CN107236027A - Echinococcus granulosus TSP1 recombinant proteins and its solubility expression method and purification process - Google Patents

Abstract

The present invention provides Echinococcus granulosus TSP1 recombinant proteins, and the amino acid sequence of the Echinococcus granulosus TSP1 recombinant proteins is sequence table SEQ ID No.2.Present invention also offers a kind of solubility expression method, the solution expression with high efficiency of TSP1 recombinant proteins is realized：The recombinant protein of expression is largely soluble protein, accounts for bacterium coli solubility total protein 90%；Then Ni NTA His Bind are used（Clontech）Prepacked column purification of Recombinant Echinococcus granulosus TSP1, obtains TSP1 purifying proteins.Using elution buffer（500mM/L imidazoles, 20mM/L Tris, 500mM/L NaCI, PH8.0）When can obtain the Echinococcus granulosus TSP1 of high-purity a kind of.Using the purifying protein as envelope antigen, a kind of ELISA kit for being used to detect echinococcosis granulosa can be prepared.

Description

Echinococcus granulosus TSP1 recombinant proteins and its solubility expression method and purification process

Technical field

The invention belongs to gene engineering technology field, and in particular to Echinococcus granulosus TSP1 recombinant proteins and its solubility Expression and purification process.

Background technology

Transmembrane protein 1（TSP1）It is an antigen gene in Echinococcus granulosus Schistosoma japonicum.TSP1 is a kind of Important Echinococcus granulosus antigen, may take part in Echinococcus granulosus signal transduction path, growth, differentiation for cell With important physiological significance.TSP1 is probably homologous gene with annexin family (Annexin family) member, is belonged to Annexin families.The physiological function of the antigen is studied, not only it will be seen that it is for the parasitic of Echinococcus Granulosus Cysts, growth, hair The significance in vital movement such as educate, new drug target and candidate vaccine can also be provided to treat and prevent echinococcosis. Based on above research background, the present invention constructs the prokaryotic expression plasmid of coding Echinococcus granulosus TSP1 genes, is transformed into big Enterobacteria expression system, induces its solubility expression, and carries out protein purification, has obtained the albumen, is its immunogene from now on Property, Analysis of Biochemical Characteristics and functional study are laid a good foundation.

The content of the invention

There is provided a kind of Echinococcus granulosus TSP1 prokaryotic expression carrier by technique for gene engineering by the present invention PET30a- TSP1, Escherichia coli are converted using the carrier（BL21-DE3）Realize TSP1 high-level solubility expression.And There is provided a kind of affinity chromatographic purification process, the restructuring TSP1 of substantial amounts of high-purity is purified into, for TSP1 immunogenicities, life Change specificity analysis and functional study, anti-Echinococcus hydatid cyst vaccine, the research and development of anti-hydatid drugs and the immunodiagnosis of cystic echinococcosis patient.

The present invention provides Echinococcus granulosus TSP1 recombinant proteins, the amino of the Echinococcus granulosus TSP1 recombinant proteins Acid sequence is sequence table SEQ ID No.2.

Preferably, the nucleotides sequence of the Echinococcus granulosus TSP1 recombinant proteins coding is classified as sequence table SEQ ID 27th -836 bit bases in No.1.

The present invention also provides the solubility expression of above-mentioned Echinococcus granulosus TSP1 recombinant proteins, and step is as follows：

（1）Target gene TSP1 amplification；

（2）Build TSP1 expression plasmids：By step（1）Target gene TSP1 digestions of preparation and after purification, are built into pET-30a Corresponding polyclone enzyme enzyme site, builds plasmid pET30a-TSP1；

（3）By step（2）The plasmid pET30a-TSP1 of preparation is transformed intoE.Coli, will in BL21 (DE3) competent cellE.ColiBL21 (DE3)-pET30a-TSP1 is enlarged culture, then adds 0.2 mmol/L IPTG in 25 DEG C, 120 R/min inductions shaken cultivation 8 hours；Ultrasound after centrifugation is resuspended, collects supernatant.

