CN111378025A

CN111378025A - Tetrodotoxin binding protein tfPSTBP2, nucleotide sequence, polyclonal antibody thereof and preparation method thereof

Info

Publication number: CN111378025A
Application number: CN202010225924.7A
Authority: CN
Inventors: 黄文树; 刘智禹; 乔琨; 蒋彩云; 熊静; 黄贝
Original assignee: Jimei University
Current assignee: Jimei University
Priority date: 2020-03-26
Filing date: 2020-03-26
Publication date: 2020-07-07

Abstract

The invention discloses tetrodotoxin binding proteinstfPSTBP2, which contains a polypeptide having a sequence of amino acids as set forth in SEQ ID NO. 1, or an active fragment of the polypeptide thereof. EncodingtfThe nucleotide sequence of PSTBP2 is shown as SEQ ID NO. 2. Using tetrodotoxin binding proteinstfPSTBP2 is used as antigen, and the antiserum is prepared from immunized miceCloning the antibody. The invention also discloses tetrodotoxin binding proteintfThe preparation method of PSTBP2 comprises the following steps: s1, obtaining coded tetrodotoxin binding protein through cloningtfA nucleotide sequence of PSTBP2 cloned into a recombinant expression vector; s2, introducing the recombinant expression vector into a host cell, and performing induced expression and condition optimization to obtain an expression product; s3, filtering the expression product, eluting through an affinity chromatography column, and collecting an elution peak to obtain the recombinant protein. Tetrodotoxin binding protein (A) obtained by the inventiontfPSTBP2), its nucleotide sequence and its polyclonal antibody, and TTX binding property is good, and lays a foundation for developing tetrodotoxin immunological detection method, and tetrodotoxin detoxification therapeutic medicine, etc.

Description

Tetrodotoxin binding protein tfPSTBP2, nucleotide sequence, polyclonal antibody thereof and preparation method thereof

Technical Field

The invention relates to the field of biotechnology, in particular to tetrodotoxin binding protein, a coded nucleotide sequence and a polyclonal antibody thereof. The invention also relates to a preparation method of the tetrodotoxin binding protein.

Background

Tetrodotoxin (TTX) is a small-molecule alkaloid neurotoxin with the molecular formula C₁₁H₁₇O₈N₃The molecular weight is 319. Is an amino perhydro quinazoline type compound, and is one of the most toxic neurotoxins found in nature. Tetrodotoxin is typical of Na⁺Channel blockers, Na which can bind to the surface of the membrane of the muscle nerve cell⁺Channel receptor specific binding, inhibition of Na in nerve cells⁺And prevent excitatory transmission between nerves and muscles.

Poisoning by tetrodotoxin is a frequent occurrence in some countries in china, japan and south-east asia, mainly due to the misuse of toxic puffer fish. After a series of studies on the sources of tetrodotoxin by scholars at home and abroad, the tetrodotoxin is found not only in the bodies of puffer fish, but also widely distributed in the bodies of other animals, such as the body surfaces of some amphibians like newworms, salamanders, wood frogs and the like. Also, it was found that various bacteria can also produce TTX. The tolerance of different organisms to TTX varies widely, and the toxicity of puffer fish shows significant individual and regional differences.

Compared with non-toxic organisms, toxic puffer fish enriched with large amounts of TTX have a higher tolerance to TTX. In the seawater puffer fish, the liver and ovary are generally the most toxic, followed by the intestine and skin, and the muscle and/or testis being non-toxic or weak. In poisonous puffer fish, the liver usually shows high toxicity throughout the year. The mechanism of transferring and accumulating virulent TTX in puffer fish bodies, which is caused by accumulation of TTX transferred from the liver in the egg-laying period, of the ovaries is not clear.

It has been found that tetrodotoxin can bind to specific proteins in the body, thereby reducing its toxic effects. The tetrodotoxin binding protein tfPSTBP2 is a carrier protein found in puffer fish, can be combined with TTX, and participates in the transportation of tetrodotoxin in vivo. Most scholars obtaining tetrodotoxin-binding protein tfPSTBP2 adopt a method of directly separating and purifying from fish bodies, but the obtained yield is low, the steps are complicated, and a large amount of tetrodotoxin-binding protein tfPSTBP2 is not easy to obtain. The related research of obtaining the protein through in vitro recombinant expression is only found in the takifugu rubripes, but the used vector has the problems of complicated technology, long time consumption, low efficiency and the like in application. At present, no report related to the separation and purification of tetrodotoxin binding protein from Takifugu flavidus exists. The binding protein which can prevent the body from TTX toxicity effect is obtained from different kinds of puffer fish bodies by recombinant expression technology, and has important significance for clarifying the transfer and enrichment mechanism of TTX in puffer fish bodies and further developing TTX antidotes or detection reagents.

Disclosure of Invention

The invention aims to provide a tetrodotoxin binding protein tfPSTBP2, a nucleotide sequence, a preparation method thereof and a polyclonal antibody thereof, which are further applied to antidotes of TTX and/or development of detection reagents of TTX and the like.

