CN107056915A - Echinococcus granulosus TSP6 recombinant proteins and its solubility expression method and purification process - Google Patents
Echinococcus granulosus TSP6 recombinant proteins and its solubility expression method and purification process Download PDFInfo
- Publication number
- CN107056915A CN107056915A CN201710391545.3A CN201710391545A CN107056915A CN 107056915 A CN107056915 A CN 107056915A CN 201710391545 A CN201710391545 A CN 201710391545A CN 107056915 A CN107056915 A CN 107056915A
- Authority
- CN
- China
- Prior art keywords
- tsp6
- echinococcus granulosus
- recombinant proteins
- medium
- nacl
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43536—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from worms
- C07K14/4355—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from worms from cestodes
- C07K14/43554—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from worms from cestodes from Taenia
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/43504—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from invertebrates
- G01N2333/43526—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from invertebrates from worms
- G01N2333/43539—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from invertebrates from worms from cestodes
- G01N2333/43543—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from invertebrates from worms from cestodes from Taenia
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Plant Pathology (AREA)
- Pathology (AREA)
- General Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- Cell Biology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
Abstract
The present invention provides Echinococcus granulosus TSP6 recombinant proteins, and the amino acid sequence of the Echinococcus granulosus TSP6 recombinant proteins is sequence table SEQ ID No.2.Present invention also offers a kind of solubility expression method, the solution expression with high efficiency of TSP6 recombinant proteins is realized：The recombinant protein of expression is largely soluble protein, accounts for bacterium coli solubility total protein 70%；Then HisPur Cobalt are used（Clontech）Affinitive layer purification recombinates Echinococcus granulosus TSP6, obtains TSP6 purifying proteins.Using elution buffer（300mM/L imidazoles, 20mM/L Tris, 500mM/L NaCl, pH8.0）When can obtain the Echinococcus granulosus TSP6 of high-purity a kind of.Using the purifying protein as envelope antigen, a kind of ELISA kit for being used to detect echinococcosis granulosa can be prepared.
Description
Technical field
The invention belongs to gene engineering technology field, and in particular to Echinococcus granulosus TSP6 recombinant proteins and its solubility
Expression and purification process.
Background technology
Transmembrane protein 6（TSP6）It is an antigen gene in Echinococcus granulosus Schistosoma japonicum.TSP6 is a kind of
Important Echinococcus granulosus antigen, may take part in Echinococcus granulosus signal transduction path, growth, differentiation for cell
With important physiological significance.TSP6 is probably homologous gene with annexin family (Annexin family) member, is belonged to
Annexin families.The physiological function of the antigen is studied, not only it will be seen that it is for the parasitic of Echinococcus Granulosus Cysts, growth, hair
The significance in vital movement such as educate, new drug target and candidate vaccine can also be provided to treat and prevent echinococcosis.
Based on above research background, the present invention constructs the prokaryotic expression plasmid of coding Echinococcus granulosus TSP6 genes, is transformed into big
Enterobacteria expression system, induces its solubility expression, and carries out protein purification, has obtained the albumen, is its immunogene from now on
Property, Analysis of Biochemical Characteristics and functional study are laid a good foundation.
The content of the invention
There is provided a kind of Echinococcus granulosus TSP6 prokaryotic expression carrier by technique for gene engineering by the present invention
PET30a-TSP6, Escherichia coli are converted using the carrier（BL21-DE3）TSP6 high-level solubility expression is realized, and is carried
A kind of affinity chromatographic purification process has been supplied, the restructuring TSP6 of substantial amounts of high-purity has been purified into, for TSP6 immunogenicities, biochemistry
Specificity analysis and functional study, anti-Echinococcus hydatid cyst vaccine, the research and development of anti-hydatid drugs and the immunodiagnosis of cystic echinococcosis patient.
The present invention provides Echinococcus granulosus TSP6 recombinant proteins, the amino of the Echinococcus granulosus TSP6 recombinant proteins
Acid sequence is sequence table SEQ ID No.2.
Preferably, the nucleotides sequence of the Echinococcus granulosus TSP6 recombinant proteins coding is classified as sequence table SEQ ID
31st -696 bit bases in No.1.
The present invention also provides the solubility expression of above-mentioned Echinococcus granulosus TSP6 recombinant proteins, and step is as follows：
（1）Target gene TSP6 amplification；
（2）Build TSP6 expression plasmids：By step（1）Target gene TSP6 digestions of preparation and after purification, are built into pET-30a
Corresponding polyclone enzyme enzyme site, builds plasmid pET30a-TSP6；
（3）By step（2）The plasmid pET30a-TSP6 of preparation is transformed intoE.Coli, will in BL21 (DE3) competent cellE.ColiBL21 (DE3)-pET30a-TSP6 is enlarged culture, then adds 0.1 mmol/L IPTG in 18 DEG C, 120
R/min induction shaken cultivations 6 h；Bacterium is collected by centrifugation, ultrasound collects supernatant.
