CN114015696B

CN114015696B - Trachinotus ovatus interferon regulatory factor IRF6 gene, protein, preparation method and application

Info

Publication number: CN114015696B
Application number: CN202111321224.9A
Authority: CN
Inventors: 孙云; 周永灿; 张盼盼; 曹贞洁; 吴莹; 王世锋; 郭伟良
Original assignee: Hainan University
Current assignee: Hainan University
Priority date: 2021-11-09
Filing date: 2021-11-09
Publication date: 2023-06-16
Anticipated expiration: 2041-11-09
Also published as: CN114015696A

Abstract

The invention relates to an trachinotus ovatus interferon regulatory factor IRF6 gene, protein, a preparation method and application thereof, and belongs to the technical field of molecular biology, wherein the sequence of the trachinotus ovatus interferon regulatory factor IRF6 gene is shown as SEQ ID N0.1, and the amino acid sequence of protein encoded by the gene is shown as SEQ ID N0.2. The invention also provides a preparation method of the trachinotus ovatus interferon regulatory factor IRF6 gene recombinant protein, and the recombinant protein can activate a promoter of interferon protein in trachinotus ovatus in vitro through MyD88 joint protein or TBK1 kinase, can be used as an immunopotentiator, and has application value in the aspects of preparing antiviral drugs, antibacterial drugs, anti-inflammatory agents and the like.

Description

Trachinotus ovatus interferon regulatory factor IRF6 gene, protein, preparation method and application

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to an oval pompano interferon regulatory factor IRF6 gene recombinant protein, a preparation method and application thereof.

Background

Trachinotus ovatus is an important marine fish. The innate immune system is thought to play an important role in its resistance to pathogen infection due to the limitations of the adaptive immune defense system of trachinotus ovatus, such as limited antibody repertoire, slow lymphocyte proliferation and maturation. Therefore, with the continuous expansion of the cultivation scale and the increase of the cultivation density, various diseases caused by bacteria, fungi and viruses continuously burst in the cultivation population of the trachinotus ovatus, resulting in great economic loss.

Similar to mammals, fish host cells recognize pathogen-associated pattern molecules (PAMPs) via Pattern Recognition Receptors (PRRs) and then transmit signals that cause production of downstream Interferons (IFNs) or other related cytokines, resulting in the host cells remaining in an anti-infective state. Toll-like receptors (TLRs) and RIG-I like receptors (RLRs) are considered to be the two major PRRs that recognize PAMPs and transmit signals to downstream factors. In the TLR signaling pathway, myeloid differentiation factor 88 (MyD 88) is used as an adapter to bind to the Toll/IL-1 receptor (TIR) domain of TLR and then activate NF-kB to initiate transcription of IFN. In the RLR signal path, the cascade signals are activated in the order RIG-I-MAVS-TBK1-IRF 3; finally, IRF3 is phosphorylated by TBK1 and transferred into the nucleus to promote IFN transcription.

Interferon (IFN) is a class of cytokines that can inhibit cell division, regulate immunity, resist viruses, and tumors, and can be classified into α, β, γ, ω, and the like. Among these, ifnγ has the functions of promoting NK cell activity, promoting antigen presentation, and enhancing macrophage lysosome activity. Interferon Regulatory Factors (IRFs) are important transcription factors that regulate the expression of Interferon (IFN), interferon-stimulated genes (ISGs), and other related genes, are capable of binding to DNA sequences containing 5'-GAAA-3' conserved motifs in the promoter region upstream of Interferon (IFN) or interferon-stimulated genes (ISGs), and exert a variety of biological effects by regulating the expression of IFN, ISGs, and other closely related genes. In vertebrates, 11 IRFs, IRF1 to IRF11, respectively, have been identified. All IRFs members contain a conserved helix-turn-helix IRF domain, also known as a DNA binding domain, at their N-terminus. In this domain there are 5 conserved tryptophan residues (Trp), which 5 conserved residues play an important role in the recognition of DNA sequences containing 5'-GAAA-3' tetranucleotides. The research shows that IRFs member IRF6 can regulate the signal path induced by virus, bacteria and interferon, and plays a significant role in the aspects of antiviral infection, innate immunity and adaptive immune response, cell proliferation, apoptosis and the like.

