CN112898436A

CN112898436A - Expression of mouse PD1 and mouse IL-15 gene fusion protein with targeting function and application thereof

Info

Publication number: CN112898436A
Application number: CN202110099592.7A
Authority: CN
Inventors: 冷启彬; 宋涛; 周旭宇
Original assignee: Institute of Microbiology of CAS; Cancer Center of Guangzhou Medical University
Current assignee: Institute of Microbiology of CAS; Cancer Center of Guangzhou Medical University
Priority date: 2020-10-23
Filing date: 2021-01-25
Publication date: 2021-06-04

Abstract

The invention belongs to the field of biological medicine, and discloses a mouse PD1 and mouse IL-15 gene fusion protein with a targeting function; the fusion protein. The protein will probably gain the following functions: 1. the PD1 molecule extracellular segment can be specifically bound to the PD-L1 molecule on the surface of a tumor cell; 2. the fusion protein molecule bound to the tumor cell PD-L1 molecule can prevent the binding of other cell surface PD1 molecules, thereby preventing the cellular immune activity from being blocked; 3. IL-15 cytokines can enrich in the tumor microenvironment and stimulate proliferative activation of relevant innate immune cells such as NK cells and CD8+ T cells; 4. the stimulated relevant innate immune cells can perform an anti-tumor killing function. The fusion protein can be used as a medicament for single treatment, and can be used for combined treatment with other treatment strategies, so that a new scheme is provided for clinical treatment.

Description

Expression of mouse PD1 and mouse IL-15 gene fusion protein with targeting function and application thereof

Technical Field

The invention relates to the technical field of biological medicines, and in particular relates to expression and application of a fusion protein of a mouse PD1 and a mouse IL-15 gene with a targeting function.

Background

The immune checkpoint molecule PD1 is a type 1 transmembrane protein expressed on the surface of most effector immune cells, including DC cells, B cells, activated T cells, NK cells, and the like. PD1 can bind to two ligands, the PD-L1 and PD-L2 molecules, with PD-L1 being the primary ligand. First, the PD1 molecule can directly affect the formation of T cell immune synapses that occur during the early stages of T cell activation. Second, binding of the PD1 molecule to PD-L1/2 would attenuate the TCR and the necessary secondary signaling pathway in activated T cells. Third, PDL1 molecule can also inhibit T cell activation by blocking the CD28-B7.1 signaling pathway by interacting with B7.1 molecule in addition to PD1 molecule. Fourth, the PD1 molecule is highly expressed on the surface of Treg cells, a major cell population with immunosuppressive functions. When activated T cells recognize antigens via a complex formed by TCR and MHC binding, the immune checkpoint PD1: PD-L1 will be preferentially examined before tumor cells are recognized. Therefore, when the PD-L1 on the surface of the tumor cell and the PD1 on the surface of the T cell are combined with each other, the T cell does not recognize the tumor cell as a foreign object to kill, thereby ensuring the survival of the tumor cell. Thus, the immunosuppressive functions of these cells can be inhibited or reduced by binding of the corresponding ligand molecules or antibodies to immune checkpoint receptor molecules expressed on the surface of tumor cells, e.g., knocking out or blocking PD1/PD-L1 can enhance the function of tumor-site effector T cells.

The cytokine IL-15 is a glycoprotein of 14-15kD in size, belonging to the family of co-gamma chain receptor cytokines, and many cells, including fibroblasts, glial cells, epithelial cells, neural cells, monocytes, macrophages, and dendritic cells, express IL-15. IL-15 is a highly potent immunostimulatory factor that stimulates the production, proliferation and activation of NK cells; stimulation of activation and proliferation of T cells; induction of CTL (tumor infiltrating lymphocytes) production; inducing the production of antibodies by B cells. In addition, IL-15 can improve the generation and survival ability of memory CD8+ T cells, and the memory CD8+ T cells can be better applied to adoptive cell transfer therapy. There are studies showing that IL-15 can prolong the lifespan of mice inoculated with CT26 colon cancer cells.

Immunotherapy with IL-15 alone is not the best option, as IL-15 may also activate negative regulatory checkpoint molecules in the immune system, thereby suppressing the immune response. In addition, nonspecific cytokines cannot specifically target tumor tissues, and thus it is difficult to release appropriate amounts of cytokines to tumor tissues in order to prevent systemic toxic effects in cytokine therapy, which becomes a limiting factor of the therapy.

Disclosure of Invention

In order to overcome the defects of the prior art, the primary object of the present invention is to provide a fusion protein of murine PD1 and murine IL-15 gene with targeting function.

The second purpose of the invention is to provide a preparation method of the fusion protein of the mouse PD1 and the mouse IL-15 gene with the targeting function.

The third purpose of the invention is to provide the application of the fusion protein of the murine PD1 and the murine IL-15 gene with the targeting function.

The purpose of the invention is realized by the following technical scheme:

a fusion protein of mouse PD1 and mouse IL-15 gene with targeting function, which comprises an extracellular segment of mouse PD1 protein at the front end and a functional fragment of mouse IL-15 protein at the rear end.

The extracellular section part of the murine PD1 protein is a front-end targeting protein of the fusion protein, the functional fragment part of the murine IL-15 protein is a rear section of the fusion protein, and the fusion protein can be targeted to PD-L1 on the surface of a tumor cell under the action of the extracellular section of the PD1 at the front end, so that the IL-15 at the rear half section can be guided to enter a tumor microenvironment to play the immunological function of the tumor microenvironment, including the activation of proliferation and activation of NK cells and CD8T cells and the like.

Preferably, the fusion protein further comprises a signal peptide of VEGFA, and a linker peptide.

More preferably, the amino acid sequence of the fusion protein is as set forth in SEQ ID NO: 1 is shown in the specification; the fusion protein is a VEGFA signal peptide-mouse PD1 extracellular domain- (GGGGGGS) from the N segment to the C segment in sequence₃The linker sequence-murine IL-15 extracellular functional fragment-His tag.

The invention also provides a preparation method of the fusion protein of the mouse PD1 and the mouse IL-15 gene, which comprises the following steps:

s1, constructing and synthesizing a polypeptide containing SEQ ID NO: 1, and a fusion protein plasmid;

and S2, transfecting, culturing and purifying to obtain the fusion protein.

Specifically, the preparation method is summarized as follows:

s1, designing and synthesizing a fusion protein plasmid;

s2, transfecting 293T cells;

s3, repeatedly collecting GFP positive cell groups by flow cytometry;

s4, culturing for 48h and collecting the culture medium supernatant;

concentrating the collected supernatant by an S5 and 10kD ultrafiltration tube;

s6, purifying the supernatant after ultrafiltration by a nickel column to obtain the fusion protein.

The invention also provides application of the fusion protein of the murine PD1 and the murine IL-15 gene.

When the IL-15 cytokine is used alone for treatment, the targeting cannot be well carried out in a tumor microenvironment, so that the activity and the function of immune cells such as T, B, NK in tumor tissues cannot be stimulated, and meanwhile, due to the lack of the targeting capability, the IL-15 cytokine alone is easy to cause systemic immune reaction and has strong side effects. According to the invention, the murine PD1 molecule and the murine IL-15 molecule are recombined and expressed into fusion protein, so that the protein can be targeted to the PD-L1 molecule on the surface of a tumor cell under the guidance of the PD1 molecule, and the IL-15 molecule is guided into a tumor tissue. The targeting of PD1 can block the binding site of PD-L1, as well as block the binding of PD1 molecules to other cell surfaces of tissues and block the PD-L1 signaling pathway in target cells. IL-15 can be enriched in the tumor microtissue under the action of PD1 protein and can better act on T, B, NK cells in the tumor microenvironment and the like.

Thus, preferably, the above application may be: the recombination of mouse PD1 and mouse IL-15 gene is used to prepare the medicine for strengthening the proliferation of immune cells.

More preferably, the immune cells are NK cells and CD8T cells.

Compared with the prior art, the invention has the following beneficial effects:

the invention combines an immune check point targeted blocking treatment scheme and a cytokine treatment scheme in anti-tumor treatment, and designs and constructs a non-antibody mediated cytokine fusion protein, namely a PD1 molecular extracellular domain and IL-15 fusion protein. The protein will probably gain the following functions: 1. the PD1 molecule extracellular segment can be specifically bound to the PD-L1 molecule on the surface of a tumor cell; 2. the fusion protein molecule bound to the tumor cell PD-L1 molecule can prevent the binding of other cell surface PD1 molecules, thereby preventing the cellular immune activity from being blocked; 3. IL-15 cytokines can enrich in the tumor microenvironment and stimulate proliferative activation of relevant innate immune cells such as NK cells and CD8+ T cells; 4. the stimulated relevant innate immune cells can perform an anti-tumor killing function. Finally, the fusion protein has good anti-tumor effect. The fusion protein can be used as a drug for single treatment, and can also be used for combined treatment with other treatment strategies such as ACT (Adoptive Cell Transfer), thereby providing a new scheme for clinical treatment.

Drawings

FIG. 1 is a schematic diagram of the sequence and structure of a fusion protein;

FIG. 2 is an identification diagram of recombinant plasmid subclones;

FIG. 3 is a schematic diagram of the procedure for detecting transient transfection of recombinant plasmid into 293T cells;

FIG. 4 is a view of EGFP under a fluorescent microscope after flow cytometry sorting and the results of flow cytometry analysis;

FIG. 5 shows RT-qPCR detection of fusion protein expression at the nucleic acid level (left panel) and protein level (right panel) for cell lines transfected with unloaded cell lines and transfected with recombinant plasmids;

FIG. 6 is a schematic diagram of the process for concentration and purification of the fusion protein;

FIG. 7 is a schematic flow chart of the functional verification of the fusion protein;

FIG. 8 is a diagram showing WB results (left panel) of the fusion protein and results of flow cytometry (right panel);

FIG. 9 shows the results of flow cytometry for the immunological function of mIL-15 protein in fusion proteins.

Detailed Description

The following further describes the embodiments of the present invention. It should be noted that the description of the embodiments is provided to help understanding of the present invention, but the present invention is not limited thereto. In addition, the technical features involved in the embodiments of the present invention described below may be combined with each other as long as they do not conflict with each other.

The test methods used in the following experimental examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.

EXAMPLE 1 construction of recombinant fusion proteins

FIG. 1a is the amino acid sequence of a fusion protein, b is the structural diagram of the constituent units of the fusion protein; the sequence from N segment to C segment is VEGFA signal peptide-mouse PD1 protein extracellular segment- (GGGGS)3 connecting sequence-mouse IL-15 extracellular functional segment-His label.

1. Construction of recombinant plasmid

The expression vector used in the method is Migr1 (adddge catalog: 27490).

The extracellular amino acid sequences of mPD1 and mIL-15 proteins were found from uniport protein database, and the results were taken to NCBI (national Center for Biotechnology information) database for alignment to find the corresponding nucleotide sequence of the mature protein. Then, designing recombinant plasmids of fusion proteins, wherein the nucleotide sequences and the amino acid sequences of the fusion proteins are respectively SEQ ID NO: 1 and SEQ ID NO: 2, starting at the N-terminus from the signal peptide fragment of the secretory protein VEGFA (Met)¹to Ala²⁶) A signal peptide capable of directing secretion of the fusion protein outside the cell; followed by the extracellular segment sequence (Ser) of mPD1 protein²⁷to Met¹⁷⁵) Mainly plays a role of targeting mPD-L1 molecules; flexible linker (GGGGS)₃(Gly¹⁷⁶ to Ser¹⁹⁰) The two fused segments can be prevented from being too close to each other to influence the correct folding and the function of each other; subsequently attached is another important part of the fusion protein, the functional segment (Asn) of mIL-15¹⁹¹ to Ser³⁰⁴) (ii) a Finally 6 × His tag (His)³⁰⁵to His³¹⁰) For purifying the expressed fusion protein, and a stop codon (TAA)³¹¹). And then constructing a recombinant plasmid, carrying out molecular subcloning, carrying out XhoI and EcoRI double enzyme digestion on the vector, and introducing XhoI and EcoRI enzyme digestion sites on the primer to carry out target gene PCR. And then carrying out homologous recombination connection and transformation on the enzyme digestion vector recovered from the gel and a target gene PCR fragment, selecting a proper single colony grown on an antibiotic plate overnight after transformation, carrying out PCR detection, sending a PCR detection positive sample to a company for sequencing, and comparing the result with a designed sequence to determine that no point mutation or amino acid frameshift mutation exists.

SEQ ID NO：1

ATGAACTTTCTGCTCTCTTGGGTGCACTGGACCCTGGCTTTACTGCTGTACCTCCACCATGCCAAGTGGTCCCAGGCTTCAGGGTGGCTTCTAGAGGTCCCCAATGGGCCCTGGAGGTCCCTCACCTTCTACCCAGCCTGGCTCACAGTGTCAGAGGGAGCAAATGCCACCTTCACCTGCAGCTTGTCCAACTGGTCGGAGGATCTTATGCTGAACTGGAACCGCCTGAGTCCCAGCAACCAGACTGAAAAACAGGCCGCCTTCTGTAATGGTTTGAGCCAACCCGTCCAGGATGCCCGCTTCCAGATCATACAGCTGCCCAACAGGCATGACTTCCACATGAACATCCTTGACACACGGCGCAATGACAGTGGCATCTACCTCTGTGGGGCCATCTCCCTGCACCCCAAGGCAAAAATCGAGGAGAGCCCTGGAGCAGAGCTCGTGGTAACAGAGAGAATCCTGGAGACCTCAACAAGATATCCCAGCCCCTCGCCCAAACCAGAAGGCCGGTTTCAAGGCATGGGTGGTGGTGGTAGCGGTGGTGGTGGTAGCGGTGGTGGTGGTAGCAACTGGATAGATGTAAGATATGACCTGGAGAAAATTGAAAGCCTTATTCAATCTATTCATATTGACACCACTTTATACACTGACAGTGACTTTCATCCCAGTTGCAAAGTTACTGCAATGAACTGCTTTCTCCTGGAATTGCAGGTTATTTTACATGAGTACAGTAACATGACTCTTAATGAAACAGTAAGAAACGTGCTCTACCTTGCAAACAGCACTCTGTCTTCTAACAAGAATGTAGCAGAATCTGGCTGCAAGGAATGTGAGGAGCTGGAGGAGAAAACCTTCACAGAGTTTTTGCAAAGCTTTATACGCATTGTCCAAATGTTCATCAACACGTCCCACCATCATCACCACCATTAA。

2. Expression of fusion proteins

The recombinant plasmid was first transfected with Lipo2000 transfection reagent, transiently transferred into 293T cells. The cells with high GFP positive rate are screened repeatedly for 5 times, after each screening, the cells are firstly subjected to enlarged culture, and a part of the rest is frozen for continuous screening. The cells obtained by the last screening are firstly expanded and cultured, and a large amount of cell culture medium supernatant containing the fusion protein within 48 hours is collected after the last passage. The collected culture supernatant was first concentrated in a 10kD ultrafiltration tube. When in concentration, the concentrate is concentrated to about 500 mul per 15ml, namely 30 times, and then 10 times after the first concentrate is concentrated. And finally, carrying out Ni column purification on the concentrated supernatant to obtain the pure fusion protein.

3. RT-qPCR detection

And (3) carrying out RT-qPCR detection on the cell line successfully transfected, respectively carrying out RNA extraction-reverse transcription-qPCR on a certain amount of cells according to an operation method on the kit, and finally carrying out detection on the cells by a machine.

4. Analysis of results

4.1 subcloning of recombinant plasmids

As shown in FIG. 2, from left to right, the results of digestion of Migr1 vector (with EGFP sequence) with XhoI and EcoRI, respectively; performing PCR on the target gene; the result of ligating the vector and the target gene into a recombinant plasmid. The recombinant plasmid was found to have no mutation by the company sequencing result.

4.2 detection of fusion protein expression

The process is shown in figure 3, firstly, the recombinant plasmid is transiently transfected into 293T cells for protein expression, and since the recombinant plasmid can express EGFP protein, the positive cells with EGFP-FITC high expression of the 293T cell line after transient transformation are subjected to 5 times of flow cytometry sorting. Finally, a part of the obtained cell line is frozen, and other cells are cultured for 48 hours and culture medium supernatant (the fusion protein enters the culture medium supernatant under the guidance of a secretory protein signal peptide) is collected.

FIG. 4 shows the observation of EGFP under a fluorescent microscope after flow cytometry sorting and the results of flow cytometry analysis; from the two results, it can be seen that the expression of the recombinant plasmid was good.

4.3 fusion protein nucleic acid level and protein level expression

As shown in FIG. 5, RT-qPCR was performed on the cell line transfected with the empty vector and the cell line transfected with the recombinant plasmid, respectively, to detect the expression of the fusion protein at the nucleic acid level and the protein level. As a result, as shown in the left panel, the expression level of the fusion protein was 5-6 times higher at the nucleic acid level compared to that at the empty cell, but only a small amount of the fusion protein could be detected in the supernatant as shown in the ELISA test result of the right panel. These two results indicate that the fusion protein is expressed, but in the supernatant the content is lower. The reason for this is that the fusion protein is degraded after expression or the expression level of the fusion protein is originally low, and therefore, it is necessary to increase the concentration and purity of the fusion protein in the supernatant.

4.4 concentration and purification of fusion proteins

The fusion protein concentration and purification process is shown in FIG. 6, and the collected supernatant is concentrated by ultrafiltration tube, and then subjected to affinity chromatography on Ni column and further concentrated. The final original culture supernatant was concentrated by about 300 times.

4.5 functional verification of fusion proteins

As shown in FIG. 7, the B16F10 cells were induced to express PD-L1 at a high level by IFN γ, and then were incubated with the supernatant of the ordinary 293T cell line containing no fusion protein and the supernatant of the 293T cell line containing the fusion protein and purified by concentration at 37 ℃ for 1 hour. After blocking for 15min with FcBlocker antibody on ice, FACS buffer was added to wash off the antibody. Finally, adding a proper volume of PD-L1-PE flow type antibody, and carrying out ice bath for 30 min. And finally, carrying out flow cytometry detection.

If a molecule capable of binding to PD-L1, i.e.the fusion protein in this experiment, is present in the sample to be tested, the epitope of PD-L1 on the cell surface of B16F10 is occupied, so that the lost antibody of PD-L1 cannot bind to the cell surface later, and the detectable fluorescence signal is reduced accordingly.

As shown in the left panel of FIG. 8, WB detection was performed on the liquids eluted from different concentrations of imidazole, and the presence of the fusion protein was observed, and the size was between 60 kD and 75kD, as expected. In the right panel, the red part represents the fluorescence signal of PD-L1 of the negative cell population, the orange part represents the fluorescence signal of PD-L1 of cells treated with the supernatant of the ordinary 293T cell culture medium, and the green part represents the fluorescence signal of PD-L1 of the cell population treated with the purified concentrated protein solution. As can be seen from the results, the fluorescence signal of the green fraction of the purified concentrated protein-treated group was between that of the negative group and that of the common 293T supernatant-treated group, indicating that there was indeed a certain amount of fusion protein in the purified concentrated protein solution to block PD-L1 on the cell surface of B16F10, i.e., the fusion protein had the effect of binding to murine PD-L1.

FIG. 9 shows the result of flow cytometry on the immunological function of mIL-15 protein in the fusion protein, and it can be found that the purified concentrated supernatant of the experimental group can cause proliferation of NK cells and CD8T cells to some extent and the expression level of CD69 of NK cells is increased to some extent, compared with the PBS negative control and the IL-15 treated positive control group. This section verifies the immunological function of the fusion protein.

Sequence listing

<110> Guangzhou medical university affiliated tumor hospital

Institute of microbiology, national academy of sciences

<120> expression of fusion protein of mouse PD1 and mouse IL-15 gene with targeting function and application thereof

<130> ZM211041ZL

<150> 202011149794X

<151> 2020-10-23

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 933

<212> DNA

<213> mouse

<400> 1

atgaactttc tgctctcttg ggtgcactgg accctggctt tactgctgta cctccaccat 60

gccaagtggt cccaggcttc agggtggctt ctagaggtcc ccaatgggcc ctggaggtcc 120

ctcaccttct acccagcctg gctcacagtg tcagagggag caaatgccac cttcacctgc 180

agcttgtcca actggtcgga ggatcttatg ctgaactgga accgcctgag tcccagcaac 240

cagactgaaa aacaggccgc cttctgtaat ggtttgagcc aacccgtcca ggatgcccgc 300

ttccagatca tacagctgcc caacaggcat gacttccaca tgaacatcct tgacacacgg 360

cgcaatgaca gtggcatcta cctctgtggg gccatctccc tgcaccccaa ggcaaaaatc 420

gaggagagcc ctggagcaga gctcgtggta acagagagaa tcctggagac ctcaacaaga 480

tatcccagcc cctcgcccaa accagaaggc cggtttcaag gcatgggtgg tggtggtagc 540

ggtggtggtg gtagcggtgg tggtggtagc aactggatag atgtaagata tgacctggag 600

aaaattgaaa gccttattca atctattcat attgacacca ctttatacac tgacagtgac 660

tttcatccca gttgcaaagt tactgcaatg aactgctttc tcctggaatt gcaggttatt 720

ttacatgagt acagtaacat gactcttaat gaaacagtaa gaaacgtgct ctaccttgca 780

aacagcactc tgtcttctaa caagaatgta gcagaatctg gctgcaagga atgtgaggag 840

ctggaggaga aaaccttcac agagtttttg caaagcttta tacgcattgt ccaaatgttc 900

atcaacacgt cccaccatca tcaccaccat taa 933

<210> 2

<211> 310

<212> PRT

<213> mouse

<400> 2

Met Asn Phe Leu Leu Ser Trp Val His Trp Thr Leu Ala Leu Leu Leu

1 5 10 15

Tyr Leu His His Ala Lys Trp Ser Gln Ala Ser Gly Trp Leu Leu Glu

20 25 30

Val Pro Asn Gly Pro Trp Arg Ser Leu Thr Phe Tyr Pro Ala Trp Leu

35 40 45

Thr Val Ser Glu Gly Ala Asn Ala Thr Phe Thr Cys Ser Leu Ser Asn

50 55 60

Trp Ser Glu Asp Leu Met Leu Asn Trp Asn Arg Leu Ser Pro Ser Asn

65 70 75 80

Gln Thr Glu Lys Gln Ala Ala Phe Cys Asn Gly Leu Ser Gln Pro Val

85 90 95

Gln Asp Ala Arg Phe Gln Ile Ile Gln Leu Pro Asn Arg His Asp Phe

100 105 110

His Met Asn Ile Leu Asp Thr Arg Arg Asn Asp Ser Gly Ile Tyr Leu

115 120 125

Cys Gly Ala Ile Ser Leu His Pro Lys Ala Lys Ile Glu Glu Ser Pro

130 135 140

Gly Ala Glu Leu Val Val Thr Glu Arg Ile Leu Glu Thr Ser Thr Arg

145 150 155 160

Tyr Pro Ser Pro Ser Pro Lys Pro Glu Gly Arg Phe Gln Gly Met Gly

165 170 175

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asn Trp

180 185 190

Ile Asp Val Arg Tyr Asp Leu Glu Lys Ile Glu Ser Leu Ile Gln Ser

195 200 205

Ile His Ile Asp Thr Thr Leu Tyr Thr Asp Ser Asp Phe His Pro Ser

210 215 220

Cys Lys Val Thr Ala Met Asn Cys Phe Leu Leu Glu Leu Gln Val Ile

225 230 235 240

Leu His Glu Tyr Ser Asn Met Thr Leu Asn Glu Thr Val Arg Asn Val

245 250 255

Leu Tyr Leu Ala Asn Ser Thr Leu Ser Ser Asn Lys Asn Val Ala Glu

260 265 270

Ser Gly Cys Lys Glu Cys Glu Glu Leu Glu Glu Lys Thr Phe Thr Glu

275 280 285

Phe Leu Gln Ser Phe Ile Arg Ile Val Gln Met Phe Ile Asn Thr Ser

290 295 300

His His His His His His

305 310

Claims

1. A fusion protein of mouse PD1 and mouse IL-15 gene with targeting function, which is characterized in that the fusion protein comprises an extracellular section of mouse PD1 protein at the front end and a functional fragment of mouse IL-15 protein at the rear end.

2. The targeted fusion protein of murine PD1 and murine IL-15 gene according to claim 1, characterized in that said fusion protein further comprises the signal peptide of VEGFA and the linker peptide.

3. The fusion protein of mouse PD1 and mouse IL-15 gene with targeting function according to claim 2, characterized in that the amino acid sequence of the fusion protein is as shown in SEQ ID NO: 2, respectively.

4. The fusion protein of murine PD1 and murine IL-15 genes with targeting function according to claim 3, characterized in that the nucleotide sequence encoding said fusion protein is as set forth in SEQ ID NO: 1 is shown.

5. The method of claim 4 for preparing a fusion protein of murine PD1 and murine IL-15 genes, comprising the steps of:

and S2, transfecting, culturing and purifying to obtain the fusion protein.

6. Use of the fusion protein of murine PD1 and murine IL-15 gene according to any one of claims 1 to 4.

7. The use according to claim 6, wherein the murine PD1 and the murine IL-15 gene are recombined for the preparation of a medicament for the enhancement of immune cell proliferation.

8. The use according to claim 7, wherein said immune cells are NK cells and CD8T cells.