Preferably, step（3）Described in expand culture be byE.ColiBL21 (DE3)-pET30a-TSP1 is first inoculated with To LB solid mediums, 37 DEG C of overnight incubations；Then monoclonal is into LB fluid nutrient mediums on picking culture medium, in 37 DEG C, 180r/min shaken cultivations 3 hours, make OD values to 0.5；Bacterium solution is finally taken to be seeded in LB fluid nutrient mediums, in 37 DEG C, 180r/ Min shaken cultivations, make OD values to 0.5.

The present invention also provides the purification process of above-mentioned Echinococcus granulosus TSP1 recombinant proteins, is to use Ni-NTA His- Bind（Clontech）Purification system purification of recombinant proteins, is then eluted using elution buffer；The elution buffer Formula be：500mM/L imidazoles, 20mM/L Tris, 500mM/L NaCl, pH8.0.

Preferably, step is as follows：

（1）Ultra-pure water is added in Ni-NTA His-Bind prepacked columns, the medium for making it slowly flow through filling in post；

（2）Add combination buffer；The formula of the combination buffer is：20mM/L Tris, 500mM/L NaCl, 20mM/L Imidazoles, pH8.0；

（3）Loading, adds ultrasonicationE.ColiMake supernatant slow after the supernatant that BL21 (DE3)-TSP1 is extracted, standing Flow through medium in post；

（4）Combination buffer is added, it is slowly flowed across medium in post；The formula of the combination buffer is：20mM/L Tris, 500mM/L NaCl, 20mM/L imidazoles, pH8.0；

（5）No. 1 eluent is added, it is slowly flowed across medium in post, the formula of No. 1 eluent is：100 mM/L miaows Azoles, 20 mM/L Tris, 500 mM/L NaCl, pH8.0；

（6）No. 2 eluents are added, it is slowly flowed across medium in post, the formula of No. 2 eluents is：200 mM/L miaows Azoles, 20 mM/L Tris, 500 mM/L NaCl, pH8.0；

（7）No. 3 eluents are added, it is slowly flowed across medium in post, the formula of No. 3 eluents is：300 mM/L miaows Azoles, 20 mM/L Tris, 500 mM/L NaCl, pH8.0；

（8）No. 4 eluents are added, it is slowly flowed across medium in post, the formula of No. 4 eluents is：400 mM/L miaows Azoles, 20 mM/L Tris, 500 mM/L NaCl, pH8.0；

（9）No. 5 elution buffers are added, it is slowly flowed across medium in post, eluent is collected；No. 5 elution buffers It is formulated and is：500mM/L imidazoles, 20mM/L Tris, 500mM/L NaCl, pH8.0.

Preferably, the ultrasonicationE.ColiSupernatant and elution buffer that BL21 (DE3)-TSP1 is extracted Volume ratio is 1:1.

The present invention also provides above-mentioned Echinococcus granulosus TSP1 recombinant proteins and is preparing the ELISA of detection echinococcosis granulosa Application in kit.

The present invention, which also provides to be coated with a kind of ELISA kit for detecting echinococcosis granulosa, the ELISA kit, to be resisted Originally it was the Echinococcus granulosus TSP1 recombinant proteins described in claim 1 or 2.

Preferably, the envelope antigen is diluted to the μ g/ of final concentration 8 with pH 9.6 0.05M/L carbonate buffer solutions ml；

Preferably, the kit also includes confining liquid, the confining liquid is the TBST containing 5% skimmed milk power, the percentage The unit of ratio is g/ml.

The invention provides a kind of new Echinococcus granulosus transmembrane protein 1（TSP1）Gene and Echinococcus granulosus TSP1 The protein of coded by said gene, and there is provided the prokaryotic expression carrier pET30a- TSP1 of Echinococcus granulosus TSP1 a kind of.Should Carrier contains T7 promoters and terminator, bacterial ribosome binding site and TSP1 genes and one histidine-tagged, from particulate TSP1 genes are cloned in echinococcus Schistosoma japonicum, its expression in Escherichia coli is controlled with T7 promoters, are utilized Carrier conversion Escherichia coli (BL21-DE3), and under the conditions of lower temperature, relatively low inducer concentrations and shorter induction time The bacterium is induced, TSP1 solution expression with high efficiency can be achieved：The recombinant protein of expression is largely soluble protein, accounts for large intestine Bacillus total soluble protein 90%.Then with Ni-NTA superflow affinitive layer purifications restructuring Echinococcus granulosus TSP1, obtain To TSP1 purifying proteins.Using elution buffer（500mM/L imidazoles, 20mM/L Tris, 500mM/L NaCI, PH8.0） A kind of Echinococcus granulosus TSP1 of new high-purity is can obtain during 10ml.TSP1 expression of recombinant proteins amount is high, and specific It is in solubility expression under inductive condition, the operation for purifying the albumen is comparatively simple, and cost is also very low, easily reuses.This hair Bright prepared recombinant protein can be used for the immunodiagnosis of cystic echinococcosis patient, and it can be by bladder type bag as immunizing antigen Parasitosis patients serum recognizes, when being detected applied to indirect ELISA, possesses higher specificity and sensitivity, and clinical detection meets Rate is up to 90%.