In order to achieve the purpose, the invention adopts the following technical scheme:

the invention discloses tetrodotoxin binding protein tfPSTBP2, which contains polypeptide of amino acid sequence shown as SEQ ID NO. 1 or active fragment of the polypeptide.

The invention also discloses a nucleotide sequence of the coded tetrodotoxin binding protein tfPSTBP2, which is shown as SEQ ID NO. 2.

The invention also discloses a polyclonal antibody, which is prepared by immunizing a mouse to prepare antiserum by using the tetrodotoxin binding protein tfPSTBP2 as an antigen.

The invention discloses a preparation method of the tetrodotoxin binding protein tfPSTBP2, which is characterized by comprising the following steps:

s1, constructing a recombinant expression vector of fugu flavidus tetrodotoxin binding protein tfPSTBP 2;

s2, introducing the recombinant expression vector into a host cell, and performing induced expression and condition optimization on the host cell to obtain an expression product;

s3, filtering the expression product, eluting through an affinity chromatography column, and collecting an elution peak to obtain the recombinant protein.

Further, in step S1, the nucleotide sequence of the tetrodotoxin binding protein (tfPSTBP2) is cloned by using cDNA reverse transcribed from total RNA prepared from Fugu flavidus liver as a template.

Further, a front primer tfPSTBP2F and a rear primer tfPSTBP2R are constructed for target gene sequence amplification, and the sequence of the primer tfPSTBP2F is as follows: GCAGATCTTTGTCTCAGAGCAG, SEQ ID NO: 3; the sequence of the primer tfPSTBP2R is as follows: CATTGTTGTCTCAGTCCTGTTCA, SEQ ID NO: 4.

Preferably, the host cell in step S2 is Escherichia coli, and the initial strain concentration is OD₆₀₀0.2, the induction temperature is 28 ℃, the induction time is 2.8 h-3h, the inducer is IPTG, and the carrier is pET-32 a.

Preferably, the affinity chromatography column in step S3 is a nickel ion metal chelate affinity chromatography column.

Further, the method also comprises the following steps: s4, putting the eluted protein into a dialysis bag, dialyzing in a PBS solution for 5-7 h at 4 ℃, replacing the dialysate for a plurality of times, taking out the sample from the dialysis bag, subpackaging and storing at-80 ℃. The salts on the protein can be eluted by a dialysis step.

The invention has the following beneficial effects:

the invention clones and obtains the binding tetrodotoxin binding protein tfPSTBP2 and the nucleotide sequence thereof for the first time, and prepares the polyclonal antibody.

The invention successfully expresses the tetrodotoxin-binding protein tfPSTBP2 in the escherichia coli by utilizing the pET-32a vector for the first time, and the recombinant protein obtained by the preparation method has the advantages of high purity, short required time, high yield and the like.

The solution used in the invention has simple preparation and low price.

The tetrodotoxin binding protein tfPSTBP2 prepared by the invention has high TTX binding activity (the equilibrium dissociation constant (kD) is 0.39 mu M), and not only can be used for scientific research, but also has the potential of developing TTX antidotes. In addition, the tetrodotoxin binding protein can be specifically bound with TTX, so that the tetrodotoxin binding protein has an application prospect in being developed as a TTX detection reagent.

Drawings

FIG. 1 shows the induced expression of PET32a/tfPSTBP2 recombinant strain under different conditions.

FIG. 2 shows SDS-PAGE of the purified protein, wherein M is protein Marker and 2 is tfPSTBP 2.

FIG. 3 is a mouse antiserum ELISA titer assay for tfPSTBP 2.

FIG. 4 is a graph of the binding kinetics of tfPSTBP2 with TTX.

FIG. 5 is a graph of death after in vitro incubation of TTX with protein in gavage mice.

FIG. 6 is a graph of the death curve of mice injected intraperitoneally after incubation of TTX with protein in vitro.

Detailed Description

In order to make the technical solutions of the present invention better understood by those skilled in the art, the present invention is further described in detail below with reference to the accompanying drawings and specific embodiments.

The reagents or apparatuses used in the examples of the present invention are those commonly used by those skilled in the art.

Example one

The invention discloses tetrodotoxin binding protein tfPSTBP2, which contains polypeptide of an amino acid sequence shown as SEQ ID NO. 1 or an active fragment of the polypeptide.

the tfPSTBP2 open reading frame encodes 391 amino acids, has a molecular weight of 43.81kDa and a predicted isoelectric point of 5.35. The protein belongs to a member of the lipocalin superfamily. The N-terminal amino acid sequence of tfPSTBP2 protein was detected on-line by SignalP-5.0Server starting at residue 21, and the first 20 amino acids of tfPSTBP2 were signal peptides. the protein encoded by tfPSTBP2 consists of a signal peptide, a single domain, and the last 9 residues at the C-terminus. Multiple alignments of the sequences were performed using BioEdit software and found that amino acid residues 24-179 of tfPSTBP2 and 180-383 amino acid residues were two repeats with an amino acid identity of 68.33%. tfPSTBP2 contains 13 cysteines, 12 of which are position conserved. The N-glycosylation sites are 6, 4 of which are position-conserved.

