneously dried after fixing, Canon's camera is taken pictures, record experimental result（Such as accompanying drawing 4）.
Embodiment 3
The secondary structure folded situation of hPD-L2 albumen is determined using circular dichroism spectra technology, concrete operation step is as follows：
1) the hPD-L2 albumen of the high-purity of acquisition is diluted to pH of buffer 7.6,20 mM Tris-HCl
In, it is final concentration of：0.5 mg/mL, 12000 g centrifuge 10 min, take supernatant stand-by.
2) circular dichroism spectrometer is opened（CD）, it is stored at room temperature 30 min.
3) by step 1) ready hPD-L2 protein samples are put into quartz colorimetric utensil, are measured,
Spectrogram is recorded, test result indicates that：The hPD-L2 Protein secondary structures of acquisition are folded preferably, and based on β-pleated sheet（As schemed
5）.
SEQUENCE LISTING
<110>University of Fuzhou
<120>A kind of preparation method of people's source program death factors part PD-L2 albumen
<130> 4
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 201
<212> PRT
<213>HPD-L2 amino acid sequences
<400> 1
Leu Phe Thr Val Thr Val Pro Lys Glu Leu Tyr Ile Ile Glu His Gly
1 5 10 15
Ser Asn Val Thr Leu Glu Cys Asn Phe Asp Thr Gly Ser His Val Asn
20 25 30
Leu Gly Ala Ile Thr Ala Ser Leu Gln Lys Val Glu Asn Asp Thr Ser
35 40 45
Pro His Arg Glu Arg Ala Thr Leu Leu Glu Glu Gln Leu Pro Leu Gly
50 55 60
Lys Ala Ser Phe His Ile Pro Gln Val Gln Val Arg Asp Glu Gly Gln
65 70 75 80
Tyr Gln Cys Ile Ile Ile Tyr Gly Val Ala Trp Asp Tyr Lys Tyr Leu
85 90 95
Thr Leu Lys Val Lys Ala Ser Tyr Arg Lys Ile Asn Thr His Ile Leu
100 105 110
Lys Val Pro Glu Thr Asp Glu Val Glu Leu Thr Cys Gln Ala Thr Gly
115 120 125
Tyr Pro Leu Ala Glu Val Ser Trp Pro Asn Val Ser Val Pro Ala Asn
130 135 140
Thr Ser His Ser Arg Thr Pro Glu Gly Leu Tyr Gln Val Thr Ser Val
145 150 155 160
Leu Arg Leu Lys Pro Pro Pro Gly Arg Asn Phe Ser Cys Val Phe Trp
165 170 175
Asn Thr His Val Arg Glu Leu Thr Leu Ala Ser Ile Asp Leu Gln Ser
180 185 190
Gln Met Glu Pro Arg Thr His Pro Thr
195 200
<210> 2
<211> 603
<212> DNA
<213>HPD-L2 nucleotide sequences
<400> 2
ttattcacag tgacagtccc taaggaactg tacataatag agcatggcag caatgtgacc 60
ctggaatgca actttgacac tggaagtcat gtgaaccttg gagcaataac agccagtttg 120
caaaaggtgg aaaatgatac atccccacac cgtgaaagag ccactttgct ggaggagcag 180
ctgcccctag ggaaggcctc gttccacata cctcaagtcc aagtgaggga cgaaggacag 240
taccaatgca taatcatcta tggggtcgcc tgggactaca agtacctgac tctgaaagtc 300
aaagcttcct acaggaaaat aaacactcac atcctaaagg ttccagaaac agatgaggta 360
gagctcacct gccaggctac aggttatcct ctggcagaag tatcctggcc aaacgtcagc 420
gttcctgcca acaccagcca ctccaggacc cctgaaggcc tctaccaggt caccagtgtt 480
ctgcgcctaa agccaccccc tggcagaaac ttcagctgtg tgttctggaa tactcacgtg 540
agggaactta ctttggccag cattgacctt caaagtcaga tggaacccag gacccatcca 600
act 603
<210> 3
<211> 29
<212> DNA
<213>Artificial sequence
<400> 3
ggactgccat atgttcacag tgacagtcc 29
<210> 4
<211> 26
<212> DNA
<213>Artificial sequence
<400> 4
aatctcgagg tcaatgctgg ccaaag 26
Claims (7)
1. a kind of preparation method of people's source program death factors part PD-L2 albumen, it is characterised in that：
A) acquisition by hPD-L2 genes and clone and recombinant plasmid pET-22b-hPD-L2 structure；
B) prepareRosseta TM (DE3) competent cell, recombinant plasmid a) obtained is transferred in the competent cell, obtained
Obtain recombinant bacterial strain；
C) h of recombinant bacterial strain 8 b) obtained is induced under the conditions of 22 DEG C, 200 rpm, 0.8 mM isopropylthiogalactosides,
Obtain the great expression of hPD-L2 albumen；
D) purity higher hPD-L2 recombinant proteins c) are obtained using the purifying of Ni-NTA posts affinity chromatography；To weight after purification
Histone is concentrated using concentration tube, obtains the hPD-L2 recombinant proteins of high concentration.