Brief description of the drawings

Accompanying drawing is used for providing a further understanding of the present invention, and constitutes a part for specification, the reality with the present invention Applying example is used to explain the present invention together, is not construed as limiting the invention.In the accompanying drawings：

Fig. 1 is Echinococcus granulosus TSP1 gene PCR amplified production electrophoresis results；

Fig. 2 is Echinococcus granulosus TSP1 prokaryotic expression；

Fig. 3 is Echinococcus granulosus TSP1 affinitive layer purification results.

Embodiment

Following embodiment facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments Method, is conventional method unless otherwise specified.Test material used, is city unless otherwise specified in following embodiments Sell.

The protein sequence of the Echinococcus granulosus TSP1 gene orders of embodiment one and its coding

1047 nucleotides of Echinococcus granulosus TSP1 total lengths, maximum ORFs（ORF）Positioned at 27-836, contain 810bp, initiation codon is atg, and terminator codon is tga, encodes the ammonia of 269 amino acid, its nucleotide sequence and coding Base acid sequence is shown in sequence table SEQ ID No.1 and 2 respectively.

Nucleotide sequence：

Amino acid sequence：

The Echinococcus granulosus TSP1 of embodiment two prokaryotic expression carrier pET30a-TSP1 clone builds

1. target gene TSP1 amplification

With the SK-TSP1 of Echinococcus granulosus pBluescript II（The SK-TSP1 of Echinococcus granulosus pBluescript II are from sea Southern medical college's parasitology teaching and research room obtains, and the public can also obtain from the teaching and research room）For template, according to particulate spine ball silk ribbon Worm TSP1 gene orders design following two pairs of primers：

Upstream primer sequence is：CGCGATATCATGACCACTGG, containsEcoRV restriction enzyme sites,

Downstream primer sequence is：GAGTCGACTCATATTGGGGAAGC, containsSalI restriction enzyme sites,

Expand the maximum ORFs of TSP1 genes（ORF）In gene order（That is 27-836 gene order）, PCR reactions Condition：98 DEG C of pre-degeneration 5min；96 DEG C of denaturation 35s, 65 DEG C of renaturation 35s, 72 DEG C of extension 45s, 35 circulations；72 DEG C of extensions 10min.Amplified production electrophoresis result is shown in Fig. 1.

Fig. 1 is Echinococcus granulosus TSP1 gene PCR amplified production electrophoresis results；Wherein, M, Marker III；1, TSP1 Pcr amplification product.

2. build TSP1 expression plasmids

After PCR primer is purified, amplification obtains fragment quiltEcoRV andSalI digestions and after purification, are built into pET-30a corresponding Polyclone enzyme enzyme site, build plasmid pET30a-TSP1, through sequencing identification, TSP1 sequence information and target gene sequence Unanimously：Nucleotides sequence is classified as in sequence table SEQ ID No.1 27-836, encodes 269 amino acid, the amino acid sequence of coding It is classified as sequence table SEQ ID No.2.