The invention discloses a preparation method of tetrodotoxin binding protein tfPSTBP2, which comprises the following steps:

s1, constructing a recombinant expression vector of the fugu flavidus tetrodotoxin binding protein tfPSTBP 2.

1. Cloning of Fugu flavidus tetrodotoxin binding protein tfPSTBP2 gene sequence

(1) First, in NCBI database, tetrodotoxin binding protein (PSTBP) gene sequence was searched, and in Takifugu flavidus genome sequence (GenBank: GCA _000400755.1), BLAST search for gene sequence with high similarity was performed. Primers were designed at the front and back of the open reading frame using Primer 5.0 software, as shown in table 1. The sequence table is shown as SEQ ID NO. 3 and SEQ ID NO. 4.

TABLE 1 primer sequence Listing

(2) Extracting the total RNA of the liver of the fugu flavidus according to an operation manual of an animal tissue total RNA extraction kit. The concentration and purity of the total RNA solution were measured using an Infinite200Pro microplate reader, and reverse transcription was performed according to the following system.

① first strand cDNA Synthesis, the reaction system is as follows:

② reverse transcription PCR program, 42 deg.C for 30min, 85 deg.C for 5sec, 4 deg.C HOLD.

(3) Cloning target gene, using reverse transcription Takifugu flavidus cDNA as template, reaction system preparing as follows:

mixing well, centrifuging the reaction system at low speed, and performing PCR reaction according to the following procedures, wherein the parameters in the PCR instrument are shown in the following table 2:

TABLE 2

(4) The PCR product was subjected to gel electrophoresis in the following procedure:

① mixing gel, mixing 30mL1XTAE buffer solution and 0.36g agarose (1.2%) in a conical flask, heating in microwave oven (first strong fire and then slow fire, and continuously taking out to see whether the powder is mixed and has no bubble);

② dye 3. mu.L of DuRed (10000X) stock solution in an erlenmeyer flask, and gently shaking;

③ pouring gel, namely inserting a comb into the gel tank, pouring the prepared gel solution into the gel tank while the gel solution is hot, and cooling to solidify;

④ loading, namely placing the solidified glue into an electrophoresis tank, adding 1xTAE solution to immerse the placed glue, and sequentially adding marker and sample in the sequence from right to left;

⑤ electrophoresis, after sample loading, covering the electrophoresis tank cover with two hands, switching on the power supply, stabilizing voltage at 100V, performing electrophoresis for 30min, and switching off the power supply.

(5) Connecting, preparing a connecting system:

after preparation, the mixture is shaken, mixed evenly, centrifuged and connected for 3 hours at 16 ℃.

(6) Heat shock transformation

① taking out 100 μ LDH5 α competent cells from an ultra-low temperature refrigerator of-80 deg.C, thawing on ice, rapidly adding the ligated product into the competent cells, standing on ice for 30min, thermally shocking at 42 deg.C for 90s, and then putting back on ice for 2 min.

② mu.L of non-resistant LB medium was added to the competent cells, and the mixture was cultured for 3 hours at 180r/min on a shaker at 37 ℃.

③ sucking 100. mu.L of E.coli liquid, spreading evenly on LB (containing AMP) solid medium, and culturing overnight at 37 ℃ in an inverted incubator.

(7) Positive clone identification

And (3) PCR reaction system:

after being prepared, the materials are mixed evenly, centrifuged and put into a PCR instrument, and the parameters in the PCR instrument are shown in the following table 3:

TABLE 3

And (3) carrying out nucleic acid electrophoresis after the PCR is finished, selecting bacterial liquid with positive strips, sequencing, verifying, and preserving the seeds after the verification is successful.

2. Construction of Fugu flavidus tetrodotoxin binding protein (tfPSTBP2) recombinant expression vector

(1) Plasmid extraction

A pET32a plasmid and a plasmid containing a target gene (tfPSTBP2) are extracted from DH5 α (pET32a) in a plasmid clone strain in small quantities, and an OMEGA plasmid extraction kit is adopted.

(2) Primer design

According to the multiple cloning sites of the vector, the restriction sites not included in the target gene are searched, and the upstream and downstream primers are designed as shown in the following table 4.

TABLE 4 prokaryotic expression primer design

(3) PCR amplification of target gene expression sequence

The Takifugu flavidus tfPSTBP2 recombinant plasmid pMD19-T plasmid is used as an amplification template, corresponding upstream and downstream primers are used, a target fragment is amplified by high-fidelity Taq enzyme, and a reaction system and a PCR program are shown in a step S1.

After the reaction was completed, all reaction products were subjected to (1.2%) agarose gel electrophoresis, and specific fragments were recovered using a gel recovery kit.