2. a kind of preparation method of people's source program death factors part PD-L2 albumen according to claim 1, its feature
It is：Specific method includes as follows：
1) the total length encoding gene using people's source program death factors part PD-L2 utilizes PCR skills as template
Art obtains the whole extracellular fragment genes of hPD-L2, utilizesNdeI withXhoI restriction enzymes are while double digestion PCR primer
With carrier pET-22b, it is attached using T4 DNA ligases, obtains connection product；
2) DH5 α competent cells are prepared, connection product is converted to DH5 α competent cells, picking positive colony, public affairs are delivered to
Department carries out gene sequencing, is sequenced successfully, obtains pET-22b-hPD-L2 recombinant plasmids；
3) prepareRosseta TM (DE3) competent cell, by step 2) the pET-22b-hPD-L2 recombinant plasmids that obtain turn
Change extremelyRosseta TM (DE3) in competent cell, the single bacterium colony of recombinant bacterium is obtained；
4) picking single bacterium colony, contains the LB of 50 μ g/mL kanamycins and 35 μ g/mL chloramphenicol in 10 mL
Culture medium, incubated overnight obtains inoculation liquid under the conditions of 37 DEG C, and inoculation liquid is according to 1：100 volume ratio accesses 1 L and contained
In the LB culture mediums of 50 μ g/mL kanamycins and 35 μ g/mL chloramphenicol, culture to OD600 nmIt is worth between 0.6-0.8, so
The IPTG for adding final concentration of 0.8 mM afterwards induces 8 h in 22 DEG C, collects thalline；
5) above-mentioned thalline is resuspended in lysis buffer PBS, ultrasonication, centrifuged, collect supernatant；
6) by step 5) obtain supernatant, utilize Ni-NTA posts affinity chromatography purifying；
7) by step 6) in collect destination protein eluent put into bag filter in, utilize PBS carry out albumen dialysis；
8) by step 7) in dialyse after hPD-L2 protein liquids be placed in concentration tube concentrate, obtain high concentration hPD-L2 albumen.
3. a kind of preparation side of people's source program death factors part PD-L2 albumen according to claim 2
Method, it is characterised in that：The genetic fragment length of the hPD-L2 is 600 bp, encodes 200 amino acid.
4. a kind of preparation side of people's source program death factors part PD-L2 albumen according to claim 2
Method, it is characterised in that：The step 2) in connection product and DH5 α competent cells volume ratio be 1：3；The step
3) in recombinant plasmid andRosseta TM (DE3) competent cell volume ratio is 1：60.
5. a kind of preparation side of people's source program death factors part hPD-L2 albumen according to claim 2
Method, it is characterised in that：The step 5) in contain in lysis buffer PBS：122 mM NaCl, 2.7 mM KCl, 10
mM Na2HPO4, 2 mM KH2PO4, pH 7.4.
6. people's source program death factors part hPD-L2 albumen its feature that method as claimed in claim 1 or 2 is prepared
It is：The Argine Monohydrochloride and nucleotide sequence are as shown in SEQ ID NO.1-2.
7. albumen as claimed in claim 6 is preparing the application of tumor.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710592911.1A CN107253988B (en) | 2017-07-19 | 2017-07-19 | Preparation method of human programmed death factor ligand PD-L2 protein |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710592911.1A CN107253988B (en) | 2017-07-19 | 2017-07-19 | Preparation method of human programmed death factor ligand PD-L2 protein |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107253988A true CN107253988A (en) | 2017-10-17 |
| CN107253988B CN107253988B (en) | 2021-01-29 |
Family
ID=60025249
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710592911.1A Active CN107253988B (en) | 2017-07-19 | 2017-07-19 | Preparation method of human programmed death factor ligand PD-L2 protein |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107253988B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110713545A (en) * | 2019-09-11 | 2020-01-21 | 潍坊医学院 | Human-derived programmed cell death factor receptor protein-1 and production method and application thereof |
| CN116162674A (en) * | 2023-02-21 | 2023-05-26 | 山东大学 | Preparation method of 6-hydroxy-flavin adenine dinucleotide and application of 6-hydroxy-flavin adenine dinucleotide as iron death inhibitor |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1297135A2 (en) * | 2000-06-28 | 2003-04-02 | Genetics Institute, LLC | Pd-l2 molecules: novel pd-1 ligands and uses therefor |
| CN104436190A (en) * | 2005-06-08 | 2015-03-25 | 达纳-法伯癌症研究院公司 | Methods and compositions for the treatment of persistent infections and cancer by inhibiting the programmed cell death 1 (PD-1) pathway |
| CN106928361A (en) * | 2015-12-31 | 2017-07-07 | 上海抗体药物国家工程研究中心有限公司 | A kind of monoclonal antibody of anti-human PD-1 and its preparation method and application |