The Echinococcus granulosus TSP1 of embodiment three prokaryotic expression

Under different inductive conditions, the amount of soluble expression of recombinant protein is different, is below optimal abductive approach：

PrepareE.ColiBL21 (DE3) competent cell, the plasmid pET30a-TSP1 that embodiment 2 is prepared is transformed intoE.ColiIn BL21 (DE3) competent cell, streak inoculationE.ColiBL21 (DE3)-pET30a-TSP1 to LB solids train Support on base, 37 DEG C of overnight incubations；Monoclonal is into 5ml LB fluid nutrient mediums on picking culture medium, and in 37 DEG C, 180r/min shakes Culture 3 hours is swung, makes OD values to 0.5；1ml bacterium solutions are taken to be seeded in 200ml LB fluid nutrient mediums, in 37 DEG C, 180r/min Shaken cultivation, makes OD values to 0.5；Add IPTG（0.2 mmol/L）In 25 DEG C, 120 r/min inductions shaken cultivation 8 hours；4 DEG C 12000g/min, centrifugation 10min collects bacterium, is resuspended in 40ml combination buffers（20mM/L Tris, 500mM/L NaCl, 20mM/L imidazoles, pH8.0）；Supernatant is extracted after ultrasonication bacterium, power 200W, ultrasonic 8S, interval 8S, 25mins, And carrying out SDS-PAGE electrophoresis, it is seen that albumen expression quantity in supernatant is very high, in solubility expression（See Fig. 2）.Recombinant protein Matter is largely soluble protein, accounts for bacterium coli solubility total protein 90%.

In order to search out optimal inductive condition, applicant carried out many experiments, Fig. 2 is Echinococcus granulosus TSP1 not Prokaryotic expression under the conditions of isogeneous induction.

Wherein, in A figures, M：Marker；1-4, BL21（DE3）- pET30a- TSP1 are in 37 DEG C, and IPTG concentration is respectively 1st, the electrophoretogram of supernatant after 0.8,0.5,0.2 mmol/L, 18 h of induction；5-8, BL21（DE3）- pET30a- TSP1 are in 30 DEG C, IPTG concentration is respectively 1,0.8,0.5,0.2 mmol/L, the electrophoretogram of supernatant after 12 h of induction；

In B figures, M：Marker；1-3, BL21（DE3）- pET30a- TSP1 are in 25 DEG C, and IPTG is respectively 0.5,0.2,0.1 The electrophoretogram of supernatant after mmol/L, induction 8h.

As seen from Figure 2, it is 37 DEG C in inducing temperature, IPTG is respectively 1,0.8,0.5,0.2 mmol/L, induces 18 h Afterwards, the extremely low TSP1 in solubility expression of visible expression quantity in supernatant；Inducing temperature is down to 30 DEG C, IPTG is respectively 1st, 0.8,0.5,0.2 mmol/L, induces 12 h, the visible TSP1 in solubility expression in supernatant, its expression quantity is compared with 37 DEG C When increased；Further reduction inducing temperature is to 25 DEG C, and IPTG concentration is respectively 0.5,0.2,0.1 mmol/L, induces 8 h Afterwards, can make the expression quantity of TSP1 in supernatant increases, and IPTG concentration is 0.2 mmol/L, and soluble T SP1 expression quantity is most It is many, thus using this condition as TSP1 protokaryon induced expressions optimal conditions.

Example IV Echinococcus granulosus TSP1 affinitive layer purification

Using Ni-NTA His-Bind（Clontech）Purification system purifies destination protein.Ni-NTA His-Bind prepacked columns are purchased From Novagen companies of the U.S., model：70691-3.

When various materials are added dropwise, rate of addition is 1 drop/10 seconds.

The purification effect difference for the recombinant protein that different purification process is obtained to purification process, it is necessary to optimize.With It is part optimization process down：