(4) Double enzyme digestion of vector and target gene

The recovered product and plasmid were double digested with the corresponding restriction enzymes, and the following samples were added to a new sterile centrifuge tube (200. mu.L):

after mixing, the reaction solution is placed in a water bath kettle at 37 ℃ for reaction for 3h, a small amount of sample is taken after enzyme digestion is finished and is mixed with 5 × Laodingbuffer uniformly, and the enzyme digestion result is detected by agarose gel electrophoresis.

(5) Ligation of the fragment of interest to the vector

After a series of treatments, the prokaryotic expression vector with the same cohesive end is connected with a target gene, and the reaction system is as follows:

after mixing, incubating overnight at 16 ℃, taking 10 mu L of the ligation reaction solution the next day, transforming into DH5 α competent cells, coating the competent cells on an LB agar plate containing AMP (PET32a-tfPSTBP2) and culturing overnight, picking single colonies the next day, identifying positive clone bacteria by a PCR method, and determining the DNA nucleotide sequence to obtain the nucleotide sequence shown as SEQ ID NO. 2.

S2, introducing the recombinant expression vector into a host cell, and performing induced expression and condition optimization on the host cell to obtain an expression product

(1) The correctly sequenced pET32a/tfPSTBP2 recombinant plasmid was transformed into Rosetta 2(DE3) competent cells, added with 1mL LB liquid medium of the corresponding antibiotic, and cultured with shaking at 37 ℃ for 1 h. A small amount of E.coli was spread on an LB agar plate for expression (containing the corresponding antibiotic) and cultured overnight at 37 ℃ in an inverted state. The induced expression steps are as follows:

① Single colonies were picked, inoculated into 10mL expression medium (containing the corresponding antibiotic), and cultured to OD at 37 ℃₆₀₀＝0.2-0.6。

② IPTG was added to a final concentration of 0.2mM, and the mixture was cultured at 37 ℃ and 180r/min for 5 hours.

③ sucking 5mL of bacteria solution into 15mL centrifuge tube, centrifuging at 49 deg.C and 10000g for 10min, and discarding the supernatant.

④ washing the precipitate with 2mL of precooled PBS, centrifuging at 4 deg.C and 10000g for 10min, discarding the supernatant, and repeating twice.

⑤ mu.L of precooled PBS was added to resuspend the pellet and the solution was transferred to a 1.5mL centrifuge tube.

⑥ placing a 1.5mL centrifuge tube on ice for ultrasonication under the conditions of 5s ultrasonication, 2s separation and 40% amplitude until the bacterial liquid is clear.

⑦ the sample is centrifuged again at 12000g for 15min at 4 ℃.

⑧ the whole supernatant was taken in a new 200. mu. LEP tube, an equal volume of PBS was added to the 1.5mL centrifuge tube to resuspend the pellet, 4 × SDS-PAGE loading buffer (containing B-ME) was added to the sample and mixed well.

⑨ the samples were denatured at 95 ℃ for 10 min.

⑩ mu.L of the denatured sample was subjected to SDS-PAGE to detect the expression of the recombinant protein.

(2) The strains with higher expression were inoculated in 5mL LB (containing antibiotics) liquid medium as described above and cultured to OD at 37 ℃ respectively₆₀₀IPTG was added to a final concentration of 2mM at 0.2 and 0.5 and expression was induced for 3h and 6h at 28 ℃ and 37 ℃ respectively. Taking the bacterial liquid to perform SDS-PAGE electrophoresis. The remaining bacterial solution was centrifuged, and the bacterial suspension was sonicated using about 1mL of PBS. Centrifuging the ultrasonic liquid at 12000g for 15min, respectively taking the supernatant and the precipitate, and analyzing the solubility of the products under each expression condition by SDS-PAGE electrophoresis.

(3) In the induction process, under the condition of the same concentration of IPTG inducer (0.2mM), the influence of different induction initial thallus concentrations, different induction temperatures and different induction times on the expression product is researched. The optical density of the protein band was subjected to Gaussian analysis by quantitative One software, and the results showed that tfPSTBP2 existed in the form of inclusion bodies at the initial cell concentration OD₆₀₀Under the conditions of 0.2, 28 ℃ induction temperature and 3h induction time, the obtained recombinant expression product accounts for 47.7% of the total protein at most, as shown in fig. 1.

Through solubility analysis, pET32a/tfPSTBP2 exists in the form of inclusion body, so that the inclusion body needs to be denatured and renatured, and after the denaturation and renaturation treatment, the ultrasonication is carried out, and then the purification step S4 is carried out.

S3, filtering the expression product, eluting the expression product through an affinity chromatography column, and collecting an elution peak

Purifying by using a nickel ion metal chelating affinity chromatography column, eluting the chelated fusion protein by using imidazole, and detecting an ultraviolet absorption curve at 280nm to obtain an obvious eluted protein peak. And collecting the elution components to perform SDS-PAGE electrophoresis, as shown in figure 2, and as can be seen from figure 2, the fusion expression product of the target protein can be specifically combined with a nickel ion chelating affinity chromatographic column, after the low-concentration imidazole solution is washed, the non-target protein is eluted from the affinity chromatographic column, and after the high-concentration imidazole solution is competitively washed, the fusion expression product of the target is eluted. Analysis by the Quality One software gave recombinant tfPSTBP2 with a purity of 91%.