However, there has been no report so far on recombinant protein of interferon regulatory factor IRF6 gene of trachinotus ovatus, preparation method and application in preparation of immunopotentiator.

Disclosure of Invention

The invention aims to solve the technical problem of providing an trachinotus ovatus interferon regulatory factor IRF6 gene recombinant protein, a preparation method and application thereof.

In order to solve the technical problems, the invention provides an trachinotus ovatus interferon regulatory factor IRF6 gene, wherein the cDNA nucleotide sequence of the trachinotus ovatus interferon regulatory factor IRF6 gene is shown as SEQ ID N0.1:

the amino acid sequence of the trachinotus ovatus interferon regulatory factor IRF6 gene is shown as SEQ ID N0.2:

the invention provides a recombinant expression method of an IRF6 disease resistance gene and a coded protein thereof, which comprises the steps of extracting RNA of trachinotus ovatus head kidney tissue, reversely transcribing the RNA into cDNA, and obtaining a nucleotide sequence of the IRF6 disease resistance gene by PCR with the cDNA as a template and the following sequence as a primer, wherein the sequence of the primer is as follows:

TroIRF6-F：5’-atttaaatgggccaccatgtcggtcacccctcgacg-3’；

TroIRF6-R：5’-atttaaatggctgtgtctgcagggcctggg-3’。

the nucleotide sequence of the IRF6 disease-resistant gene obtained by PCR is connected with a pMD19-T vector, transformed into escherichia coli DH5 alpha, sequenced and identified as a recombinant, and the recombinant is named as TroIRF 6-Tsample after the sequencing is correct. Extracting TroIRF6-Tsimple plasmid, and recovering 1476bp fragment after restriction enzyme digestion by smiI restriction enzyme; extracting PET-32a plasmid, and connecting the 1476bp recovery fragment by using T4 ligase after EcoR V enzyme digestion to construct recombinant plasmid; the recombinant plasmid is verified to contain IRF6 genes by gene sequencing, and is named pET32a-TroIRF6;

transferring the plasmid pET32a-TroIRF6 into an escherichia coli BL21 expression strain by a conventional method, naming the plasmid pET32a-TroIRF6 as E.coil BL21 (DE 3)/pET 32a-TroIRF6, performing induction culture, and purifying to obtain the recombinant protein with the amino acid sequence in a sequence table SEQ ID N0.2.

Application of the trachinotus ovatus interferon regulatory factor IRF6 gene recombinant protein in preparing trachinotus ovatus immunopotentiator.

Compared with the prior art, the invention has the beneficial effects that:

the interferon regulatory factor IRF6 recombinant protein can obviously inhibit the growth of pathogenic bacteria and improve the disease resistance of fishes. The trachinotus ovatus interferon regulatory factor IRF6 gene recombinant protein can activate a promoter of interferon protein (TroIFNgamma) in trachinotus ovatus in vitro through MyD88 joint protein or TBK1 kinase, can be used as an immunopotentiator, and has application value in the aspects of preparing antiviral drugs, antibacterial drugs, anti-inflammatory agents and the like.

Drawings

FIG. 1 is an electrophoresis diagram of recombinant protein purification of trachinotus ovatus interferon regulatory factor IRF6 gene according to an embodiment of the invention.

FIG. 2 is a graph showing the change in the number of bacteria in the liver, spleen and kidneys at various time points after injection of purified recombinant protein IRF6 (rIRF 6) from Trachinotus ovatus interferon regulatory factor in experimental fish.

FIG. 3 is a functional effect diagram of the recombinant protein of the interferon regulatory factor IRF6 of Trachinotus ovatus in activating the TroIFN gamma promoter region in HEK293T cells. a: schematic representation of a continuous truncated mutant of the troifnγ promoter, b: double luciferase reporter gene detection of transcriptional activity of TroIRF6 on troifnγ promoter;

fig. 4 is a functional effect diagram of the recombinant protein IRF6, which is an interferon regulatory factor of trachinotus ovatus, in activating the promoter region of interferon protein (troifnγ) in trachinotus ovatus in HEK293T cells by MyD88 adaptor protein or TBK1 kinase. a: troMyD88 promotes TroIRF6 to regulate TroIFNγ promoter activity. b: troTBK1 promotes TroIRF6 to regulate TroIFNγ promoter activity.

Detailed Description

The technical scheme of the present invention is further explained by examples below, but the scope of the present invention is not limited in any way by the examples.

Example 1

Trachinotus ovatus interferon regulatory factor IRF6 gene, wherein the nucleotide sequence of Trachinotus ovatus interferon regulatory factor IRF6 gene cDNA is shown as SEQ ID N0.1, and the amino acid sequence of Trachinotus ovatus interferon regulatory factor IRF6 gene is shown as SEQ ID N0.2

The preparation method of the oval pomfret interferon regulatory factor IRF6 gene recombinant protein is carried out sequentially according to the following steps:

1. construction of recombinant vectors

Extracting RNA of head and kidney tissues of trachinotus ovatus, reversely transcribing the RNA into cDNA, and obtaining a nucleotide sequence of IRF6 disease resistance gene by PCR with the cDNA as a template and the following sequence as a primer, wherein the sequence of the primer is:

TroIRF6-F：5’-ATTTAAATGGGCCACCATGTCGGTCACCCCTCGACG-3’；

TroIRF6-R：5’-ATTTAAATGGCTGTGTCTGCAGGGCCTGGG-3’。

the reaction conditions are 94 ℃ pre-denaturation for 5min,94 ℃ 30s,62 ℃ 30s,72 ℃ 1min 40s,72 ℃ extension for 5min, and 35 cycles are total; the amplified fragment is connected with a pMD19-T carrier after passing through a gel recovery purification kit (Novain biotechnology company), and is transformed into escherichia coli DH5 alpha, and positive colonies are selected for PCR detection; after the detection is correct, the sample is named TroIRF 6-Tsample.

Extracting recombinant plasmid TroIRF6-Tsimple, and recovering 1476bp fragment after restriction enzyme digestion by using smiI restriction enzyme; extracting pET-32a plasmid, and connecting the 1476bp recovery fragment by using T4 ligase to construct recombinant plasmid after the plasmid is digested by EcoR V; the recombinant plasmid is verified to contain IRF6 genes by gene sequencing, and is named pET32a-TroIRF6;

2. inducible expression of recombinant protein rTroIRF6

The plasmid pET32a-TroIRF6 was transformed into competent cells of the expression strain E.coil BL21 (DE 3) (purchased from full gold biosystems, beijing) by a conventional method, cultured on LB solid medium containing ampicillin (1%o) for 12-20 hours, and the positive transformant was picked up and designated as E.coil BL21 (DE 3)/pET 32a-TroIRF6.

Inoculating E.coil BL21 (DE 3)/pET 32a-TroIRF6 strain into LB medium containing ampicillin (1%o), and shake culturing at 37deg.C at 180rpm/min to OD ₆₀₀ About 0.4 to 0.6, adding isopropyl-beta-D-thiogalactopyranoside (IPTG) to a final concentration of 0.2mM/L for induction expression, continuously shaking and culturing at 180rpm/min for 35h at 16 ℃, centrifuging at 8000g and 4 ℃ for 10min, collecting bacterial liquid, adding 6ml of Lysis Buffer (0 mM imidazole solution, pH=8.0), thoroughly mixing, quick-freezing for 10min by liquid nitrogen, naturally thawing at 4 ℃, performing ultrasonic crushing, centrifuging at 12000rpm and 4 ℃ for 30min, and recovering supernatant.

3. Purification of recombinant protein rTroIRF6

Purifying by Ni-NTA-Sepharose column at 4deg.C to obtain soluble recombinant protein rTroIRF6, which comprises the following steps:

(1) Freshly prepared 20% ethanol to clean the nickel column, 4mL, and shaking the nickel column for 30min by a horizontal shaking table;

(2) 0mM Lysis Buffer,4mL, oscillating for 30min on a horizontal shaker;

(3) Adding the protein to be purified into a column, 4mL, vibrating for 1-2h by a horizontal shaking table, standing vertically for 2min, and collecting effluent;

(4) 0mM Lysis Buffer,4mL, standing vertically for 2min after vibrating for 30min by a horizontal shaking table, and collecting effluent (this step is repeated twice);

(5) 40mM Wash Buffer,1.5mL, standing vertically for 2min after vibrating for 30min by a horizontal shaking table, and collecting effluent (repeating the step four times);

(6) 60mM Elution Buffer,1.5mL, standing vertically for 2min after vibrating for 30min by a horizontal shaking table, and collecting effluent (this step is repeated three times);

(7) 80mM Wash Buffer,1.5mL, standing vertically for 2min after vibrating for 30min by a horizontal shaking table, and collecting effluent;

(8) The column was washed with 500mM Wash Buffer,4mL, shaken on a horizontal shaker for 30min, and the filtrate was discarded (this step was repeated once);

(9) 4mL of 20% ethanol is added into the column and then stored at 4 ℃;

(10) The effluent samples from each step were tested by 12% SDA-PAGE;

(11) Cutting off a dialysis bag with proper length, boiling in boiling water for 20min, clamping one end by a clamp, adding an effluent sample which accords with the size of target protein and has single strip at the other end, fixing by the clamp, and placing in PBS buffer solution (4 ℃ and pH=7.0) for dialysis according to the instruction of the dialysis bag (Soy treasure).

(13) After the end, the dialyzed recombinant protein rTroIRF6 was stored at-80 ℃.

The purified and dialyzed recombinant protein rTroIRF6 and the protein of the control empty vector are detected by SDS-PAGE (electrophoresis at 80V for 25-30min and then electrophoresis at 120V for 1-2 h) to determine the molecular weight (see FIG. 1) and accord with the expected protein size. Thus obtaining the oval pompano interferon regulatory factor IRF6 gene recombinant protein, and the amino acid sequence is shown as SEQ ID N0.2.

Length 492 amino acids

Type of amino acids

Strand-type single strand

The molecular weight is 55.455kDa, the isoelectric point is 5.07, and the DNA binding domain has a conserved IRF domain.

Example 2: the rTroIRF6 protein can obviously improve the disease resistance and infection resistance of fish after being injected into the fish

The rTroIRF6 protein purified in example 1 was diluted to 150ug/ml in PBS to give rTroIRF6 dilution. 30 trachinotus ovatus (14.2 g.+ -. 1.3 g) were randomly divided into 2 groups of 15 strips each. Two groups, designated A and B, respectively, were each injected with 100uL rTroIRF6 dilutions, and group B was injected with 100uL PBS, respectively

Culturing Vibrio harveyi in LB medium at 37deg.C under shaking at 180rpm/min to OD ₆₀₀ About 0.4-0.6, estimated 10d=5x10 ⁸ CFU/ml, diluted to 10 in PBS ⁶ CFU/ml, namely the Vibrio harveyi bacterial suspension.

Attack of toxic materials and infection

After injecting the experimental fish of groups A and B with 100u1 rTroIRF6 dilution or 100u1 PBS for 1 day, each fish was injected with 100u1 of the Vibrio harveyi bacterial suspension prepared by the above procedure for artificial infection. At 6h,9h and 12h after infection, kidneys, spleens and livers of fish were taken, tissues were ground in PBS to prepare respective tissue suspensions, the tissue suspensions were plated on LB solid plates, and after incubation at 30℃for 12h, bacterial colony calculation was performed. The results showed that the bacterial count of the kidney, spleen and liver of group a fish was significantly lower than that of the tissue of group B fish at each time point, see fig. 2.

The PBS component has the formula of 137mmol/L NaCl, 2.7mmol/L KCl and Na ₂ HPO ₄ 10mmol/L，KH ₂ PO ₄ 2mmol/L，pH7.2-7.4。

These results indicate that rTroIRF6 can significantly inhibit the growth of pathogenic bacteria and can significantly enhance the ability of fish to resist bacterial infection. Therefore, the rTroIRF6 of the oval pomfret can be prepared into an injection preparation for preventing the Vibrio harveyi disease.

Experimental example 3: the trachinotus ovatus interferon regulatory factor IRF6 gene recombinant protein promotes transcriptional activity analysis of TroIFN gamma promoter region in HEK293T cells.

(1) The TroIRF6-Tsimple plasmid is digested by Smi I, the pCN3 plasmid is digested by EcoR V, the digested fragments are connected by T4 ligase, the transformant is transformed, and the recombinant is identified by sequencing and named pTroiRF6.

(2) Constructing a TroIFN gamma promoter truncated mutant (shown in figure 3 a) by taking an upstream 1817bp gene non-coding region of an oval pomfret interferon protein (TroIFN gamma) as a template according to a predicted binding site of the TroIFN gamma promoter sequence, respectively amplifying the TroIFN gamma promoter truncated mutant by adopting the following primers, then connecting the TroIFN gamma promoter truncated mutant with a pMD19-T vector, transforming the TroIFN gamma-Tsime, extracting plasmids, and naming the TroIFN gamma-Tsime;

Tr-IFNγ-pF1 cggggtaccttcatcttttcattggatgt

Tr-IFNγ-pF2 cggggtacctcagttaaaatcaccaaacc

Tr-IFNγ-pF3 cggggtaccatctaatgatttccgacgca

Tr-IFNγ-pF4 cggggtacccccagtatgaccagtaaag

Tr-IFNγ-pF5 cggggtacccagtttgagccaacttcag

Tr-IFNγ-pR ccgctcgagatagtgctgcagcaggttgctg

(3) The plasmid and pGL4.10 plasmid are subjected to enzyme digestion by Kpn I and Xho I, the enzyme digestion fragments are connected by T4, transformation and sequencing are carried out to identify recombinants, and the recombinants are named pGL4.10-IFN gamma promtor (shown in figure 3 b);

(4) The endotoxin removal plasmid extraction was performed on all plasmids including pGL4.10-luc, pCN3, pRL-TK, pTroiRF6 and pGL4.10-IFN gamma promtor;

(5) Human kidney epithelial cells HEK293T were cultured in DMEM medium containing 10% fetal bovine serum at 37℃at 5% C0 ₂ Taking log phase cells for testing;

(6) The cells were treated with 0.5x10 ⁵ -2x10 ⁵ Density of wells/well was seeded in 24 well cell culture plates, 500 ul/well, 5% CO ₂ Culturing in an incubator for 24 hours, and replacing respective culture mediums after the cells adhere to the wall;

(7) The plasmids were grouped as follows:

pCN3+PGL4.10+pRL-TK＝200ng+250ng+10ng

pCN3+pGL4.10-IFNγpromotor+pRL-TK＝200ng+250ng+10ng

pTroIRF6+pGL4.10-IFNγpromotor+pRL-TK＝200ng+250ng+10ng

(8) When the cell fusion degree reaches 70% -90%, carrying out transfection experiments according to the above groups and according to Lipofectamine TM3000 Reagent instruction;

(9) Placing 5% CO ₂ After 24h of culture in an incubator, the relative fluorescence activity is detected by using a double-fluorescein reporter gene detection kit after 24h of stimulation by LPSSex.

And constructing a TroIFN gamma promoter truncated mutant according to the predicted binding site of the TroIFN gamma promoter sequence. The results are shown in FIG. 3.

Analysis of results: troIRF6 increases the transcriptional activity of TroIFNgamma-1 over other mutants, indicating that TroIRF6 acts mainly on-1817 bp to +120bp of TroIFNgamma-1 promoter fragment. It follows that TroIRF6 is able to induce expression of troifnγ gene in HEK293T cells.

Experimental example 4: the trachinotus ovatus interferon regulatory factor IRF6 gene recombinant protein promotes transcriptional activity analysis of TroIFN gamma promoter region in HEK293T cells through MyD88 joint protein or TBK1 kinase.

The cDNA of the head and kidney tissues of the trachinotus ovatus is used as a template, the nucleotide sequences of MyD88 (TroMyD 88) and TBK1 (TroTBK 1) genes of the trachinotus ovatus are obtained by PCR with the following sequences as primers:

Tr-MyD88-F:GATATCGCCACCATGGCTTGTGCTGAGACAGATGTTG

Tr-MyD88-R:GATATCCGGCAGTGAAAGAACTTTGGC

Tr-TBK1-F:GATATCGCCACCATGCAGAGCACCACCAACTACC

Tr-TBK1-R:GATATCTCCTCTCAAGCCTCCATCCAG

connecting the PCR product with a pMD19-T vector, transforming, extracting a plasmid, and naming the plasmid as TroMyD 88-Tsample and TroTBK 1-Tsample;

the TroMyD88-Tsimple, troTBK1-Tsimple and pCN3 plasmids were digested with EcoR V, the digested fragments were ligated by T4 ligase, transformed, and the recombinants were identified by sequencing and designated pTroMyD88, pTroTBK1.

(1) The endotoxin removal plasmid extraction was performed on all plasmids including pGL4.10-luc, pCN3, pRL-TK, pTroIRF6, pTroMyD88, pTroTBK1 and pGL4.10-IFN gamma promtor;

(2) Human kidney epithelial cells HEK293T were cultured in DMEM medium containing 10% fetal bovine serum at 37℃under 5% CO ₂ Taking log phase cells for testing;

(3) The cells were treated with 0.5x10 ⁵ -2x10 ⁵ Density of wells/well was seeded in 24 well cell culture plates, 500 ul/well, 5% CO ₂ Culturing in an incubator for 24 hours, and replacing respective culture mediums after the cells adhere to the wall;

(4) The plasmids were grouped as follows:

pCN3+pCN3+pGL4.10-IFNγpromotor+pRL-TK＝250ng+25ng+250ng+10ng

pTroMyD88+pCN3+pGL4.10-IFNγpromotor+pRL-TK＝250ng+25ng+250ng+10ng

pCN3+pTroIRF6+pGL4.10-IFNγpromotor+pRL-TK＝250ng+25ng+250ng+10ng

pTroMyD88+pTroIRF6+pGL4.10-IFNγpromotor+pRL-TK＝250ng+25ng+250ng+10ng

pTroTBK1+pCN3+pGL4.10-IFNγpromotor+pRL-TK＝250ng+25ng+250ng+10ng

pTroTBK1+pTroIRF6+pGL4.10-IFNγpromotor+pRL-TK＝250ng+25ng+250ng+10ng

(5) When the cell fusion degree reaches 70% -90%, carrying out transfection experiments according to the above groups and according to Lipofectamine TM3000 Reagent instruction;

(6) Placing 5% CO ₂ After 24h incubation in incubator, the relative fluorescence activity was detected with the double-fluorescein reporter gene detection kit after 24h stimulation with LPS.

The results are shown in FIG. 4. Analysis of results: it can be seen from a: both TroIRF6 and TroMyD88 can improve the transcriptional activity of the TroIFNγ promoter, and when TroIRF6 and TroMyD88 are transfected into cells at the same time, the transcriptional activity of the TroIFNγ promoter is up-regulated by a higher factor; it can be seen from b: both TroIRF6 and TroTBK1 can increase the transcriptional activity of the troifnγ promoter, with the TroIRF6 and TroTBK1 being up-regulated by a higher fold when transfected into cells simultaneously. It follows that TroIRF6 is able to modulate the transcriptional activity of the troifnγ promoter in HEK293T cells by MyD88 adaptor proteins or TBK1 kinase, thereby activating expression of the promoter region of troifnγ. This will be applied to the study of IRF6 related disease mechanisms and the study of interferon related immune pathway transcription mechanisms.

Sequence listing

<110> university of Hainan

<120> Trachinotus ovatus interferon regulatory factor IRF6 gene, protein, preparation method and application

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1476

<212> DNA

<213> Trachinotus ovatus (Trachinotus ovatus)

<400> 1

atgtcggtca cccctcgacg tgtccgcctg aagccctggc tggtcgctca ggtggacagc 60

ggccggtacc cgggtctggt gtggattgac cgtgaggcca tgcgcttcag gattccgtgg 120

aaacacgcaa cacgacacac accccagcat gaggatgagg acaccatatt taaggcgtgg 180

gctgtggaga ctgggaagtt ccaggaggga gtcgatgaac ctgatcctgc aaagtggaaa 240

gctcagcttc gatgtgccct gaacaaaagc cgagaattca acctcatcta cgatggcact 300

aaagaggtcc ccatgaatcc tttgaagata tatgatgtct gcgacatccc acaacccctc 360

agtaaccaag cctcttcaga tgctggttca tggactccac atgatgatga cggcggtgag 420

gaggatgttc cagatacgcc agagtctctc cccccatacc catccaatgg ccccagcccc 480

tctcctctga tcctgtggtc tcctatgggc tcagactcat ccatgcagcc tccaagttgt 540

cccccttcaa acgaggcctg gcccaaagag gaacccgtta aaatctggcc caaagaggag 600

cctgtggatg tggagatgca ccccacaccc atggctgaca tgccgcctgc tcctctgcct 660

gatcccacca tgcagccccc tcccctaccc gacaccttgt ttgcctctcc agaaatgtgg 720

attagttccc tcccgatgac agacctggag gttcagtttc tgtaccgagg gaaggaaatg 780

tgtcccacag tgaccgttag taacccgcag ggctgcaggc tgttctacgg agacctcggc 840

cccatggtca accaggaaga gctgtttgga ccggtgaacc tggaacagtt acgcttcccg 900

accacagagc acattaccaa tgacaagcag agggtgttca ctaaccgcct gctagatgtg 960

atggacaggg gtctgatcct ggaggtcagt ggccatgata tctatgcagt ccgcctctgc 1020

cagtgtaagg tgtactggtc cggtccctgt gctccaaatc cagctgcacc gaatcttata 1080

gagcgacaga ggagggtcaa actcttctgc ctggagtctt ttctcagcag tgtgatcgcc 1140

caccagcgtg gccagacacc aaccccgcct cagtttgaaa tcagcctgtg ttttggagag 1200

gagtggcctg atgggaggcc cagggagagg aagcttatca tggttcaggt cattccagtg 1260

gtggctcgca tgataagcga gatgttttct ggagataaca cacgatcctt tgacagtggc 1320

agcgttcgcc tgcagatttc aatcccagat atcaaagaca acatagtgac ccacctcaag 1380

cagctgtact gcctgctaca gacccaccag ggccaggatg gctgggcgtt gcccccgggg 1440

tcaggcctga acatcgccca ggccctgcag acacag 1476

<210> 2

<211> 492

<212> PRT

<213> Trachinotus ovatus (Trachinotus ovatus)

<400> 2

Met Ser Val Thr Pro Arg Arg Val Arg Leu Lys Pro Trp Leu Val Ala

1 5 10 15

Gln Val Asp Ser Gly Arg Tyr Pro Gly Leu Val Trp Ile Asp Arg Glu

20 25 30

Ala Met Arg Phe Arg Ile Pro Trp Lys His Ala Thr Arg His Thr Pro

35 40 45

Gln His Glu Asp Glu Asp Thr Ile Phe Lys Ala Trp Ala Val Glu Thr

50 55 60

Gly Lys Phe Gln Glu Gly Val Asp Glu Pro Asp Pro Ala Lys Trp Lys

65 70 75 80

Ala Gln Leu Arg Cys Ala Leu Asn Lys Ser Arg Glu Phe Asn Leu Ile

85 90 95

Tyr Asp Gly Thr Lys Glu Val Pro Met Asn Pro Leu Lys Ile Tyr Asp

100 105 110

Val Cys Asp Ile Pro Gln Pro Leu Ser Asn Gln Ala Ser Ser Asp Ala

115 120 125

Gly Ser Trp Thr Pro His Asp Asp Asp Gly Gly Glu Glu Asp Val Pro

130 135 140

Asp Thr Pro Glu Ser Leu Pro Pro Tyr Pro Ser Asn Gly Pro Ser Pro

145 150 155 160

Ser Pro Leu Ile Leu Trp Ser Pro Met Gly Ser Asp Ser Ser Met Gln

165 170 175

Pro Pro Ser Cys Pro Pro Ser Asn Glu Ala Trp Pro Lys Glu Glu Pro

180 185 190

Val Lys Ile Trp Pro Lys Glu Glu Pro Val Asp Val Glu Met His Pro

195 200 205

Thr Pro Met Ala Asp Met Pro Pro Ala Pro Leu Pro Asp Pro Thr Met

210 215 220

Gln Pro Pro Pro Leu Pro Asp Thr Leu Phe Ala Ser Pro Glu Met Trp

225 230 235 240

Ile Ser Ser Leu Pro Met Thr Asp Leu Glu Val Gln Phe Leu Tyr Arg

245 250 255

Gly Lys Glu Met Cys Pro Thr Val Thr Val Ser Asn Pro Gln Gly Cys

260 265 270

Arg Leu Phe Tyr Gly Asp Leu Gly Pro Met Val Asn Gln Glu Glu Leu

275 280 285

Phe Gly Pro Val Asn Leu Glu Gln Leu Arg Phe Pro Thr Thr Glu His

290 295 300

Ile Thr Asn Asp Lys Gln Arg Val Phe Thr Asn Arg Leu Leu Asp Val

305 310 315 320

Met Asp Arg Gly Leu Ile Leu Glu Val Ser Gly His Asp Ile Tyr Ala

325 330 335

Val Arg Leu Cys Gln Cys Lys Val Tyr Trp Ser Gly Pro Cys Ala Pro

340 345 350

Asn Pro Ala Ala Pro Asn Leu Ile Glu Arg Gln Arg Arg Val Lys Leu

355 360 365

Phe Cys Leu Glu Ser Phe Leu Ser Ser Val Ile Ala His Gln Arg Gly

370 375 380

Gln Thr Pro Thr Pro Pro Gln Phe Glu Ile Ser Leu Cys Phe Gly Glu

385 390 395 400

Glu Trp Pro Asp Gly Arg Pro Arg Glu Arg Lys Leu Ile Met Val Gln

405 410 415

Val Ile Pro Val Val Ala Arg Met Ile Ser Glu Met Phe Ser Gly Asp

420 425 430

Asn Thr Arg Ser Phe Asp Ser Gly Ser Val Arg Leu Gln Ile Ser Ile

435 440 445

Pro Asp Ile Lys Asp Asn Ile Val Thr His Leu Lys Gln Leu Tyr Cys

450 455 460

Leu Leu Gln Thr His Gln Gly Gln Asp Gly Trp Ala Leu Pro Pro Gly

465 470 475 480

Ser Gly Leu Asn Ile Ala Gln Ala Leu Gln Thr Gln

485 490

<210> 3

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

atttaaatgg gccaccatgt cggtcacccc tcgacg 36

<210> 4

<211> 30

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

atttaaatgg ctgtgtctgc agggcctggg 30

<210> 5

<211> 29

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

cggggtacct tcatcttttc attggatgt 29

<210> 6

<211> 29

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

cggggtacct cagttaaaat caccaaacc 29

<210> 7

<211> 29

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

cggggtacca tctaatgatt tccgacgca 29

<210> 8

<211> 28

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

cggggtaccc ccagtatgac cagtaaag 28

<210> 9

<211> 28

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

cggggtaccc agtttgagcc aacttcag 28

<210> 10

<211> 31

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

ccgctcgaga tagtgctgca gcaggttgct g 31

<210> 11

<211> 37

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

gatatcgcca ccatggcttg tgctgagaca gatgttg 37

<210> 12

<211> 27

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

gatatccggc agtgaaagaa ctttggc 27

<210> 13

<211> 34

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

gatatcgcca ccatgcagag caccaccaac tacc 34

<210> 14

<211> 27

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

gatatctcct ctcaagcctc catccag 27

Claims

1. The trachinotus ovatus interferon regulatory factor IRF6 gene is characterized in that the cDNA nucleotide sequence of the trachinotus ovatus interferon regulatory factor IRF6 gene is shown as SEQ ID N0.1.

2. The protein encoded by the gene of claim 1, wherein the amino acid sequence of the protein is shown in SEQ ID N0.2.

3. The recombinant expression method of the protein as claimed in claim 2, which is characterized in that the nucleotide sequence as claimed in claim 1 is connected with a pMD19-T vector, transformed into escherichia coli DH5 alpha, sequenced to identify a recombinant, and the recombinant is named as TroIRF6-Tsimple after the sequence is correct; extracting TroIRF6-Tsimple plasmid, and recovering 1476bp fragment after restriction enzyme digestion by smiI restriction enzyme; extracting PET-32a plasmid byEcoRV enzyme cutting, and then connecting the 1476bp recovery fragment by using T4 ligase so as to construct recombinant plasmid; the recombinant plasmid is verified to contain IRF6 genes by gene sequencing, and is named pET32a-TroIRF6;

transferring the plasmid pET32a-TroIRF6 into an escherichia coli BL21 expression strain, and naming the plasmid pET32a-TroIRF6 as the expression strainE.coilBL21 (DE 3)/pET 32a-TroIRF6, then carrying out induction culture and purification to obtain the recombinant protein with the amino acid sequence shown as SEQ ID N0.2.

4. Use of the recombinant protein prepared by the method of claim 3 for preparing a preparation for preventing vibrio harveyi from trachinotus ovatus.