20ml ultra-pure waters are added in Ni-NTA His-bind prepacked columns, the medium for making it slowly flow through filling in post；Add 20ml combination buffers（50mM/L NaH₂PO₄, 300mM/L NaCl, pH8.0）, Jie for making it slowly flow through filling in post Matter；Loading, adds 4ml and passes through ultrasonicationE.ColiThe supernatant that BL21 (DE3)-pET30a- TSP1 are extracted, controlling stream Speed makes supernatant slowly flow across in post medium and collect；Add 40ml wash buffers（50mM/L NaH₂PO₄, 300mM/L NaCl, 20mM/L imidazoles, pH8.0）, coutroi velocity makes it slowly flow across medium in post, to elute foreign protein；Add 50mM/L Imidazole elution（50 mM/L imidazoles, 50mM/L NaH₂PO₄, 300mM/L NaCl, pH8.0）2ml, makes it slowly flow across in post Medium is simultaneously collected；Add 100mM/L imidazole elutions（100 mM/L imidazoles, 50mM/L NaH₂PO₄, 300mM/L NaCl, pH8.0）2ml, makes it slowly flow across in post medium and collect；Add 200 mM/L imidazole elutions（200mM/L imidazoles, 50mM/L NaH₂PO₄, 300mM/L NaCl, pH8.0）2ml, makes it slowly flow across in post medium and collect；Add 300mM/L Imidazole elution（300 mM/L imidazoles, 50mM/L NaH₂PO₄, 300mM/L NaCl, pH8.0）2ml, makes it slowly flow across post Interior medium is simultaneously collected；Add 400 mM/L imidazole elutions（400 mM/L imidazoles, 50mM/L NaH₂PO₄, 300mM/L NaCl, pH8.0）2ml, makes it slowly flow across in post medium and collect.The eluent of collection is subjected to SDS-PAGE analyses respectively, The degree of purification of albumen is checked, the A figures seen in Fig. 3.

Fig. 3 is Echinococcus granulosus TSP1 affinitive layer purification results.

Wherein, in A figures, M：Marker；1-2, BL21（DE3）- pET30a- TSP1 supernatants are as former state；3, albumen loading mistake Liquid is flowed through after post；4,50mM/L imidazole elutions；5,100mM/L imidazole elutions；6,200mM/L imidazole elutions；7, 300mM/L imidazole elutions；8,400mM/L imidazole elutions.

From the A figures in Fig. 3：Respectively with 50 mM/L, 100 mM/L, 200 mM/L, 300 mM/L, 400 mM/L miaows Azoles eluent can elute destination protein, and the destination protein amount under the elution of especially 200 mM/L imidazole elutions is most It is many, but purity of protein is not high, foreign protein content is very high, therefore further optimization protein purification condition, is carried out using following methods Purifying.

20ml ultra-pure waters are added in Ni-NTA His-Bind prepacked columns, the medium for making it slowly flow through filling in post With scouring media；Add 20ml Tris- combination buffers（20 mM/L Tris, 500 mM/L NaCl, 20 mM/L imidazoles, pH8.0）With balance media；Loading, adds 10ml and passes through ultrasonicationE.ColiThe supernatant that BL21 (DE3)-TSP1 is extracted, Coutroi velocity makes supernatant slowly flow across medium in post；Add 40ml Tris- combination buffers（20 mM/L Tris, 500 MM/L NaCl, 20 mM/L imidazoles, pH8.0）, coutroi velocity makes it slowly flow across in post medium to elute foreign protein；Add 1 Number eluent（100 mM/L imidazoles, 20 mM/L Tris, 500 mM/L NaCl, pH8.0）2 ml, make it slowly flow across in post Medium is simultaneously collected；Add No. 2 eluents（200 mM/L imidazoles, 20 mM/L Tris, 500 mM/L NaCl, pH8.0）2 ml, It is set to slowly flow across in post medium and collect；Add No. 3 eluents（300 mM/L imidazoles, 20 mM/L Tris, 500 mM/L NaCl, pH8.0）2 ml, make it slowly flow across in post medium and collect；Add No. 4 eluents（400 mM/L imidazoles, 20 mM/ L Tris, 500 mM/L NaCl, pH8.0）2 ml, make it slowly flow across in post medium and collect；Add No. 5 eluents（500 MM/L imidazoles, 20 mM/L Tris, 500 mM/L NaCl, pH8.0）2 ml, make it slowly flow across in post medium and collect；Will The eluent of collection carries out SDS-PAGE analyses respectively, checks the degree of purification of albumen.It can be seen that being obtained when with No. 5 elutions To purity very high TSP1（See Fig. 3 B）, the molecular weight of albumen is about 29.7KD.The B figures that SDS-PAGE results are shown in Fig. 3.

In Fig. 3 B figures, M：Marker ；1-2, BL21（DE3）- pET30a- TSP1 supernatants are as former state；3, albumen loading Cross and liquid is flowed through after post；4, No. 1 eluents；5, No. 2 eluents；6, No. 3 eluents；7, No. 4 eluents；8, No. 5 eluents（Purifying Preferably, purity is high for effect）.