S4, desalting of eluted protein

Putting the target protein eluted by affinity chromatography into a dialysis bag, dialyzing in PBS solution at 4 ℃ for 6h, and replacing the dialysate for 3 times. The samples were removed from the dialysis bag and stored in aliquots at-80 ℃. Thus obtaining the purified tetrodotoxin binding protein (tfPSTBP 2).

Example two

The embodiment discloses a polyclonal antibody, which is obtained by immunizing a mouse to prepare antiserum by using the tetrodotoxin binding protein (tfPSTBP2) in the embodiment I as an antigen.

The specific preparation process of the polyclonal antibody comprises the following steps: the purified tfPSTBP2 protein obtained in example one was sent to an antibody preparation center, and 10 mice were immunized, and polyclonal antibodies were prepared. A small amount of blood was collected from the eyes of the mice with a disposable needle on the 3 rd day after the fourth immunization, and the serum titer was measured by ELISA. Blood was collected on day 4 after the last injection. Mouse blood was collected using a 1.5mL sterilized Eppendoff tube, the tube number was noted, and the tube was allowed to stand at room temperature for 2h-3 h. About 1mL of blood can be collected from each mouse. After blood coagulation, the blood clot was carefully stripped along the tube wall with a pipette tip and placed in a refrigerator at 4 ℃ overnight to allow serum to precipitate. Centrifuging at 4 deg.C and 2000g for 10min, collecting serum, subpackaging into small tubes, and storing in a refrigerator at-80 deg.C.

The procedure for detecting serum titers by ELISA is detailed below:

three groups of blank control, negative control and experimental group are arranged, primary antibody is respectively antibody diluent, pre-immune serum and post-immune serum, and the experimental process is as follows:

① coating, diluting the purified tfPSTBP2 fusion protein to 5 mu g/mL by using a coating buffer solution, adding 100 mu L of the solution to each plate of a 96-well enzyme label plate, and standing overnight at 4 ℃;

② rinsing, discarding antigen solution, rinsing with 200 μ L PBST for 3 times per well, pouring off the solution, and drying on clean filter paper;

③ blocking, adding 100 μ L blocking solution into each well, and incubating at 37 deg.C for 1 h;

④ rinsing, repeating the method ② for 4 times;

⑤ combining with an antibody, diluting tfPSTBP2 antibody serum and negative serum in PBST diluent in series, wherein the dilution is 1/3200, 1/6400, 1/12800, 1/25600, 1/51200, 1/102400, 1/204800 and the like, 50 mu L of each dilution is respectively taken in the reaction hole coated with the antigen, and the reaction hole is incubated for 2h at 37 ℃;

⑥ rinsing, the method is the same as (4);

⑦ binding enzyme-labeled secondary antibody, adding 50 μ L of freshly diluted rat antibody labeled with horseradish peroxidase (1: 5000 dilution) into each reaction well, and incubating at 37 deg.C for 30 min;

⑧ rinsing, the method is the same as (4);

⑨ developing by adding 100 μ L1-Step Ultra IMB-ELISA developing solution into each well, incubating at 37 deg.C for 5-10min, adding 50 μ L2M H into each well after developing depth is appropriate₂SO₄Stopping the blue positive to become bright yellow, and stabilizing for 3-5 min;

⑩ detection, placing in a preheated enzyme labeling instrument, and measuring 0D of each well₄₅₀The value is obtained.

Measurement and calculation: the absorbance of each well was measured at a wavelength of 450nm using an enzyme-linked immunoassay instrument with PBST wells as a blank control. The ratio of A value (Positive/Negative, P/N) of the Positive serum to the Negative serum after blank deduction is calculated, and the Positive serum is Positive when the P/N is more than or equal to 2.1, the suspicious serum is when the P/N is less than 2.1 and more than or equal to 1.5, and the Negative serum is when the P/N is less than 1.5. As shown in FIG. 3, the P/N was still greater than 2 when mouse antisera to tfPSTBP2 was diluted 204800, 51200, and 102400 fold, respectively. Therefore, the tetrodotoxin binding protein (tfPSTBP2) has good reactogenicity and can induce the body to generate high-level antibodies.

The tetrodotoxin binding protein (tfPSTBP2) obtained by the present invention has the effect of binding to TTX and detoxifying, and the following is a relevant experimental verification.

1. The binding capacity of the recombinant protein (tfPSTBP2) to the tetrodotoxin binding protein TTX was tested by ELISA.