Preferably, step（3）Described in expand culture be byE.ColiBL21 (DE3)-pET30a-TSP6 is first inoculated with
To LB solid mediums, 37 DEG C of overnight incubations；Then monoclonal is into LB fluid nutrient mediums on picking culture medium, in 37 DEG C,
200r/min shaken cultivations 2 hours, make OD values to 0.6；Bacterium solution is finally taken to be seeded in LB fluid nutrient mediums, in 37 DEG C, 200r/
Min shaken cultivations, make OD values to 0.6.
The present invention also provides the purification process of above-mentioned Echinococcus granulosus TSP6 recombinant proteins, is to use HisTALONTM
Gravity Columns prepacked columns purify Echinococcus granulosus TSP6 recombinant proteins, are then eluted using elution buffer；
The formula of the elution buffer is：300mM/L imidazoles, 20mM/L Tris, 500mM/L NaCl, pH8.0.
Preferably, step is as follows：
（1）Add 20 mM MES buffer solutions scouring media in HisPur Cobalt prepacked columns；
（2）Ultra-pure water is added, the medium for making it slowly flow through filling in prepacked column；
（3）Combination buffer is added, it is slowly flowed across medium in post；The formula of the combination buffer is：20mM/L
Tris, 500mM/L NaCl, 20mM/L imidazoles, pH8.0；
（4）Loading, adds ultrasonicationE.ColiThe supernatant that BL21 (DE3)-pET30a- TSP6 are extracted, shake makes albumen
Combined with the medium filled in prepacked column, after centrifugation, supernatant is slowly flowed across medium in post；
（5）Combination buffer is added, shake is allowed to fully be combined with albumen, liquid is slowly flowed across medium in post；It is described
The formula of combination buffer is：20mM/L Tris, 500mM/L NaCl, 20mM/L imidazoles, pH8.0；
（6）No. 1 eluent is added, it is slowly flowed across medium in post；The formula of No. 1 eluent is：50 mM/L imidazoles,
20 mM/L Tris, 500 mM/L NaCl, pH8.0；
（7）No. 2 eluents are added, it is slowly flowed across medium in post；The formula of No. 2 eluents is：100 mM/L miaows
Azoles, 20 mM/L Tris, 500 mM/L NaCl, pH8.0；
（8）No. 3 eluents are added, it is slowly flowed across medium in post；The formula of No. 3 eluents is：200 mM/L miaows
Azoles, 20 mM/L Tris, 500 mM/L NaCl, pH8.0；（9）No. 4 eluents are added, it is slowly flowed across medium in post, are received
Collect eluent；The formula of No. 4 eluents is 300mM/L imidazoles, 20mM/L Tris, 500mM/L NaCl, pH8.0.
Preferably, the ultrasonicationE.ColiSupernatant and elution that BL21 (DE3)-pET30a- TSP6 are extracted
The volume ratio of buffer solution is 1:2.
The present invention also provides above-mentioned Echinococcus granulosus TSP6 recombinant proteins and is preparing the ELISA of detection echinococcosis granulosa
Application in kit.
The present invention, which also provides to be coated with a kind of ELISA kit for detecting echinococcosis granulosa, the ELISA kit, to be resisted
Originally it was the Echinococcus granulosus TSP6 recombinant proteins described in claim 1 or 2.
Preferably, the envelope antigen is diluted to the μ g/ of final concentration 5 with pH 9.6 0.05M/L carbonate buffer solutions
ml；
Preferably, the kit also includes confining liquid, the confining liquid is the TBST containing 5% skimmed milk power, the percentage
The unit of ratio is g/ml.
The invention provides a kind of Echinococcus granulosus transmembrane protein 6（TSP6）Gene, additionally provides Echinococcus granulosus
The protein of TSP6 coded by said gene, and there is provided a kind of Echinococcus granulosus TSP6 prokaryotic expression carrier pET30a-TSP6.
Using carrier conversion Escherichia coli (BL21-DE3), in lower temperature, relatively low inducer concentrations and shorter induction time condition
Lower induction bacterium, can be achieved TSP6 solution expression with high efficiency：The recombinant protein of expression is largely soluble protein, accounts for big
Enterobacteria total soluble protein 70%.Then HisPur Cobalt are used（Clontech）Affinitive layer purification recombinates particulate spine ball silk ribbon
Worm TSP6, obtains TSP6 purifying proteins, is using elution buffer（300mM/L imidazoles, 20mM/L Tris, 500mM/L
NaCl, pH8.0）When can obtain a kind of Echinococcus granulosus TSP6 of new high-purity.TSP6 expression of recombinant proteins amounts are very high, no
Large-scale culture bacterium is needed, and in solubility expression under specific inductive condition, the operation for purifying the albumen is comparatively simple,
Cost is also very low, easily reuses.Recombinant protein prepared by the present invention can be used for the immune of cystic echinococcosis patient and examine
Disconnected, it can recognize when being detected applied to indirect ELISA, possess higher as immunizing antigen by bladder type patients with hydatidosis serum
Specificity and sensitivity, clinical detection coincidence rate is up to 85%.
Brief description of the drawings
Accompanying drawing is used for providing a further understanding of the present invention, and constitutes a part for specification, the reality with the present invention
Applying example is used to explain the present invention together, is not construed as limiting the invention.In the accompanying drawings：
Fig. 1 is Echinococcus granulosus TSP6 gene PCR amplified production electrophoresis results；
Fig. 2 is prokaryotic expressions of the Echinococcus granulosus TSP6 under different inductive conditions；
Fig. 3 is Echinococcus granulosus TSP6 affinitive layer purification results.
Embodiment
Following embodiment facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments
Method, is conventional method unless otherwise specified.Test material used, is city unless otherwise specified in following embodiments
Sell.
The protein sequence of the Echinococcus granulosus TSP6 gene orders of embodiment one and its coding
916 nucleotides of Echinococcus granulosus TSP6 total lengths, maximum ORFs（ORF）Positioned at 31-696, containing 666bp,
Initiation codon is atg, and terminator codon is taa, encodes the amino acid sequence of 221 amino acid, its nucleotide sequence and coding
Row are shown in sequence table SEQ ID No.1 and 2 respectively.
Nucleotide sequence：
Amino acid sequence：
The Echinococcus granulosus TSP6 of embodiment two prokaryotic expression carrier pET30a-TSP6 clone builds
1. target gene TSP6 amplification
With the SK-TSP6 of Echinococcus granulosus pBluescript II（The SK-TSP6 of Echinococcus granulosus pBluescript II are from sea
Southern medical college's parasitology teaching and research room obtains, and the public can also obtain from the teaching and research room）For template, according to Echinococcus granulosus
TSP6 gene orders design following two pairs of primers：
Upstream primer sequence is：GGCGGATCCATGGTTCTGAC, containsBamHI restriction enzyme sites,
Downstream primer sequence is：GCGTCGACTTAGGCACTCCG, containsSalI restriction enzyme sites.
Expand the maximum ORFs of TSP6 genes（ORF）In gene order（That is 31-696 gene order）, PCR
Reaction condition：96 DEG C of pre-degeneration 5min；96 DEG C of denaturation 30s, 66 DEG C of renaturation 40s, 72 DEG C of extension 60s, 25 circulations；72 DEG C of extensions
10min.Amplified production electrophoresis result is shown in Fig. 1.
Fig. 1 is Echinococcus granulosus TSP6 gene PCR amplified production electrophoresis results；Wherein, M, Marker III；1, TSP6
Pcr amplification product.
2. build TSP6 expression plasmids
After PCR primer is purified, amplification obtains fragment quiltBamHI andSalI digestions and after purification, are built into pET-30a corresponding
Polyclone enzyme enzyme site, build plasmid pET30a-TSP6, through sequencing identification, TSP6 sequence information and target gene sequence
Unanimously：Nucleotides sequence is classified as 31-696 bit bases in sequence table SEQ ID No.1, encodes 221 amino acid, the amino of coding
Acid sequence is sequence table SEQ ID No.2.
The Echinococcus granulosus TSP6 of embodiment three prokaryotic expression
Under different inductive conditions, the amount of soluble expression of recombinant protein is different, is below optimal abductive approach：
PrepareE.ColiBL21 (DE3) competent cell, the plasmid pET30a-TSP6 that embodiment 2 is prepared is transformed intoE.ColiIn BL21 (DE3) competent cell, streak inoculationE.ColiBL21 (DE3)-pET30a-TSP6 to LB solids train
Support on base, 37 DEG C of overnight incubations；Monoclonal is into 5ml LB fluid nutrient mediums on picking culture medium, and in 37 DEG C, 200r/min shakes
Culture 2 hours is swung, makes OD values to 0.6；2ml bacterium solutions are taken to be seeded in 300ml LB fluid nutrient mediums, in 37 DEG C, 200r/min
Shaken cultivation, makes OD values to 0.6；Add IPTG（0.1 mmol/L）In 18 DEG C, 120 r/min inductions shaken cultivation 6 hours；4
DEG C 12000g/min, centrifugation 10min collects bacterium；Carried after ultrasonication bacterium, power 150W, ultrasonic 6s, interval 6s, 35min
Supernatant is taken, and carries out SDS-PAGE electrophoresis, it is seen that albumen expression quantity in supernatant is very high, in solubility expression（See Fig. 2）.Weight
Histone matter is largely soluble protein, accounts for bacterium coli solubility total protein 70%.
In order to search out optimal inductive condition, applicant carried out many experiments, Fig. 2 is Echinococcus granulosus TSP6 not
Prokaryotic expression under the conditions of isogeneous induction.
Wherein, in A figures, M：Marker ；1-4, BL21（DE3）- pET30a- TSP6 in 37 DEG C, IPTG is respectively 1,
0.5th, the electrophoretogram of supernatant after 0.25,0.1 mmol/L, 18 h of induction；
In B figures, M：Marker ；1-4, BL21（DE3）- pET30a- TSP6 in 30 DEG C, IPTG is respectively 1,0.5,0.25,
The electrophoretogram of supernatant after 0.1 mmol/L, 12 h of induction；
In C figures, M：Marker ；1-4, BL21（DE3）- pET30a- TSP6 in 25 DEG C, IPTG is respectively 1,0.5,0.25,
Supernatant after 0.1 mmol/L, 12 h of induction；
In D figures, M：Marker ；1-3, BL21（DE3）- pET30a- TSP6 are in 18 DEG C, and IPTG is respectively 0.5,0.25,0.1
Supernatant after mmol/L, 6 h of induction.
As seen from Figure 2, it is 37 DEG C in inducing temperature, IPTG is respectively 1,0.5,0.25,0.1 mmol/L, induces 18 h
Afterwards, the TSP6 in solubility expression is had no in supernatant；Inducing temperature is down to 30 DEG C, IPTG is respectively 1,0.5,0.25,0.1
After mmol/L, 12 h of induction, the TSP6 in solubility expression is had not yet to see in supernatant；Inducing temperature is further reduced to 25 DEG C,
IPTG is respectively 1,0.5,0.25,0.1 mmol/L, and after 12 h of induction, the TSP6 in solubility expression is had not yet to see in supernatant；
Inducing temperature is down to 18 DEG C by continuation, and IPTG is respectively 0.5,0.25,0.1 mmol/L, after induction 6h, it is seen that use 0.1 mmol/
The TSP6 in solubility expression is occurred in that after L IPTG inductions in supernatant, and expression quantity is very high, accounts for bacterium coli solubility total
70% or so of albumen, thus using this condition as TSP6 protokaryon induced expressions optimal conditions.
Example IV Echinococcus granulosus TSP6 affinitive layer purification
Using HisPur Cobalt（Clontech）Purification system purifies destination protein.HisTALONTM Gravity
Columns prepacked columns are purchased from Japan Clontech companies, model：635655.
When various materials are added dropwise, rate of addition is 1 drop/15 seconds.
The purification effect difference for the recombinant protein that different purification process is obtained to purification process, it is necessary to optimize.With
It is part optimization process down：
20ml ultra-pure waters are added in HisTALONTMIn Gravity Columns prepacked columns, it is set slowly to flow through filling in post
Medium；Add 20ml combination buffers（50mM/L NaH2PO4, 300mM/L NaCl, pH8.0）, it is slowly flowed through post
The medium of interior filling；Loading, adds 4ml and passes through ultrasonicationE.ColiThe supernatant that BL21 (DE3)-pET30a- TSP6 are extracted
Liquid, coutroi velocity makes it slowly flow across in post medium and collect；Add 40ml wash buffers（50mM/L NaH2PO4,
300mM/L NaCl, 20mM/L imidazoles, pH8.0）, coutroi velocity makes it slowly flow across medium in post, to elute foreign protein；Add
100 mM/L imidazole elutions（100 mM/L imidazoles, 50mM/L NaH2PO4, 300mM/L NaCl, pH8.0）2ml, delays it
Slug flow is crossed in post medium and collected；Add 200 mM/L imidazole elutions（200mM/L imidazoles, 50mM/L NaH2PO4,
300mM/L NaCl, pH8.0）2ml, makes it slowly flow across in post medium and collect；Add 300mM/L imidazole elutions（300
MM/L imidazoles, 50mM/L NaH2PO4, 300mM/L NaCl, pH8.0）2ml, makes it slowly flow across in post medium and collect；Plus
Enter 400 mM/L imidazole elutions（400 mM/L imidazoles, 50mM/L NaH2PO4, 300mM/L NaCl, pH8.0）2ml, makes it
Slowly flow across in post medium and collect；Add 500 mM/L imidazole elutions（500 mM/L imidazoles, 50mM/L NaH2PO4,
300mM/L NaCl, pH8.0）2ml, makes it slowly flow across in post medium and collect.The eluent of collection is subjected to SDS- respectively
PAGE is analyzed, and checks the degree of purification of albumen, the A figures seen in Fig. 3.
Fig. 3 is Echinococcus granulosus TSP6 affinitive layer purification results.
Wherein, in A figures, M：Marker；1, BL21（DE3）- pET30a- TSP6 supernatants are as former state；2, albumen loading crosses post
After flow through liquid；3,100 mM/L imidazole elutions；4,200 mM/L imidazole elutions；5,300 mM/L imidazole elutions；6,
400 mM/L imidazole elutions；7,500 mM/L imidazole elutions.
From the A figures in Fig. 3：Respectively with 100 mM/L, 200 mM/L, 300 mM/L, 400 mM/L, 500 mM/L miaows
Azoles eluent can elute destination protein, but simultaneously also elute foreign protein, and purification effect is bad, therefore enter
One-step optimization protein purification condition, is purified using following methods.
Add the mM MES of 30ml 20（2-（N- morpholines）- ethyl sulfonic acid, pH 5.0）Buffer solution is in HisTALONTM
Scouring media in Gravity Columns prepacked columns；30ml ultra-pure waters are added, the medium for making it slowly flow through filling in post；
Add 10ml Tris- combination buffers（20mM/L Tris, 500mM/L NaCl, 20mM/L imidazoles, pH8.0）, coutroi velocity
It is set to slowly flow across medium in post；Loading, adds 5ml and passes through ultrasonicationE.ColiBL21 (DE3)-pET30a- TSP6 are carried
The supernatant taken, coutroi velocity makes it slowly flow across medium in post；Add 20ml Tris- combination buffers（20mM/L Tris,
500mM/L NaCl, 20mM/L imidazoles, pH8.0）, coutroi velocity makes liquid slowly flow across medium in post；Add No. 1 eluent
（50 mM/L imidazoles, 20 mM/L Tris, 500 mM/L NaCl, pH8.0）2 ml, make it slowly flow across in post medium and receive
Collection；Add No. 2 eluents（100 mM/L imidazoles, 20 mM/L Tris, 500 mM/L NaCl, pH8.0）2 ml, make its slow
Flow through in post medium and collect；Add No. 3 eluents（200 mM/L imidazoles, 20 mM/L Tris, 500 mM/L NaCl,
pH8.0）2 ml, make it slowly flow across in post medium and collect；Add No. 4 eluents（300 mM/L imidazoles, 20 mM/L
Tris, 500 mM/L NaCl, pH8.0）2 ml, make it slowly flow across in post medium and collect.The eluent of collection is entered respectively
Row SDS-PAGE is analyzed, and checks the degree of purification of albumen.It can be seen that can obtain purity highest TSP6 using No. 4 elutions
（See Fig. 3 B）, the molecular weight of albumen is about 24.42KD.The B figures that SDS-PAGE results are shown in Fig. 3.
In B figures in figure 3, M：Marker ；1, BL21（DE3）- pET30a- TSP6 supernatants are as former state；2, albumen loading
Cross and liquid is flowed through after post；3, No. 1 eluents；4, No. 2 eluents；5, No. 3 eluents；6, No. 4 eluents（Purification effect is preferably, pure
Spend highest）.
Embodiment five detects the ELISA kit of echinococcosis granulosa
Detecting the ELISA kit of echinococcosis granulosa includes following components：
1st, envelope antigen：The recombinant protein of the purifying obtained using embodiment 4 is envelope antigen, with pH 9.6 0.05M/L carbonic acid
The recombinant protein of salt buffer dilution purifying is to the μ g/ml of final concentration 5；
2nd, confining liquid：5 g skimmed milk powers are dissolved in 100 ml TBST；
3rd, negative control：Healthy Human Serum, 1:200 dilutions；
4th, ELIAS secondary antibody：The goat anti-human igg of peroxidase labelling, 1:10000 dilutions；
5th, TMB nitrite ions；
6th, terminate liquid：The 2 mol/L concentrated sulfuric acids.
The Echinococcus granulosus antigen TSP6 of embodiment six ELISA detections
Using recombinant protein after purification as antigen, to 20 parts of infection hydatidosis human serum samples and 20 parts of Healthy Human Serum samples
Product carry out indirect ELISA detection.Specific method is as follows：
The recombinant protein purified with pH 9.6 0.05M/L carbonate buffer solutions dilution is to the μ g/ml of final concentration 5, per hole 200
μ l are coated with 96 hole elisa Plates, and 4 DEG C overnight；Liquid in hole is got rid of, with pH 7.4 PBST board-washings 3 times (5 min/ times)
200 μ l confining liquids are added per hole afterwards（5 g skimmed milk powers are dissolved in 100 ml TBST）, 37 DEG C are closed 1 hour.PBST board-washings
3 times (5 min/ times), Echinococcus Granulosus Cysts patient and Healthy Human Serum are separately added into per the μ l of hole 100（1: 200 dilution）,
37 DEG C incubate 1 hour；PBST board-washings 3 times, the goat anti-human igg of peroxidase labelling is added per the μ l of hole 100（ 1：
10000 dilutions）, 37 DEG C incubate 1 hour；PBST board-washings 3 times, TMB nitrite ions, 37 DEG C of lucifuge reactions are added per the μ l of hole 100
30 minutes, 2 mol/L concentrated sulfuric acid terminating reactions are added per the μ l of hole 50, absorbance is determined（）Value.With Healthy Human SerumThe extraordinarily standard deviation of average 2 is positive cutoff value.As shown in table 1, TSP6 is to Echinococcus Granulosus Cysts patient for ELISA testing results
The diagnostic sensitivity of serum is 90%（18/20）, there is preferable Immunodiagnosis to echinococcosis granulosa.
The Echinococcus granulosus TSP6 ELISA testing results of table 1
Finally it should be noted that：The preferred embodiments of the present invention are the foregoing is only, are not intended to limit the invention, although
The present invention is described in detail with reference to the foregoing embodiments, for those skilled in the art, it still can be right
Technical scheme described in foregoing embodiments is modified, or carries out equivalent substitution to which part technical characteristic.It is all
Within the spirit and principles in the present invention, any modification, equivalent substitution and improvements made etc. should be included in the protection of the present invention
Within the scope of.
Sequence table
<110>Lanzhou University
<120>Echinococcus granulosus TSP6 recombinant proteins and its solubility expression method and purification process
<210> 1
<211> 916
<212> DNA
<213>Echinococcus granulosus TSP6 nucleotide sequences
<400> 1
cggggacaca ttaggacgat cggagcgacc atggttctga catgcggaga gcagtgcctt 60
cgaattctac tcgttgtgtg caatcttttc gtcttcttat ttggatgtat atgcactgga 120
tttgcggcgt acacgttggc caaagttagg gaatacacga gcgatcaagg ggctctcatc 180
gttcctgctt ttatcctcac tttagtgctg ttaatactta tcctcggctt tctggggtgc 240
tgtggcgctt ggaaactcaa ttcatgctgt ctcaaaacgt acgcgattat tatcaccatt 300
ctgatcataa ttgaagtcat ctgcggaatt ctcattctcg tttaccacga caagggtaaa 360
gactttattg ccaagttctt gaggcaatgc atcagagagg cggaagttcc tggcaataca 420
gacatggaag atatgatgag aaatctgcaa gaaaagtttg agtgttgtgg cgcagatgga 480
ccctcagatt ggcagaaccc aggcaattac tgctccagac ctgacaaccc catatcccag 540
ttctcgtcat tcttcaagcg gggttgcgcg gacgctatct acgaatacct gcgaagccat 600
gcaatcgtgg taggagtgac agcaattgtg ctttccatcg ttgagatcgg tgcagtcttc 660
gccgcctgct gtttggccgg caagcggagt gcctaactac ggtaaagaga cgagcctcgt 720
gactgcctcc gcgggaagga gagaaataat gtgctaccat tcaattcgct taaccacaca 780
atttataatt ataacctctc atgtttaatt agttctattg ctattcacgc ttaactggcc 840
acatacataa ttgcacccgc aaaaaaaaaa aaaaaaaaca tgtcggccgc ctcggcctat 900
gtgcggccgc caccgc 916
<210> 2
<211> 221
<212> PRT
<213>Echinococcus granulosus TSP6 recombinant proteins
<400> 2
Met Val Leu Thr Cys Gly Glu Gln Cys Leu Arg Ile Leu Leu Val Val
1 5 10 15
Cys Asn Leu Phe Val Phe Leu Phe Gly Cys Ile Cys Thr Gly Phe Ala
20 25 30
Ala Tyr Thr Leu Ala Lys Val Arg Glu Tyr Thr Ser Asp Gln Gly Ala
35 40 45
Leu Ile Val Pro Ala Phe Ile Leu Thr Leu Val Leu Leu Ile Leu Ile
50 55 60
Leu Gly Phe Leu Gly Cys Cys Gly Ala Trp Lys Leu Asn Ser Cys Cys
65 70 75 80
Leu Lys Thr Tyr Ala Ile Ile Ile Thr Ile Leu Ile Ile Ile Glu Val
85 90 95
Ile Cys Gly Ile Leu Ile Leu Val Tyr His Asp Lys Gly Lys Asp Phe
100 105 110
Ile Ala Lys Phe Leu Arg Gln Cys Ile Arg Glu Ala Glu Val Pro Gly
115 120 125
Asn Thr Asp Met Glu Asp Met Met Arg Asn Leu Gln Glu Lys Phe Glu
130 135 140
Cys Cys Gly Ala Asp Gly Pro Ser Asp Trp Gln Asn Pro Gly Asn Tyr
145 150 155 160
Cys Ser Arg Pro Asp Asn Pro Ile Ser Gln Phe Ser Ser Phe Phe Lys
165 170 175
Arg Gly Cys Ala Asp Ala Ile Tyr Glu Tyr Leu Arg Ser His Ala Ile
180 185 190
Val Val Gly Val Thr Ala Ile Val Leu Ser Ile Val Glu Ile Gly Ala
195 200 205
Val Phe Ala Ala Cys Cys Leu Ala Gly Lys Arg Ser Ala
210 215 220
Claims (10)
1. Echinococcus granulosus TSP6 recombinant proteins, it is characterised in that：The amino of the Echinococcus granulosus TSP6 recombinant proteins
Acid sequence is sequence table SEQ ID No.2.
2. Echinococcus granulosus TSP6 recombinant proteins according to claim 1, it is characterised in that：The Echinococcus granulosus
The nucleotides sequence of TSP6 recombinant proteins coding is classified as the 31st -696 bit bases in sequence table SEQ ID No.1.
3. the solubility expression of the Echinococcus granulosus TSP6 recombinant proteins described in claim 1 or 2, it is characterised in that：Step
It is as follows：
（1）Target gene TSP6 amplification；
（2）Build TSP6 expression plasmids：By step（1）Target gene TSP6 digestions of preparation and after purification, are built into pET-30a
Corresponding polyclone enzyme enzyme site, builds plasmid pET30a-TSP6；
（3）By step（2）The plasmid pET30a-TSP6 of preparation is transformed intoE.Coli, will in BL21 (DE3) competent cellE.ColiBL21 (DE3)-pET30a-TSP6 is enlarged culture, then adds 0.1 mmol/L IPTG in 20 DEG C, lures
Lead shaken cultivation 6 hours；Bacterium is collected by centrifugation, ultrasound collects supernatant.
4. solubility expression according to claim 3, it is characterised in that：Step（3）Described in expand culture be byE.ColiBL21 (DE3)-pET30a-TSP6 is first seeded on LB solid mediums, 37 DEG C of overnight incubations；Then picking culture
Monoclonal is into LB fluid nutrient mediums on base, and in 37 DEG C, 200r/min shaken cultivations 2 hours make OD values to 0.6；Finally take bacterium
Liquid is seeded in LB fluid nutrient mediums, and in 37 DEG C, 200r/min shaken cultivations make OD values to 0.6.
5. the purification process of the Echinococcus granulosus TSP6 recombinant proteins described in claim 1 or 2, it is characterised in that：It is to use
HisTALONTMGravity Columns prepacked columns purify Echinococcus granulosus TSP6 recombinant proteins, then using elution buffer
Liquid is eluted；The formula of the elution buffer is：300mM/L imidazoles, 20mM/L Tris, 500mM/L NaCl,
pH8.0。
6. purification process according to claim 5, it is characterised in that：Step is as follows：
（1）20 mM MES buffer solutions are added in HisTALONTMScouring media in Gravity Columns prepacked columns；
（2）Ultra-pure water is added, the medium for making it slowly flow through filling in prepacked column；
（3）Combination buffer is added, it is slowly flowed across medium in post；The formula of the combination buffer is：20mM/L
Tris, 500mM/L NaCl, 20mM/L imidazoles, pH8.0；
（4）Loading, adds ultrasonicationE.ColiThe supernatant that BL21 (DE3)-pET30a- TSP6 are extracted, makes its slug flow mistake
Medium in post；
（5）Combination buffer is added, liquid is slowly flowed across medium in post；The formula of the combination buffer is：20mM/L
Tris, 500mM/L NaCl, 20mM/L imidazoles, pH8.0；
（6）No. 1 eluent is added, it is slowly flowed across medium in post；The formula of No. 1 eluent is：50 mM/L imidazoles,
20 mM/L Tris, 500 mM/L NaCl, pH8.0；
（7）No. 2 eluents are added, it is slowly flowed across medium in post；The formula of No. 2 eluents is：100 mM/L miaows
Azoles, 20 mM/L Tris, 500 mM/L NaCl, pH8.0；
（8）No. 3 eluents are added, it is slowly flowed across medium in post；The formula of No. 3 eluents is：200 mM/L miaows
Azoles, 20 mM/L Tris, 500 mM/L NaCl, pH8.0；
（9）No. 4 eluents are added, it is slowly flowed across medium in post, eluent is collected；The formula of No. 4 eluents is
300mM/L imidazoles, 20mM/L Tris, 500mM/L NaCl, pH8.0.
7. purification process according to claim 6, it is characterised in that：The ultrasonicationE.Coli BL21(DE3)-
The supernatant and the volume ratio of elution buffer that pET30a- TSP6 are extracted are 1:2.
8. the Echinococcus granulosus TSP6 recombinant proteins described in claim 1 or 2 are preparing the ELISA of detection echinococcosis granulosa
Application in kit.
9. a kind of ELISA kit for detecting echinococcosis granulosa, it is characterised in that：Envelope antigen in the ELISA kit
For the Echinococcus granulosus TSP6 recombinant proteins described in claim 1 or 2.
10. kit according to claim 9, it is characterised in that：Envelope antigen pH 9.6 0.05M/L carbon
Phthalate buffer is diluted to the μ g/ml of final concentration 5；
Preferably, the kit also includes confining liquid, the confining liquid is the TBST containing 5% skimmed milk power, the percentage
The unit of ratio is g/ml.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710391545.3A CN107056915A (en) | 2017-05-27 | 2017-05-27 | Echinococcus granulosus TSP6 recombinant proteins and its solubility expression method and purification process |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710391545.3A CN107056915A (en) | 2017-05-27 | 2017-05-27 | Echinococcus granulosus TSP6 recombinant proteins and its solubility expression method and purification process |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107056915A true CN107056915A (en) | 2017-08-18 |
Family
ID=59617599
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710391545.3A Pending CN107056915A (en) | 2017-05-27 | 2017-05-27 | Echinococcus granulosus TSP6 recombinant proteins and its solubility expression method and purification process |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107056915A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111574608A (en) * | 2020-04-21 | 2020-08-25 | 沈阳农业大学 | Specific detection antigen of echinococcosis granulosus of cattle and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101948521A (en) * | 2010-09-17 | 2011-01-19 | 中国疾病预防控制中心寄生虫病预防控制所 | Recombinant antigenic protein for diagnosing echinococcosis granulosus, preparation method thereof and use thereof |
| CN102863524A (en) * | 2012-08-28 | 2013-01-09 | 中国疾病预防控制中心寄生虫病预防控制所 | Recombinant antigen protein for diagnosing echinococcosis granulosa as well as preparation method and application thereof |
-
2017
- 2017-05-27 CN CN201710391545.3A patent/CN107056915A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101948521A (en) * | 2010-09-17 | 2011-01-19 | 中国疾病预防控制中心寄生虫病预防控制所 | Recombinant antigenic protein for diagnosing echinococcosis granulosus, preparation method thereof and use thereof |
| CN102863524A (en) * | 2012-08-28 | 2013-01-09 | 中国疾病预防控制中心寄生虫病预防控制所 | Recombinant antigen protein for diagnosing echinococcosis granulosa as well as preparation method and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| TSAI,I.J. ET AL.: "TSP6 [Echinococcus granulosus]", 《GENBANK: CDS17458.1》 * |
| 刘田莉等: "细粒棘球蚴TSP1和TSP6基因的克隆及生物信息学分析", 《华北农学报》 * |
| 辛奇: "细粒棘球绦虫成虫基因表达谱分析及抗包虫药物筛选", 《中国博士学位论文全文数据库医药卫生科技辑》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111574608A (en) * | 2020-04-21 | 2020-08-25 | 沈阳农业大学 | Specific detection antigen of echinococcosis granulosus of cattle and application thereof |
| CN111574608B (en) * | 2020-04-21 | 2021-11-19 | 沈阳农业大学 | Specific detection antigen of echinococcosis granulosus of cattle and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Moks et al. | Large–Scale Affinity Purification of Human Insulin–Like Growth Factor I from Culture Medium of Escherichia Coli | |
| US5965400A (en) | DNA encoding a truncated pneumogoccal surface protein (PspA) | |
| CN107236027A (en) | Echinococcus granulosus TSP1 recombinant proteins and its solubility expression method and purification process | |
| CN107200776A (en) | Echinococcus granulosus antigen cC1 recombinant protein and its solubility expression method and purification process | |
| CN108314710B (en) | Mycoplasma pneumoniae recombinant antigen and application thereof | |
| CN110845582B (en) | Preparation of feline parvovirus recombinant protein and monoclonal antibody thereof | |
| CN113999861B (en) | Preparation method and application of polyclonal antibody of adeno-associated virus capsid protein conservation region | |
| CN111087453A (en) | Preparation method and application method of chlamydia pneumoniae recombinant antigen | |
| CN108179149A (en) | S100B mutant and its application | |
| CN107056915A (en) | Echinococcus granulosus TSP6 recombinant proteins and its solubility expression method and purification process | |
| CN112553231A (en) | Recombinant human heat shock protein HSP90-His and expression and purification method thereof | |
| CN112062858A (en) | Tandem protein for diagnosing alveolar echinococcosis and cloning expression method thereof | |
| CN108300725B (en) | Soluble single-chain antibody superantigen fusion gene and protein, and preparation and application thereof | |
| CN107201348B (en) | Echinococcus granulosus Sigma-glutathione S-transferase recombinant protein and soluble expression method and purification method thereof | |
| CN107253988A (en) | A kind of preparation method of people's source program death factors part PD L2 albumen | |
| CN109055416A (en) | A kind of preparation method of soluble recombinant protein | |
| CN107746432A (en) | A kind of modified proteins of A β 42 and its expression and purification method | |
| CN111888797B (en) | Method for purifying egg yolk antibody by using affinity immune medium | |
| CN113121694B (en) | Isolated binding proteins with antigen binding domains that bind hpgi and methods of making and using the same | |
| CN113603790A (en) | RGD-anti-p 21Ras single-chain antibody fusion protein capable of entering tumor cells and preparation method thereof | |
| CN107099519A (en) | Echinococcus granulosus turns dihydroxyacetone kinase recombinant protein, its solubility expression method and its purification process and application | |
| CN108642024B (en) | CK-MB expression and purification method | |
| CN111378025A (en) | Tetrodotoxin binding protein tfPSTBP2, nucleotide sequence, polyclonal antibody thereof and preparation method thereof | |
| CN113481227B (en) | Preparation method of PLA2R recombinant protein | |
| CN117924439B (en) | Recombinant CagA protein and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170818 |