Embodiment five detects the ELISA kit of echinococcosis granulosa

Detecting the ELISA kit of echinococcosis granulosa includes following components：

1st, envelope antigen：The recombinant protein of the purifying obtained using embodiment 4 is envelope antigen, with pH 9.6 0.05M/L carbonic acid The recombinant protein of salt buffer dilution purifying is to the μ g/ml of final concentration 8；

2nd, confining liquid：5 g skimmed milk powers are dissolved in 100 ml TBST；

3rd, negative control：Healthy Human Serum, 1:200 dilutions；

4th, ELIAS secondary antibody：The goat anti-human igg of peroxidase labelling, 1:10000 dilutions；

5th, TMB nitrite ions；

6th, terminate liquid：The 2 mol/L concentrated sulfuric acids.

The Echinococcus granulosus antigen TSP1 of embodiment six ELISA detections

Using recombinant protein after purification as antigen, to 20 parts of infection hydatidosis human serum samples and 20 parts of Healthy Human Serum samples Product carry out indirect ELISA detection.Specific method is as follows：

The recombinant protein purified with pH 9.6 0.05M/L carbonate buffer solutions dilution is to the μ g/ml of final concentration 8, per hole 20096 hole elisa Plates are coated with, 4 DEG C overnight；Liquid in hole is got rid of, with pH 7.4 3 (5 min/ of PBST board-washings It is secondary) 200 μ l confining liquids are added per hole afterwards, 37 DEG C are closed 1 hour.PBST board-washings 3 times (5 min/ times), per hole 100It is separately added into Echinococcus Granulosus Cysts patient and Healthy Human Serum（1: 200 dilution）, 37 DEG C incubate 1 hour；PBST is washed Plate 3 times, the goat anti-human igg of peroxidase labelling is added per the μ l of hole 100（ 1：10000 dilutions）, 37 DEG C incubate 1 hour； PBST board-washings 3 times, TMB nitrite ions are added per the μ l of hole 100, and 37 DEG C of lucifuges are reacted 30 minutes, and 2 are added per the μ l of hole 50 Mol/L concentrated sulfuric acid terminating reactions, determine absorbance（）Value.With Healthy Human SerumThe extraordinarily standard deviation of average 2 is Positive cutoff value.ELISA testing results as shown in table 1, the diagnosis of kit of the invention to echinococcosis granulosa patients serum Sensitiveness is 90%（18/20）, there is preferable Immunodiagnosis to echinococcosis granulosa.

The Echinococcus granulosus TSP1 ELISA testing results of table 1

Finally it should be noted that：The preferred embodiments of the present invention are the foregoing is only, are not intended to limit the invention, although The present invention is described in detail with reference to the foregoing embodiments, for those skilled in the art, it still can be right Technical scheme described in foregoing embodiments is modified, or carries out equivalent substitution to which part technical characteristic.It is all Within the spirit and principles in the present invention, any modification, equivalent substitution and improvements made etc. should be included in the protection of the present invention Within the scope of.

Sequence table

<110>Lanzhou University

<120>Echinococcus granulosus TSP1 recombinant proteins and its solubility expression method and purification process