The tfPSTBP2 obtained from the purification was serially diluted in gradient 0(PBS), 0.045nM, 0.09nM, 0.18nM, 0.36nM, 0.72nM, 1.44nM, 2.88nM using the corresponding antiserum as the primary antibody and the labeled HRP mouse antibody as the secondary antibody. The experimental procedure was as follows:

① antigen coating, namely, taking a new 96-hole enzyme label plate, adding 3 mu g/mL BSA-TTX antigen by a line gun, putting 100 mu L of BSA-TTX antigen into a refrigerator at 4 ℃ for overnight, ensuring that no air bubbles exist in the gun head after the line gun absorbs the antigen during sample adding, avoiding experimental error, coating the required number of micro-hole plates for one time, reducing the difference caused by improper coating methods, and respectively sealing by sealing bags after finishing the coating;

② rinsing, pour off antigen from plate, add 200. mu.L PBST, shake gently for 20s and pour off liquid, repeat four times.

③ blocking the washed plate was patted dry on clean filter paper, blocked by adding 200. mu.L of 4% nonfat dry milk (PBST dilution), and incubated at 37 ℃ for 3 h.

④ cleaning and preserving, pouring off the sealing solution, rinsing with 200 μ l PBST for five times, shaking for 20s each time, patting dry on clean filter paper, air drying on clean bench for 30 min;

⑤ adding samples, adding protein samples of various concentrations, 50 μ L per well, incubating at 37 deg.C for 1 h;

⑥ rinsing by ④;

⑦ binding to an antibody, adding 50. mu.L of antiserum (tfPSTBP2), diluting 2000-fold (PBST as dilution), incubating at 37 ℃ for 1 h;

⑧ rinsing by ④;

⑨ binding secondary antibody, diluting the marked HRP mouse antibody 5000 times, adding 50 μ L per well, and incubating at 37 deg.C for 30 min;

⑩ developing, adding developing solution (Ultra TMB)100 μ L, reacting at room temperature in dark place for 5-10min, adding 2M H μ L into each well after developing depth is appropriate₂SO₄Stopping changing blue positive into bright yellow, stabilizing for 3-5min, detecting in enzyme labeling instrument, and determining OD of each well₄₅₀And (5) nm value.

As shown in FIG. 4, the results of the experiment showed that tfPSTBP2 has an equilibrium dissociation constant (kD) of 0.39. mu.M (pH7.2-7.4) with TTX, and that tfPSTBP2 has a large binding effect with TTX.

2. Experiment of toxin binding protein of tetrodotoxin (tfPSTBP2) in detoxification of TTX intoxication in mice.

Preparation before experiment:

selecting 60 male healthy mice of 19.0-21.0 g of Specific Pathogen Free (SPF) ICR line, weighing and recording the weight. The groups were randomized into 6 groups of 10 individuals. Each test mouse was gavaged/intraperitoneally injected with 0.5mL of TTX solution, the tetrodotoxin-binding protein (tfPSTBP2) solution obtained in example one, or TTX-recombinant protein mixture. The time of injection start and finish was recorded, and the time of death when the mice stopped breathing was carefully observed and recorded.

(1) The detoxification effect of tetrodotoxin binding protein (tfPSTBP2) on TTX poisoning of mice is verified by a gastric lavage method

① Experimental procedure experiments of the control group and the experimental group were carried out as follows.

Control group:

10 mice were prepared, each mouse was gavaged with 0.5mL of 14. mu.g/mL TTX, and the time to death and the number of deaths recorded within 2 h.

Experimental groups:

two groups of 10 mice each were assigned TTX to tfPSTBP2 molar ratios (1: 1) and (1: 10). Mu.g/ml LTTX was incubated in advance with tfPSTBP2 in the corresponding molar ratio for 15h at 15 ℃. Each mouse was gavaged with 0.5mL of TTX mixed with tfPSTBP2 at the corresponding molar ratio, and the time to death and the number of deaths within 2h were recorded.

② results of the experiment

As shown in fig. 5, all mice survived the mixture after incubation of the gavage toxin with the protein and no clinical signs of toxicity occurred during the experimental time (2 h). It shows that TTX is in non-toxic state after in vitro incubation with protein.

(2) Intraperitoneal injection is utilized to verify the detoxification effect of recombinant protein on TTX poisoning of mice

Control group:

10 mice were prepared and each mouse was injected intraperitoneally with 0.5mL of 0.30. mu.g/mL TTX and allowed to die, and the survival time and number of deaths within 2h were recorded.

Experimental groups:

two groups of 10 mice each were assigned TTX to tfPSTBP2 molar ratios (1: 1) and (1: 10). 0.3. mu.g/ml LTTX was incubated with the corresponding molar ratio of recombinant protein at 15 ℃ for 15h in advance. Each mouse was injected intraperitoneally with 0.5mL of TTX mixed with the corresponding molar ratio of recombinant protein, and the time to death and the number of deaths within 2h were recorded.

② results of the experiment

As shown in fig. 6, the survival rate of mice significantly increased by the mixed solution after the incubation of the toxin and the protein injected into the abdominal cavity, which indicates that the toxicity of TTX is significantly reduced after the in vitro incubation of TTX and the protein.

In conclusion, the detoxification effect of the protein on TTX poisoning of mice is studied by intraperitoneal injection and intragastric perfusion (tfPSTBP2), and the lethal dose of intragastric TTX is about 50 times that of intraperitoneal injection, and the survival time is longer than that of intraperitoneal injection by 1 hour. If TTX and tetrodotoxin binding protein (tfPSTBP2) are incubated overnight in advance and then act on the mice at the same time, the survival time of the mice is obviously prolonged, and the death rate is obviously reduced, which indicates that the toxicity of the TTX and the tetrodotoxin binding protein (tfPSTBP2) is reduced or no toxicity is generated after the TTX and the tetrodotoxin binding protein are co-applied in vitro.

The invention aims to obtain a gene engineering expression product of takifugu flavidus binding protein tfPSTBP2, and identifies the activity of binding TTX, so as to develop a new drug for resisting pathogenic microorganisms or use the new drug as an animal feed additive. The invention obtains the escherichia coli expression recombinant of the takifugu flavidus binding protein tfPSTBP2, successfully recombines and expresses the recombinant in escherichia coli to obtain a tfPSTBP2 gene engineering product, confirms the TTX binding activity of tfPSTBP2, and lays a theoretical foundation for the development of the ttX antidote and TTX detection reagent.

The above description is only for the preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope of the present invention are included in the scope of the present invention.

SEQUENCE LISTING

<110> Fujian provincial aquatic product research institute (Fujian aquatic product disease control center)

<120> tetrodotoxin binding protein tfPSTBP2, nucleotide sequence, polyclonal antibody thereof and preparation method thereof

<160>4

<170>PatentIn version 3.5

<210>1

<211>391

<212>PRT

<213> Takifugu flavidus

<400>1

Met Gly Ala Val Pro Gly Val Val Leu Leu Leu Met Leu Ala Val Leu

1 5 10 15

Gly Ile Lys Ala Ala Pro Ala Pro Glu Glu Cys His Lys Leu Thr Lys

20 25 30

Ala Val Thr Lys Ala Asp Leu Gln Ser Val Ser Gly Asp Trp Val Leu

35 40 45

Val Trp Ser Val Ala Asn Thr Thr Glu Arg Trp Ile Cys Glu Asn Leu

50 55 60

Thr Ser Ser Tyr Val Glu Phe Lys Leu His Ser Asp Ile Ile Glu Tyr

65 70 75 80

Thr Glu Arg Asn Leu Phe Leu Gly Asn Phe Cys Ile Ser Phe Tyr Ser

85 90 95

Asn Leu Ser Ala Ser Thr Glu Lys Gln Gln Gln Phe Ser Leu Asn Asn

100 105 110

Leu Gln Met Glu Glu Lys Gly Val Val Arg Pro Phe Asn Asp Asn Gly

115 120 125

Thr Val Lys Phe Phe Glu Thr Cys Val Asp Cys Leu Ser Met Glu Tyr

130 135 140

Ser Gly Asp Ile Gly Arg Phe Leu Leu Ile Tyr Arg Arg Asp Gly Val

145 150 155 160

His Gln Asn Val Glu Val Leu Lys Ala Ala Gln Asp Asp Asn Gln Lys

165 170 175

Leu Ala Glu Cys Leu Gly Phe Ser Ile Asp Glu Pro Phe Ile Tyr Asp

180 185 190

Gly Val Ser Asp Phe Cys His Lys Lys Ser Pro Glu Glu Cys His Lys

195 200 205

Leu Thr Lys Ala Val Thr Lys Ala Asp Val Gln Ser Val Ser Gly Asp

210 215 220

Trp Val Leu Val Trp Ser Ile Ile Glu Asn Ser Thr Ile Ser Asp Asp

225 230 235 240

TrpLys Lys Leu Lys Ser Ser His Val Gly Gln Arg Ile His Ser Gly

245 250 255

Val Ile Asp Tyr Thr Glu Arg Asn Met Leu Lys Asn Asn Ser Cys Met

260 265 270

Thr Phe Lys Thr Asn Met Thr Ala Gly Pro Glu Gly Gln Asn Thr Phe

275 280 285

Ile Tyr Thr Ser Gly Lys Ile Glu Glu Asn Gly Val Val Thr Val Leu

290 295 300

Asp Gly Asn Gly Met Val Lys Phe Phe Glu Thr Cys Ala Asp Cys Leu

305 310 315 320

Ser Met Glu Tyr Ser Gly Phe Ile Gly His Phe Leu Leu Ile Tyr Arg

325 330 335

Arg Asp Gly Val His Gln Asn Val Glu Val Leu Lys Ala Ala His Asp

340 345 350

Asp Asn Gln Lys Leu Ala Glu Cys Leu Gly Phe Ser Ile Gly Glu Pro

355 360 365

Phe Ile Tyr Asp Gly Val Ser Asp Phe Cys His Lys Lys Ser Ser Pro

370 375 380

Glu Val Lys Pro Glu Gln Asp

385 390

<210>2

<211>1176

<212>DNA

<213> Takifugu flavidus

<400>2

atgggtgctg taccaggagt ggttctactg ctgatgctgg cggtgcttgg tatcaaagca 60

gcaccggctc cagaagagtg tcacaagctg actaaagcag tgacaaaagc cgatttgcag 120

agcgtttctg gtgactgggt tctggtctgg tccgtcgcta acaccactga aagatggatc 180

tgtgagaatc tgacaagctc ctacgttgag tttaaactcc actcagatat cattgagtac 240

acagagagga acttgttttt gggaaacttc tgcatatctt tctactcaaa cctgtcagca 300

tccactgaaa aacaacaaca attcagcctc aacaatctcc agatggagga gaagggagtc 360

gtcagaccat ttaatgacaa cggcacggtg aagttctttg agacgtgtgt tgattgtctg 420

tccatggagt acagtggtga tattggccgc ttcctgctca tctacaggag agatggtgtt 480

catcagaatg tggaggtact gaaggctgcc caagatgaca atcagaagct ggctgagtgt 540

ttgggattct ctattgacga gccattcatc tacgacggag tttcagattt ttgccataaa 600

aaatctccag aagagtgtca caagctgact aaagcagtga caaaagcaga tgtgcagagc 660

gtttctggtg actgggttct tgtctggtcc atcattgaaa attctaccat atctgacgac 720

tggaagaaac tcaaaagctc ccatgttggg caaaggatcc actctggggt catcgactac 780

actgagagga acatgctaaa gaataactcc tgtatgacgt tcaaaacaaa catgacagca 840

ggtcctgaag gccagaatac tttcatctac acttctggca agattgagga gaatggagtt 900

gtcacagtat tagatggaaa cggcatggtg aagttctttg agacgtgtgc tgactgtcta 960

tccatggagt acagtggatt tattggccat ttcctgctca tctacaggag agatggtgtt 1020

catcagaatg tggaggtact gaaggctgcc catgatgaca atcagaagct ggctgagtgt 1080

ttgggattct ctattggcga gccattcatc tacgacggag tttcagattt ttgccataaa 1140

aaatcttctc cagaggtgaa gcctgaacag gactga 1176

<210>3

<211>22

<212>DNA

<213> Takifugu flavidus

<400>3

gcagatcttt gtctcagagc ag 22

<210>4

<211>23

<212>DNA

<213> Takifugu flavidus

<400>4

cattgttgtc tcagtcctgt tca 23

Claims

1. Tetrodotoxin binding protein tfPSTBP2, characterized by: it contains the polypeptide of the amino acid sequence shown in SEQ ID NO. 1 or the active fragment of the polypeptide.

2. A nucleotide sequence encoding the tetrodotoxin binding protein tfPSTBP2 of claim 1, characterized in that: the nucleotide sequence is shown in SEQ ID NO. 2.

3. A polyclonal antibody, characterized by: immunizing a mouse with the tetrodotoxin binding protein tfPSTBP2 of claim 1 as an antigen to prepare antiserum.

4. The preparation method of the tetrodotoxin binding protein tfPSTBP2 is characterized by comprising the following steps:

5. The method of claim 4, wherein the tetrodotoxin binding protein tfPSTBP2 is prepared by:

in step S1, the total RNA reverse transcription cDNA prepared from Fugu flavidus liver is used as template to clone and obtain the nucleotide sequence of tetrodotoxin binding protein tfPSTBP 2.

6. The method of claim 5, wherein the tetrodotoxin binding protein tfPSTBP2 is prepared by: constructing a front primer tfPSTBP2F and a rear primer tfPSTBP2R for target gene sequence amplification, wherein the sequence of the primer tfPSTBP2F is as follows: GCAGATCTTTGTCTCAGAGCAG, SEQ ID NO: 3; the sequence of the primer tfPSTBP2R is as follows: CATTGTTGTCTCAGTCCTGTTCA, SEQ ID NO: 4.

7. The method of claim 4, wherein the tetrodotoxin binding protein tfPSTBP2 is prepared by: the host cell in step S2 is Escherichia coli, and the initial strain concentration is OD₆₀₀0.2, 28 ℃ of induction temperature, 2.8-3 h of induction time, IPTG as an inducer and pET-32a as a carrier.

8. The method of claim 4, wherein the tetrodotoxin binding protein tfPSTBP2 is prepared by: in step S3, the affinity chromatography column is a nickel ion metal chelating affinity chromatography column.

9. The method of claim 4, wherein the tetrodotoxin binding protein tfPSTBP2 is prepared by: also comprises the following steps:

s4, putting the eluted protein into a dialysis bag, dialyzing in a PBS solution for 5-7 h at 4 ℃, replacing the dialysate for a plurality of times, taking out the sample from the dialysis bag, subpackaging and storing at-80 ℃.