-
2017
- 2017-07-19 CN CN201710592911.1A patent/CN107253988B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1297135A2 (en) * | 2000-06-28 | 2003-04-02 | Genetics Institute, LLC | Pd-l2 molecules: novel pd-1 ligands and uses therefor |
| CN104436190A (en) * | 2005-06-08 | 2015-03-25 | 达纳-法伯癌症研究院公司 | Methods and compositions for the treatment of persistent infections and cancer by inhibiting the programmed cell death 1 (PD-1) pathway |
| CN106928361A (en) * | 2015-12-31 | 2017-07-07 | 上海抗体药物国家工程研究中心有限公司 | A kind of monoclonal antibody of anti-human PD-1 and its preparation method and application |
Non-Patent Citations (2)
| Title |
|---|
| 何贤辉等: "人PD-L2基因克隆及其在大肠杆菌中的表达", 《免疫学杂志》 * |
| 李儒曙等: "猪瘟兔化弱毒株E2蛋白ABCD抗原结构域在大肠杆菌BL21(DE3)和Rosseta(DE3)中的表达及鉴定", 《中国动物传染病学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110713545A (en) * | 2019-09-11 | 2020-01-21 | 潍坊医学院 | Human-derived programmed cell death factor receptor protein-1 and production method and application thereof |
| CN110713545B (en) * | 2019-09-11 | 2021-10-22 | 潍坊医学院 | Human-derived programmed cell death factor receptor protein-1 and production method and application thereof |
| CN116162674A (en) * | 2023-02-21 | 2023-05-26 | 山东大学 | Preparation method of 6-hydroxy-flavin adenine dinucleotide and application of 6-hydroxy-flavin adenine dinucleotide as iron death inhibitor |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107253988B (en) | 2021-01-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107253988A (en) | A kind of preparation method of people's source program death factors part PD L2 albumen | |
| CN106543272A (en) | Multifunctional label fusion protein and its expression and application | |
| CN111875676A (en) | P49 mutant protein of African swine fever virus immunogen, recombinant vector, Escherichia coli genetic engineering bacteria, preparation method and application | |
| CN107973857B (en) | Recombinant fusion protein based on bacterial surface display system and application thereof | |
| CN107200776B (en) | Echinococcus granulosus antigen cC1 recombinant protein and soluble expression method and purification method thereof | |
| CN107236027B (en) | Echinococcus granulosus TSP1 recombinant protein and soluble expression method and purification method thereof | |
| CN107936123B (en) | Swine transmissible gastroenteritis virus fusion protein and preparation method and application thereof | |
| CN104877011A (en) | Protein transduction domain derived from fish nervous necrosis virus as well as preparation method and use of protein transduction domain | |
| CN104862331B (en) | A kind of method of solubility expression Rhodococcus equi Disease-causing gene VapA albumen | |
| CN112730829B (en) | Colloidal gold test strip for rapidly detecting oyster herpesvirus OsHV-1 and application thereof | |
| CN111471112B (en) | Rabies virus recombinant antigen and preparation method and application thereof | |
| CN115073559A (en) | Prokaryotic soluble expression method and application of recombinant African swine fever virus EP153R subunit transmembrane protein | |
| CN107201348B (en) | Echinococcus granulosus Sigma-glutathione S-transferase recombinant protein and soluble expression method and purification method thereof | |
| CN108359680A (en) | Recombinant plasmid, genetic engineering bacterium containing human cytomegalovirus UL146 genes and its application | |
| CN110004170A (en) | The recombinant plasmid of the gene of SMIM25 containing someone, genetic engineering bacterium, recombinant protein, more anti-and preparation method and application | |
| CN112341525A (en) | Recombinant African swine fever virus pE120R subunit soluble protein and preparation method and application thereof | |
| CN107056915A (en) | Echinococcus granulosus TSP6 recombinant proteins and its solubility expression method and purification process | |
| CN111378016A (en) | Subunit H protein of peste des petits ruminants virus, preparation method and application thereof | |
| CN109897092A (en) | A kind of solvable preparation method of blue tongue virus NS3 gene | |
| CN112812192B (en) | ProA/G-dRep fusion protein serving as nucleic acid-antibody conjugate universal carrier and application thereof | |
| CN111499696B (en) | Anti-tumor protein ILAP1, and preparation and application thereof | |
| CN114409804B (en) | Escherichia coli enterotoxin multi-epitope fusion protein and preparation method and application thereof | |
| CN111499695B (en) | Functional protein MU20410, its coding sequence and application | |
| CN114836368B (en) | Mitochondria purification kit | |
| CN111909949B (en) | Preparation method and application of recombinant protein HSP70_5 of Sporothrix globosum |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |