CN114015696A

CN114015696A - Trachinotus ovatus interferon regulatory factor IRF6 gene, protein, preparation method and application

Info

Publication number: CN114015696A
Application number: CN202111321224.9A
Authority: CN
Inventors: 孙云; 周永灿; 张盼盼; 曹贞洁; 吴莹; 王世锋; 郭伟良
Original assignee: Hainan University
Current assignee: Hainan University
Priority date: 2021-11-09
Filing date: 2021-11-09
Publication date: 2022-02-08
Anticipated expiration: 2041-11-09
Also published as: CN114015696B

Abstract

The invention relates to a trachinotus ovatus interferon regulatory factor IRF6 gene, protein, a preparation method and application, and belongs to the technical field of molecular biology, wherein the trachinotus ovatus interferon regulatory factor IRF6 gene sequence is shown as SEQ ID N0.1, and the amino acid sequence of the protein encoded by the gene is shown as SEQ ID N0.2. The invention also provides a preparation method of the trachinotus ovatus interferon regulatory factor IRF6 gene recombinant protein, wherein the recombinant protein can activate the promoter of the interferon protein in the trachinotus ovatus in vitro through MyD88 linker protein or TBK1 kinase, can be used as an immunopotentiator, and has application values in the aspects of preparing antiviral drugs, antibacterial drugs, anti-inflammatory agents and the like.

Description

Trachinotus ovatus interferon regulatory factor IRF6 gene, protein, preparation method and application

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to an egg-shaped pompano interferon regulatory factor IRF6 gene recombinant protein, a preparation method and application thereof.

Background

Trachinotus ovatus is an important marine culture fish. Due to the limitations of limited antibody repertoire, slow lymphocyte proliferation and maturation, etc., in the adaptive immune defense system of trachinotus ovatus, the innate immune system is considered to play an important role in resisting pathogen infection. Therefore, with the continuous expansion of the culture scale and the improvement of the culture density, various diseases caused by bacteria, fungi and viruses continuously burst in the culture population of the trachinotus ovatus, and huge economic losses are caused.

Similar to mammals, fish host cells recognize pathogen-associated pattern molecules (PAMPs) via Pattern Recognition Receptors (PRRs) and then transmit signals that cause the production of downstream Interferons (IFNs) or other relevant cytokines, thereby causing the host cells to remain in an anti-infective state. Toll-like receptors (TLRs) and RIG-I-like receptors (RLRs) are considered to be the two major PRRs that recognize PAMPs and transmit signals to downstream factors. In the TLR signaling pathway, myeloid differentiation factor 88(MyD88) is used as an adaptor to bind to the Toll/IL-1 receptor (TIR) domain of TLR, then activates NF-kB to initiate transcription of IFN. In the RLR signal path, cascade signals are activated in the sequence of RIG-I-MAVS-TBK1-IRF 3; finally, IRF3 was phosphorylated by TBK1 and transferred into the nucleus to promote IFN transcription.

Interferons (IFNs) are a class of cytokines that inhibit cell division, modulate immunity, resist viruses, and resist tumors, and can be classified into α, β, γ, ω, and the like. Among them, IFN gamma has the functions of promoting NK cell activity, promoting antigen presentation, improving macrophage lysosome activity and the like. Interferon Regulatory Factors (IRFs) are important transcription factors that regulate the expression of Interferon (IFN), interferon-stimulated gene (ISG) and other related genes, and can bind to DNA sequences containing 5'-GAAA-3' conserved motifs in the upstream promoter region of Interferon (IFN) or interferon-stimulated gene (ISG), and exert various biological effects by regulating the expression of IFN, ISG and other closely related genes. In vertebrates, 11 IRFs have been identified, IRF1 to IRF11 respectively. All IRFs members contain a conserved helix-turn-helix type IRF domain at their N-terminus, also known as DNA binding domain. In this domain, 5 conserved tryptophan residues (Trp) are present, which 5 conserved residues have an important role in the recognition of DNA sequences containing the 5'-GAAA-3' tetranucleotide. Research shows that IRFs member IRF6 can regulate and control signal channels induced by viruses, bacteria and interferon, and plays an important role in aspects of virus infection resistance, innate immunity, adaptive immune response, cell proliferation, apoptosis and the like.

However, no reports on the trachinotus ovatus interferon regulatory factor IRF6 gene recombinant protein, a preparation method and application in preparing an immunopotentiator are provided so far.

Disclosure of Invention

The invention aims to solve the technical problem of providing an trachinotus ovatus interferon regulatory factor IRF6 gene recombinant protein, a preparation method and application thereof.

In order to solve the technical problems, the invention provides an oval pompano interferon regulatory factor IRF6 gene, wherein the cDNA nucleotide sequence of the oval pompano interferon regulatory factor IRF6 gene is shown as SEQ ID N0.1:

the amino acid sequence of the trachinotus ovatus interferon regulatory factor IRF6 gene is shown as SEQ ID N0.2:

the invention provides a trachinotus ovatus interferon regulatory factor IRF6 disease-resistant gene and a recombinant expression method of an encoding protein thereof, which particularly comprises the steps of extracting RNA of trachinotus ovatus kidney tissues, carrying out reverse transcription on the RNA into cDNA, taking the cDNA as a template, taking the cDNA as a primer, and obtaining a nucleotide sequence of the IRF6 disease-resistant gene through PCR, wherein the sequence of the primer is as follows:

TroIRF6-F：5’-atttaaatgggccaccatgtcggtcacccctcgacg-3’；

TroIRF6-R：5’-atttaaatggctgtgtctgcagggcctggg-3’。

connecting the nucleotide sequence of IRF6 disease-resistant gene obtained by PCR with pMD19-T vector, transforming into Escherichia coli DH5 alpha, sequencing to identify recombinant, and naming the recombinant as TroIRF6-Tsimple after sequencing correctly. Extracting a TroIRF6-Tsimple plasmid, carrying out enzyme digestion by using smiI restriction enzyme, and recovering a 1476bp fragment; extracting a PET-32a plasmid, carrying out enzyme digestion by EcoR V, and connecting the 1476bp recovery fragment by utilizing T4 ligase to construct a recombinant plasmid; the recombinant plasmid contains IRF6 gene through gene sequencing verification, and is named as pET32a-TroIRF 6;

the plasmid pET32a-TroIRF6 is transferred into an expression strain of escherichia coli BL21 by a conventional method, is named as E.coil BL21(DE3)/pET32a-TroIRF6, and then is subjected to induction culture and purification, so that the recombinant protein with the amino acid sequence in the sequence table SEQ ID N0.2 is obtained.

An application of the trachinotus ovatus interferon regulatory factor IRF6 gene recombinant protein in preparing the trachinotus ovatus immunopotentiator.

Compared with the prior art, the invention has the beneficial effects that:

the recombinant protein of the interferon regulatory factor IRF6 can obviously inhibit the growth of pathogenic bacteria and improve the disease resistance of fish. The trachinotus ovatus interferon regulatory factor IRF6 gene recombinant protein can activate the promoter of interferon protein (TroIFN gamma) in trachinotus ovatus in vitro through MyD88 linker protein or TBK1 kinase, can be used as an immunopotentiator, and has application values in the aspects of preparing antiviral drugs, antibacterial drugs, anti-inflammatory agents and the like.

Drawings

FIG. 1 is the electrophoresis chart of the purification of the trachinotus ovatus interferon regulatory factor IRF6 gene recombinant protein.

FIG. 2 is a graph showing the change of the amount of bacteria in the liver, spleen and kidney at various time points after experimental fish are injected with purified trachinotus ovatus interferon regulatory factor IRF6 recombinant protein (r IRF 6).

FIG. 3 is a diagram showing the functional effect of the trachinotus ovatus interferon regulatory factor IRF6 recombinant protein in activating the TroIFN gamma promoter region in HEK293T cells. a: b, detecting the transcriptional activity of TroIRF6 on the TroIFN gamma promoter by using a dual-luciferase reporter gene;

FIG. 4 is a diagram showing the functional effect of the trachinotus ovatus interferon regulatory factor IRF6 recombinant protein in HEK293T cells on activation of the promoter region of the interferon protein (TroIFN gamma) in trachinotus ovatus through MyD88 linker protein or TBK1 kinase. a: TroMyD88 promotes TroIRF6 to regulate TroIFN gamma promoter activity. b: TroTBK1 promotes TroIRF6 to regulate TroIFN γ promoter activity.

Detailed Description

The technical solution of the present invention is further explained by the following examples, but the scope of the present invention is not limited in any way by the examples.

Example 1

An egg-shaped pompano interferon regulatory factor IRF6 gene, wherein the nucleotide sequence of the egg-shaped pompano interferon regulatory factor IRF6 gene cDNA is shown as SEQ ID N0.1, the amino acid sequence of the egg-shaped pompano interferon regulatory factor IRF6 gene is shown as SEQ ID N0.2

The preparation method of the trachinotus ovatus interferon regulatory factor IRF6 gene recombinant protein is sequentially carried out according to the following steps:

1. construction of recombinant vectors

Extracting RNA of trachinotus ovatus kidney tissues, reversely transcribing the RNA into cDNA, taking the cDNA as a template, and obtaining a nucleotide sequence of an IRF6 disease-resistant gene by PCR by taking the following sequence as a primer, wherein the sequence of the primer is as follows:

TroIRF6-F：5’-ATTTAAATGGGCCACCATGTCGGTCACCCCTCGACG-3’；

TroIRF6-R：5’-ATTTAAATGGCTGTGTCTGCAGGGCCTGGG-3’。

the reaction conditions are pre-denaturation at 94 ℃ for 5min, pre-denaturation at 94 ℃ for 30s, pre-elongation at 62 ℃ for 30s, pre-elongation at 72 ℃ for 1min and pre-elongation at 72 ℃ for 40s, and re-elongation at 72 ℃ for 5min for 35 cycles; the amplified fragment is connected with a pMD19-T vector after passing through a gel recovery and purification kit (Novozapine biotechnologies company), is transformed into Escherichia coli DH5 alpha, and a positive bacterial colony is selected for PCR detection; after the detection is correct, the sequence is named as TroIRF 6-Tsimple.

Extracting a recombinant plasmid TroIRF6-Tsimple, carrying out enzyme digestion by using smiI restriction enzyme, and recovering a 1476bp fragment; extracting pET-32a plasmid, carrying out enzyme digestion on the plasmid by EcoR V, and connecting the 1476bp recovery fragment by utilizing T4 ligase to construct a recombinant plasmid; the recombinant plasmid contains IRF6 gene through gene sequencing verification, and is named as pET32a-TroIRF 6;

2. inducible expression of recombinant protein rTroIRF6

The plasmid pET32a-TroIRF6 was transferred into competent cells of the expression strain E.coil BL21(DE3) (purchased from Korea gold Co., Ltd., Beijing) by a conventional method, cultured on LB solid medium containing ampicillin (1 ‰) for 12-20 hours, and a positive transformant was selected and named E.coil BL21(DE3)/pET32a-TroIRF6.

Inoculating E.coil BL21(DE3)/pET32a-TroIRF6 strain into LB culture medium containing ampicillin (1 ‰), and performing shake culture at 37 deg.C and 180rpm/min to OD₆₀₀About 0.4 to 0.6, adding isopropyl-beta-D-thiogalactopyranoside (IPTG) to a final concentration of 0.2mM/L for induction expression, and continuing to perform induction expression at 180rpm/min at 16 DEG CCulturing for 35h by shaking, centrifuging at 4 deg.C for 10min at 8000g, collecting bacterial solution, adding 6ml lysine Buffer (0mM imidazole solution, pH 8.0), mixing completely, quick freezing with liquid nitrogen for 10min, thawing at 4 deg.C, performing ultrasonication, centrifuging at 12000rpm for 30min at 4 deg.C, and recovering supernatant.

3. Purification of the recombinant protein rTroIRF6

Under the condition of 4 ℃, a Ni-NTA-Sepharose column is adopted for purification to obtain a soluble recombinant protein rTroIRF6, and the specific operation steps are as follows:

(1) cleaning a nickel column with 4mL of freshly prepared 20% ethanol, and shaking the nickel column for 30min by using a horizontal shaking table;

(2)0mM lysine Buffer, 4mL, shaking horizontally for 30 min;

(3) adding the protein to be purified into a column, shaking by a horizontal shaking table for 1-2h at a volume of 4mL, standing for 2min vertically, and collecting effluent liquid;

(4)0mM lysine Buffer, 4mL, shaking by a horizontal shaker for 30min, standing vertically for 2min, and collecting effluent (the step is repeated twice);

(5)40mM Wash Buffer (1.5 mL), shaking by a horizontal shaker for 30min, standing vertically for 2min, and collecting effluent (repeating the step for four times);

(6)60mM Elution Buffer, 1.5mL, shaking in a horizontal shaker for 30min, standing vertically for 2min, and collecting effluent (repeating the step three times);

(7)80mM Wash Buffer (1.5 mL), shaking for 30min by a horizontal shaker, standing for 2min vertically, and collecting effluent;

(8) washing the column with 500mM Wash Buffer, 4mL, shaking on a horizontal shaker for 30min, and discarding the filtrate (this step is repeated once);

(9) adding 4mL of 20% ethanol into the column, and storing at 4 ℃;

(10) effluent samples from each step were detected by 12% SDA-PAGE;

(11) cutting a dialysis bag with a proper length, boiling in boiling water for 20min, clamping one end of the bag with a clamp, adding an effluent sample with a single band and a size corresponding to the target protein at the other end of the bag, fixing the effluent sample with the clamp, and placing the effluent sample in a PBS buffer solution (4 ℃, pH 7.0) to perform dialysis according to the instruction of the dialysis bag (Solebao).

(13) After completion, the dialyzed recombinant protein rTroIRF6 was stored at-80 ℃.

The purified, dialyzed recombinant protein rTroIRF6 and the control empty vector were detected by SDS-PAGE electrophoretic analysis (electrophoresis at 80V for 25-30min, followed by electrophoresis at 120V for 1-2h), and the molecular weights were determined (see FIG. 1), which corresponded to the expected protein sizes. Thus obtaining the trachinotus ovatus interferon regulatory factor IRF6 gene recombinant protein, the amino acid sequence of which is shown as SEQ ID N0.2.

492 amino acids in length

Type of amino acid

Chain type single chain

The molecular weight is 55.455kDa, the isoelectric point is 5.07, and the molecular weight has a conserved IRF structural domain, namely a DNA binding structural domain.

Example 2: after the rTroIRF6 protein is injected into fish, the disease and infection resistance of the fish is obviously improved

The rTroIRF6 protein purified in example 1 was diluted to 150ug/ml in PBS, which was rTroIRF6 dilution. 30 trachinotus ovatus (14.2g +/-1.3 g) were randomly divided into 2 groups of 15. Two groups of fish named A and B, respectively, were injected with 100uL rTroIRF6 diluent for each fish in group A, and 100uL PBS for group B

Culturing Vibrio harveyi in LB culture medium at 37 deg.C under shaking at 180rpm/min to OD₆₀₀About 0.4 to 0.6, and an estimated 10D-5 x10⁸CFU/ml, diluted to 10 in PBS⁶CFU/ml, namely the Vibrio harveyi bacterial suspension.

Infection with offensive pathogen

After injecting 100u1 rTroIRF6 diluent or 100u1 PBS to experimental fishes in groups A and B for 1 day, each fish was injected with 100u1 of the Vibrio harveyi bacterial suspension prepared by the above steps for artificial infection. At 6h, 9h and 12h after infection, the kidney, spleen and liver of the fish are taken, tissues are ground in PBS to prepare each tissue suspension, the tissue suspension is coated on an LB solid plate and cultured at 30 ℃ for 12h, and then bacterial colony calculation is carried out. The results showed that the bacteria counts in kidney, spleen and liver of group a fish were significantly lower than those in group B fish tissue at each time point, see figure 2.

The PBS component has the formula of NaCl 137mmol/L, KCl 2.7mmol/L and Na₂HPO₄ 10mmol/L，KH₂PO₄ 2mmol/L，pH7.2-7.4。

These results indicate that rtrooirf 6 can significantly inhibit the growth of pathogenic bacteria and can significantly enhance the ability of fish to resist bacterial infestation. Therefore, the trachinotus ovatus rTroIRF6 can be prepared into an injection preparation for preventing vibriosis harveyi.

Experimental example 3: the trachinotus ovatus interferon regulatory factor IRF6 gene recombinant protein of the invention promotes the transcriptional activity analysis of a TroIFN gamma promoter region in HEK293T cells.

(1) The TroIRF 6-Tsample plasmid is subjected to enzyme digestion by Smi I, the pCN3 plasmid is subjected to enzyme digestion by EcoR V, the enzyme digestion fragments are connected by T4 ligase, and the transformant is transformed, sequenced and identified to be a recombinant, and the recombinant is named as pTROIRF 6.

(2) Constructing a TroIFN gamma promoter truncated mutant (shown as a figure 3a) by taking an upstream 1817bp gene non-coding region of trachinotus ovatus interferon protein (TroIFN gamma) as a template according to a binding site predicted by a TroIFN gamma promoter sequence, respectively adopting the following primers for amplification, then connecting the primers with a pMD19-T vector, transforming, extracting a plasmid, and naming the plasmid as TroIFN gamma-Tsimple;

Tr-IFNγ-pF1 cggggtaccttcatcttttcattggatgt

Tr-IFNγ-pF2 cggggtacctcagttaaaatcaccaaacc

Tr-IFNγ-pF3 cggggtaccatctaatgatttccgacgca

Tr-IFNγ-pF4 cggggtacccccagtatgaccagtaaag

Tr-IFNγ-pF5 cggggtacccagtttgagccaacttcag

Tr-IFNγ-pR ccgctcgagatagtgctgcagcaggttgctg

(3) carrying out enzyme digestion on the plasmid and the pGL4.10 plasmid by using Kpn I and Xho I, connecting enzyme digestion fragments by using T4, transforming, sequencing and identifying a recombinant, and naming the recombinant as pGL4.10-IFN gamma promoter (as shown in figure 3 b);

(4) extracting all plasmids including pGL4.10-luc, pCN3, pRL-TK, pTROIRF6 and pGL4.10-IFN gamma promoter to remove endotoxin;

(5) human renal epithelial cells HEK293T were cultured in DMEM medium containing 10% fetal bovine serum at 37 deg.C and 5% C0₂Culturing in the incubator, and taking logarithmic phase cells for testing;

(6) the cells were washed at 0.5 × 10⁵-2x10⁵The density per well was seeded in 24-well cell culture plates, 500 ul/well, 5% CO₂Culturing for 24h in an incubator, and replacing respective culture media after the cells adhere to the wall;

(7) the plasmids were grouped as follows:

pCN3+PGL4.10+pRL-TK＝200ng+250ng+10ng

pCN3+pGL4.10-IFNγpromotor+pRL-TK＝200ng+250ng+10ng

pTroIRF6+pGL4.10-IFNγpromotor+pRL-TK＝200ng+250ng+10ng

(8) when the cell fusion degree reaches 70% -90%, performing transfection experiments according to the above groups and according to Lipofectamine (TM) 3000 Reagent instructions;

(9) put 5% CO₂After culturing in an incubator for 24h, stimulating the cells for 24h by LPS, and detecting the relative fluorescence activity by using a bifluorescin reporter gene detection kit.

And constructing a TroIFN gamma promoter truncated mutant according to the binding site predicted by the TroIFN gamma promoter sequence. The results are shown in FIG. 3.

And (4) analyzing results: TroIRF6 increased the transcriptional activity of TroIFN gamma-1 higher than other mutants, indicating that TroIRF6 mainly acts on the-1817 bp to +120bp of the TroIFN gamma-1 promoter fragment. It can be seen that TroIRF6 was able to induce expression of TroIFN γ gene in HEK293T cells.

Experimental example 4: the trachinotus ovatus interferon regulatory factor IRF6 gene recombinant protein promotes the transcriptional activity analysis of a TroIFN gamma promoter region in HEK293T cells through MyD88 linker protein or TBK1 kinase.

The nucleotide sequences of MyD88(TroMyD88) and TBK1(TroTBK1) genes of the trachinotus ovatus are obtained by PCR by using cDNA of the kidney tissues of the trachinotus ovatus as a template and the following sequences as primers:

Tr-MyD88-F:GATATCGCCACCATGGCTTGTGCTGAGACAGATGTTG

Tr-MyD88-R:GATATCCGGCAGTGAAAGAACTTTGGC

Tr-TBK1-F:GATATCGCCACCATGCAGAGCACCACCAACTACC

Tr-TBK1-R:GATATCTCCTCTCAAGCCTCCATCCAG

connecting the PCR product with a pMD19-T vector, transforming, extracting plasmids, and naming the plasmids as TroMyD 88-Tprime and TroTBK 1-Tprime;

the plasmid of the TroMyD 88-Tprime, the plasmid of the TroTBK 1-Tprime and the plasmid of the pCN3 are cut by EcoR V, the cut fragments are connected by T4 ligase, transformed, sequenced and identified recombinants, and the recombinants are named as pTroMyD88 and pTroTBK 1.

(1) Extracting all plasmids including pGL4.10-luc, pCN3, pRL-TK, pTROIRF6, pTROMyD88, pTROTBK1 and pGL4.10-IFN gamma promoter with endotoxin removing plasmid;

(2) human renal epithelial cells HEK293T were cultured in DMEM medium containing 10% fetal bovine serum at 37 deg.C and 5% CO₂Culturing in the incubator, and taking logarithmic phase cells for testing;

(3) the cells were washed at 0.5 × 10⁵-2x10⁵The density per well was seeded in 24-well cell culture plates, 500 ul/well, 5% CO₂Culturing for 24h in an incubator, and replacing respective culture media after the cells adhere to the wall;

(4) the plasmids were grouped as follows:

pCN3+pCN3+pGL4.10-IFNγpromotor+pRL-TK＝250ng+25ng+250ng+10ng

pTroMyD88+pCN3+pGL4.10-IFNγpromotor+pRL-TK＝250ng+25ng+250ng+10ng

pCN3+pTroIRF6+pGL4.10-IFNγpromotor+pRL-TK＝250ng+25ng+250ng+10ng

pTroMyD88+pTroIRF6+pGL4.10-IFNγpromotor+pRL-TK＝250ng+25ng+250ng+10ng

pTroTBK1+pCN3+pGL4.10-IFNγpromotor+pRL-TK＝250ng+25ng+250ng+10ng

pTroTBK1+pTroIRF6+pGL4.10-IFNγpromotor+pRL-TK＝250ng+25ng+250ng+10ng

(5) when the cell fusion degree reaches 70% -90%, performing transfection experiments according to the above groups and according to Lipofectamine (TM) 3000 Reagent instructions;

(6) put 5% CO₂After culturing in an incubator for 24h, stimulating the cells for 24h by LPS, and detecting the relative fluorescence activity by using a bifluorescin reporter gene detection kit.

The results are shown in FIG. 4. And (4) analyzing results: as can be seen from a: both TroIRF6 and TroMyD88 can improve the transcriptional activity of the TroIFN gamma promoter, and when the TroIRF6 and the TroMyD88 are transfected into cells at the same time, the transcriptional activity of the TroIFN gamma promoter is up-regulated by a higher factor; as can be seen from b: both TroIRF6 and TroTBK1 can increase the transcriptional activity of the TroIFN γ promoter, and when TroIRF6 and TroTBK1 are transfected into cells simultaneously, the transcriptional activity of the TroIFN γ promoter is up-regulated by a higher factor. Thus, it can be seen that TroIRF6 can regulate the transcriptional activity of the TroIFN γ promoter through MyD88 linker protein or TBK1 kinase in HEK293T cells, thereby activating the expression of the promoter region of TroIFN γ. This will apply to the study of IRF 6-related disease mechanisms and the study of interferon-related immune pathway transcription mechanisms.

Sequence listing

<110> university of Hainan

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1476

<212> DNA

<213> Trachinotus ovatus (Trachinotus ovatus)

<400> 1

atgtcggtca cccctcgacg tgtccgcctg aagccctggc tggtcgctca ggtggacagc 60

ggccggtacc cgggtctggt gtggattgac cgtgaggcca tgcgcttcag gattccgtgg 120

aaacacgcaa cacgacacac accccagcat gaggatgagg acaccatatt taaggcgtgg 180

gctgtggaga ctgggaagtt ccaggaggga gtcgatgaac ctgatcctgc aaagtggaaa 240

gctcagcttc gatgtgccct gaacaaaagc cgagaattca acctcatcta cgatggcact 300

aaagaggtcc ccatgaatcc tttgaagata tatgatgtct gcgacatccc acaacccctc 360

agtaaccaag cctcttcaga tgctggttca tggactccac atgatgatga cggcggtgag 420

gaggatgttc cagatacgcc agagtctctc cccccatacc catccaatgg ccccagcccc 480

tctcctctga tcctgtggtc tcctatgggc tcagactcat ccatgcagcc tccaagttgt 540

cccccttcaa acgaggcctg gcccaaagag gaacccgtta aaatctggcc caaagaggag 600

cctgtggatg tggagatgca ccccacaccc atggctgaca tgccgcctgc tcctctgcct 660

gatcccacca tgcagccccc tcccctaccc gacaccttgt ttgcctctcc agaaatgtgg 720

attagttccc tcccgatgac agacctggag gttcagtttc tgtaccgagg gaaggaaatg 780

tgtcccacag tgaccgttag taacccgcag ggctgcaggc tgttctacgg agacctcggc 840

cccatggtca accaggaaga gctgtttgga ccggtgaacc tggaacagtt acgcttcccg 900

accacagagc acattaccaa tgacaagcag agggtgttca ctaaccgcct gctagatgtg 960

atggacaggg gtctgatcct ggaggtcagt ggccatgata tctatgcagt ccgcctctgc 1020

cagtgtaagg tgtactggtc cggtccctgt gctccaaatc cagctgcacc gaatcttata 1080

gagcgacaga ggagggtcaa actcttctgc ctggagtctt ttctcagcag tgtgatcgcc 1140

caccagcgtg gccagacacc aaccccgcct cagtttgaaa tcagcctgtg ttttggagag 1200

gagtggcctg atgggaggcc cagggagagg aagcttatca tggttcaggt cattccagtg 1260

gtggctcgca tgataagcga gatgttttct ggagataaca cacgatcctt tgacagtggc 1320

agcgttcgcc tgcagatttc aatcccagat atcaaagaca acatagtgac ccacctcaag 1380

cagctgtact gcctgctaca gacccaccag ggccaggatg gctgggcgtt gcccccgggg 1440

tcaggcctga acatcgccca ggccctgcag acacag 1476

<210> 2

<211> 492

<212> PRT

<213> Trachinotus ovatus (Trachinotus ovatus)

<400> 2

Met Ser Val Thr Pro Arg Arg Val Arg Leu Lys Pro Trp Leu Val Ala

1 5 10 15

Gln Val Asp Ser Gly Arg Tyr Pro Gly Leu Val Trp Ile Asp Arg Glu

20 25 30

Ala Met Arg Phe Arg Ile Pro Trp Lys His Ala Thr Arg His Thr Pro

35 40 45

Gln His Glu Asp Glu Asp Thr Ile Phe Lys Ala Trp Ala Val Glu Thr

50 55 60

Gly Lys Phe Gln Glu Gly Val Asp Glu Pro Asp Pro Ala Lys Trp Lys

65 70 75 80

Ala Gln Leu Arg Cys Ala Leu Asn Lys Ser Arg Glu Phe Asn Leu Ile

85 90 95

Tyr Asp Gly Thr Lys Glu Val Pro Met Asn Pro Leu Lys Ile Tyr Asp

100 105 110

Val Cys Asp Ile Pro Gln Pro Leu Ser Asn Gln Ala Ser Ser Asp Ala

115 120 125

Gly Ser Trp Thr Pro His Asp Asp Asp Gly Gly Glu Glu Asp Val Pro

130 135 140

Asp Thr Pro Glu Ser Leu Pro Pro Tyr Pro Ser Asn Gly Pro Ser Pro

145 150 155 160

Ser Pro Leu Ile Leu Trp Ser Pro Met Gly Ser Asp Ser Ser Met Gln

165 170 175

Pro Pro Ser Cys Pro Pro Ser Asn Glu Ala Trp Pro Lys Glu Glu Pro

180 185 190

Val Lys Ile Trp Pro Lys Glu Glu Pro Val Asp Val Glu Met His Pro

195 200 205

Thr Pro Met Ala Asp Met Pro Pro Ala Pro Leu Pro Asp Pro Thr Met

210 215 220

Gln Pro Pro Pro Leu Pro Asp Thr Leu Phe Ala Ser Pro Glu Met Trp

225 230 235 240

Ile Ser Ser Leu Pro Met Thr Asp Leu Glu Val Gln Phe Leu Tyr Arg

245 250 255

Gly Lys Glu Met Cys Pro Thr Val Thr Val Ser Asn Pro Gln Gly Cys

260 265 270

Arg Leu Phe Tyr Gly Asp Leu Gly Pro Met Val Asn Gln Glu Glu Leu

275 280 285

Phe Gly Pro Val Asn Leu Glu Gln Leu Arg Phe Pro Thr Thr Glu His

290 295 300

Ile Thr Asn Asp Lys Gln Arg Val Phe Thr Asn Arg Leu Leu Asp Val

305 310 315 320

Met Asp Arg Gly Leu Ile Leu Glu Val Ser Gly His Asp Ile Tyr Ala

325 330 335

Val Arg Leu Cys Gln Cys Lys Val Tyr Trp Ser Gly Pro Cys Ala Pro

340 345 350

Asn Pro Ala Ala Pro Asn Leu Ile Glu Arg Gln Arg Arg Val Lys Leu

355 360 365

Phe Cys Leu Glu Ser Phe Leu Ser Ser Val Ile Ala His Gln Arg Gly

370 375 380

Gln Thr Pro Thr Pro Pro Gln Phe Glu Ile Ser Leu Cys Phe Gly Glu

385 390 395 400

Glu Trp Pro Asp Gly Arg Pro Arg Glu Arg Lys Leu Ile Met Val Gln

405 410 415

Val Ile Pro Val Val Ala Arg Met Ile Ser Glu Met Phe Ser Gly Asp

420 425 430

Asn Thr Arg Ser Phe Asp Ser Gly Ser Val Arg Leu Gln Ile Ser Ile

435 440 445

Pro Asp Ile Lys Asp Asn Ile Val Thr His Leu Lys Gln Leu Tyr Cys

450 455 460

Leu Leu Gln Thr His Gln Gly Gln Asp Gly Trp Ala Leu Pro Pro Gly

465 470 475 480

Ser Gly Leu Asn Ile Ala Gln Ala Leu Gln Thr Gln

485 490

<210> 3

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atttaaatgg gccaccatgt cggtcacccc tcgacg 36

<210> 4

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atttaaatgg ctgtgtctgc agggcctggg 30

<210> 5

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cggggtacct tcatcttttc attggatgt 29

<210> 6

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cggggtacct cagttaaaat caccaaacc 29

<210> 7

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cggggtacca tctaatgatt tccgacgca 29

<210> 8

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cggggtaccc ccagtatgac cagtaaag 28

<210> 9

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

cggggtaccc agtttgagcc aacttcag 28

<210> 10

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ccgctcgaga tagtgctgca gcaggttgct g 31

<210> 11

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gatatcgcca ccatggcttg tgctgagaca gatgttg 37

<210> 12

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gatatccggc agtgaaagaa ctttggc 27

<210> 13

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gatatcgcca ccatgcagag caccaccaac tacc 34

<210> 14

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gatatctcct ctcaagcctc catccag 27

Claims

1. An oval pompano interferon regulatory factor IRF6 gene is characterized in that the cDNA nucleotide sequence of the oval pompano interferon regulatory factor IRF6 gene is shown as SEQ ID N0.1.

2. The protein encoded by the gene of claim 1, wherein the amino acid sequence of the protein is as shown in SEQ ID N0.2.

3. The method for recombinant expression of the protein according to claim 2, wherein the method comprises ligating the nucleotide sequence of claim 1 with a pMD19-T vector, transforming into e.coli DH5 α, sequencing to identify recombinants, and after the sequencing is correct, naming them as TroIRF 6-Tsimple; extracting a TroIRF6-Tsimple plasmid, carrying out enzyme digestion by using smiI restriction enzyme, and recovering a 1476bp fragment; extracting a PET-32a plasmid, carrying out enzyme digestion by EcoR V, and connecting the 1476bp recovery fragment by utilizing T4 ligase to construct a recombinant plasmid; the recombinant plasmid contains IRF6 gene through gene sequencing verification, and is named as pET32a-TroIRF 6;

the plasmid pET32a-TroIRF6 is transferred into an expression strain of escherichia coli BL21, is named as E.coil BL21(DE3)/pET32a-TroIRF6, and then is subjected to induction culture and purification, so that the recombinant protein with the amino acid sequence in the sequence table SEQ ID N0.2 is obtained.

4. The use of the recombinant protein prepared by the method of claim 3 in the preparation of immune potentiators for trachinotus ovatus.