<210> 1

<211> 1047

<212> DNA

<213>Echinococcus granulosus TSP1 nucleotide sequences

<400> 1

ccggggacca cctacagcgg cacacaatga ccactggtta tgatataatg cgcagttcct 60

gctcgacgtt gacgcgattc atcatcggtc tgctcaatct gattttggga gttacatttt 120

tggtgcttgg agtagttggc gtgctgctac gaaccaacaa ggaattcttg cttaaattca 180

ctaacagtct ctccgaaaag ttcctcaatg aggcttcaca agaacaggcg gatgaaatag 240

ctcaattctt gctaaaatac gatgttggaa taccggcgat attcatcgtg gtgggatttg 300

ccatcaccgg tgtctgcatt ctcgggttca tagcgacctg ctgttcatgc aataaactcc 360

tacaaatcta tgcggtgatt ttaacatcca ttgttgtgat ccaagttatc gccgttggag 420

tcatctttgg ggtcccggac atataccgca gcttagcatt tcagggcatg gagaaaacgc 480

ttgcctacta cgatccgagc actcctgagg gcaaagggtc tgccagactg tgggatctta 540

ttatgactgc aaacaaagag acctgttgcg gaatggatgg agccaatgac ttcaaaaaca 600

caccttttga tcccaagtgt ccaaaatact gttgcaaagc agacaaggac tgtttgatta 660

ctgatgcatt ggcgttgact ccaccggttg agggatgtcg tggaaagata agacgctacg 720

ctgatgaata catgttgaag attttggtca ttcttatcat cttcatcgct tgccaggtag 780

ttctttcaat cctcacctac gtggcactga catgtaagac tgcttcccca atatgagagg 840

aggggcgccg tttgctgcac caaattatct ctgcttgttt tctgcacctc atcattcact 900

actgtgttaa gagatgtggg ttcctctcat tgattcccct tcactcacaa ggaaagttaa 960

taaagcgtag agatatgtgc attttttacg taaaaaaaaa aaaaaaaaac atgtcggccg 1020

cctcggccta tgtgcggccg ccaccgc 1047

<210> 2

<211> 269

<212> PRT

<213>Echinococcus granulosus TSP1 recombinant proteins

<400> 2

Met Thr Thr Gly Tyr Asp Ile Met Arg Ser Ser Cys Ser Thr Leu Thr

1 5 10 15

Arg Phe Ile Ile Gly Leu Leu Asn Leu Ile Leu Gly Val Thr Phe Leu

20 25 30

Val Leu Gly Val Val Gly Val Leu Leu Arg Thr Asn Lys Glu Phe Leu

35 40 45

Leu Lys Phe Thr Asn Ser Leu Ser Glu Lys Phe Leu Asn Glu Ala Ser

50 55 60

Gln Glu Gln Ala Asp Glu Ile Ala Gln Phe Leu Leu Lys Tyr Asp Val

65 70 75 80

Gly Ile Pro Ala Ile Phe Ile Val Val Gly Phe Ala Ile Thr Gly Val

85 90 95

Cys Ile Leu Gly Phe Ile Ala Thr Cys Cys Ser Cys Asn Lys Leu Leu

100 105 110

Gln Ile Tyr Ala Val Ile Leu Thr Ser Ile Val Val Ile Gln Val Ile

115 120 125

Ala Val Gly Val Ile Phe Gly Val Pro Asp Ile Tyr Arg Ser Leu Ala

130 135 140

Phe Gln Gly Met Glu Lys Thr Leu Ala Tyr Tyr Asp Pro Ser Thr Pro

145 150 155 160

Glu Gly Lys Gly Ser Ala Arg Leu Trp Asp Leu Ile Met Thr Ala Asn

165 170 175

Lys Glu Thr Cys Cys Gly Met Asp Gly Ala Asn Asp Phe Lys Asn Thr

180 185 190

Pro Phe Asp Pro Lys Cys Pro Lys Tyr Cys Cys Lys Ala Asp Lys Asp

195 200 205

Cys Leu Ile Thr Asp Ala Leu Ala Leu Thr Pro Pro Val Glu Gly Cys

210 215 220

Arg Gly Lys Ile Arg Arg Tyr Ala Asp Glu Tyr Met Leu Lys Ile Leu

225 230 235 240

Val Ile Leu Ile Ile Phe Ile Ala Cys Gln Val Val Leu Ser Ile Leu

245 250 255

Thr Tyr Val Ala Leu Thr Cys Lys Thr Ala Ser Pro Ile

260 265

Claims (10)

1. Echinococcus granulosus TSP1 recombinant proteins, it is characterised in that：The amino of the Echinococcus granulosus TSP1 recombinant proteins Acid sequence is sequence table SEQ ID No.2.

2. Echinococcus granulosus TSP1 recombinant proteins according to claim 1, it is characterised in that：The Echinococcus granulosus The nucleotides sequence of TSP1 recombinant proteins coding is classified as the 27th -836 bit bases in sequence table SEQ ID No.1.

3. the solubility expression of the Echinococcus granulosus TSP1 recombinant proteins described in claim 1 or 2, it is characterised in that：Step It is as follows：

（1）Target gene TSP1 amplification；

（2）Build TSP1 expression plasmids：By step（1）Target gene TSP1 digestions of preparation and after purification, are built into pET-30a Corresponding polyclone enzyme enzyme site, builds plasmid pET30a-TSP1；

（3）By step（2）The plasmid pET30a-TSP1 of preparation is transformed intoE.Coli, will in BL21 (DE3) competent cellE.ColiBL21 (DE3)-pET30a-TSP1 is enlarged culture, then adds 0.2 mmol/L IPTG in 25 DEG C, lures Lead shaken cultivation 8 hours；Ultrasound after centrifugation is resuspended, collects supernatant.

4. solubility expression according to claim 3, it is characterised in that：Step（3）Described in expand culture be byE.ColiBL21 (DE3)-pET30a-TSP1 is first seeded on LB solid mediums, 37 DEG C of overnight incubations；Then picking culture Monoclonal is into LB fluid nutrient mediums on base, and in 37 DEG C, 180r/min shaken cultivations 3 hours make OD values to 0.5；Finally take bacterium Liquid is seeded in LB fluid nutrient mediums, and in 37 DEG C, 180r/min shaken cultivations make OD values to 0.5.

5. the purification process of the Echinococcus granulosus TSP1 recombinant proteins described in claim 1 or 2, it is characterised in that：It is to use Ni-NTA His-Bind（Clontech）Purification system purification of recombinant proteins, is then eluted using elution buffer；It is described The formula of elution buffer is：500mM/L imidazoles, 20mM/L Tris, 500mM/L NaCl, pH8.0.

6. purification process according to claim 5, it is characterised in that：Step is as follows：

（1）Ultra-pure water is added in Ni-NTA His-Bind prepacked columns, the medium for making it slowly flow through filling in post；

（2）Add combination buffer；The formula of the combination buffer is：20mM/L Tris, 500mM/L NaCl, 20mM/L Imidazoles, pH8.0；

（3）Loading, adds ultrasonicationE.ColiMake supernatant slow after the supernatant that BL21 (DE3)-TSP1 is extracted, standing Flow through medium in post；

（4）Combination buffer is added, it is slowly flowed across medium in post；The formula of the combination buffer is：20mM/L Tris, 500mM/L NaCl, 20mM/L imidazoles, pH8.0；

（5）No. 1 eluent is added, it is slowly flowed across medium in post, the formula of No. 1 eluent is：100 mM/L miaows Azoles, 20 mM/L Tris, 500 mM/L NaCl, pH8.0；

（6）No. 2 eluents are added, it is slowly flowed across medium in post, the formula of No. 2 eluents is：200 mM/L miaows Azoles, 20 mM/L Tris, 500 mM/L NaCl, pH8.0；

（7）No. 3 eluents are added, it is slowly flowed across medium in post, the formula of No. 3 eluents is：300 mM/L miaows Azoles, 20 mM/L Tris, 500 mM/L NaCl, pH8.0；

（8）No. 4 eluents are added, it is slowly flowed across medium in post, the formula of No. 4 eluents is：400 mM/L miaows Azoles, 20 mM/L Tris, 500 mM/L NaCl, pH8.0；

（9）No. 5 elution buffers are added, it is slowly flowed across medium in post, eluent is collected；No. 5 elution buffers It is formulated and is：500mM/L imidazoles, 20mM/L Tris, 500mM/L NaCl, pH8.0.

7. purification process according to claim 6, it is characterised in that：The ultrasonicationE.Coli BL21(DE3)- The supernatant and the volume ratio of elution buffer that TSP1 is extracted are 1:1.

8. the Echinococcus granulosus TSP1 recombinant proteins described in claim 1 or 2 are preparing the ELISA of detection echinococcosis granulosa Application in kit.

9. a kind of ELISA kit for detecting echinococcosis granulosa, it is characterised in that：Envelope antigen in the ELISA kit For the Echinococcus granulosus TSP1 recombinant proteins described in claim 1 or 2.

10. kit according to claim 9, it is characterised in that：Envelope antigen pH 9.6 0.05M/L carbon Phthalate buffer is diluted to the μ g/ml of final concentration 8；

Preferably, the kit also includes confining liquid, the confining liquid is the TBST containing 5% skimmed milk power, the percentage The unit of ratio is g/ml.