WO2019129090A1 - Cd28 bidirectionally activated costimulatory molecule/receptor, and uses thereof - Google Patents

Abstract

Provided is a CD28 bidirectionally activated costimulatory molecule/receptor, sequentially comprising from N-end to C-end the following elements: an optional signal peptide, a CD28-activated single-chain antibody, an extracellular hinge region, a transmembrane region, and a intracellular costimulatory signal molecule. When said costimulatory molecule/receptor covalently modifies a first-generation CAR-T using a first signal, the effect of bidirectional activation is merely limited between T cells in mutual contact, a cluster effect is generated, and the tumor cells are killed.

Description

CD28 bidirectional activated costimulatory molecule receptor and use thereof Technical field

The invention belongs to the field of cell biology and immunology, and relates to a CD28 bidirectional activated costimulatory molecule receptor, and the use thereof for modifying a T cell modified by the receptor for treating a malignant tumor.

Background technique

Adoptive cell therapy (ACT) is the process of returning treated autologous or allogeneic immune cells (mainly autologous cells) to tumor patients, directly killing tumor cells, or killing tumor cells by stimulating the body's immune response. The purpose of treatment. The current tumor adoptive cell therapy has developed rapidly and achieved very good therapeutic effects in the clinical treatment of various malignant tumors (Nature.2016; Jun16; 534(7607): 396-401); (Cell.2016 Oct 6; 167(2 ): 405-418.e13). Tumor immune cell therapy is considered to be one of the most promising approaches for the treatment of malignant tumors.

T cell activation requires stimulation of two signals, two signals related to T cell activation. Among them, the TCR-CD3 complex on the surface of T cells binds to the antigen peptide-MHC molecule, providing the first signal of T cell activation, determining the killing specificity of T cells; the costimulatory molecules on the surface of T cells (such as CD28) and the corresponding ligands. Binding (eg, B7) provides a second signal for T cell activation that promotes T cell activation, proliferation, and survival. However, the lack of or the decreased expression of the first signal stimulus source (such as MHC molecule) and the second signal ligand (such as B7) of the tumor cell cannot effectively provide a signal related to T cell activation, thereby failing to activate the T cell immune response. The widespread activation of T cell costimulatory molecules may have strong toxic side effects.

Chimeric antigen receptors (CAR) activate the intracellular signal CD3ζ or FcεRIγ by ITAM (immunoreceptor tyrosine-based activation) by specifically recognizing the single-chain antibody fragment (scFv) of the tumor antigen. Moments.) Signal transmission. However, the first-generation CAR receptor lacks the costimulatory signal of T cells, which leads to T cells only exerting transient effects, short time in the body and less secretion of cytokines.

The second and third generation CARs combine the two signals required for T cell activation, and the second signal CD28 or / and 4-1BB intracellular signal regions are directly linked to the CD3ζ molecule, thereby bypassing the tumor. Cells often have a second signal, such as B7, that lacks the barrier that prevents T cells from activating. The combination of the first signal and the second signal greatly enhances the activation, proliferation and killing ability of T cells, and the therapeutic effect thereof is greatly increased. Based on the current understanding of the activation mechanism of T cells, CD28 and 4-1BB molecules can provide the second. Activate the signal and further enhance the TCR/CD3 signal.

However, no matter what kind of CAR-T cells, it can only provide stimulation signals to the modified T cells, lack of bystander function, and can not activate surrounding T cells, resulting in a stronger cluster effect, resulting in a series of activated T cell functions. Cascade reaction.

Summary of the invention

Through intensive research and creative labor, the inventors designed a Dual Costimulatory Activated Receptor (DCR), which transmits a second signal related to T cell activation through a CD28 extracellular activated antibody. The modified T cells can not only activate their own CD28 costimulatory molecules through extracellular CD28-activated antibodies, but also activate the intracellular cells of exposed T cells by contact with surrounding unmodified activated T cells. The costimulatory molecule signals promote T cell activation, proliferation and survival. In particular, when it co-modifies T cells with the first generation CAR-T containing the first signal, it can produce a strong cluster effect and kill tumor cells. In addition, the effect of this two-way activation is only limited to the T cells that are in contact with each other, and does not cause strong T cell immunity like the activated antibody injected with CD28, causing potentially serious side effects.

The following invention is thus provided:

One aspect of the invention relates to an isolated polypeptide comprising, in order from the N-terminus to the C-terminus, the following elements:

An alternative signal peptide, a polypeptide that activates CD28 (eg, a CD28 activated single chain antibody or a ligand for CD28), an extracellular hinge region, a transmembrane region, and an intracellular costimulatory signaling molecule.

In one or more embodiments of the invention, the polypeptide is characterized by any one, two, three, four or five of the following items (1) to (5):

(1) the signal peptide is a membrane protein signal peptide; preferably, the signal peptide is one or more selected from the group consisting of a CD8 signal peptide, a CD28 signal peptide, and a CD4 signal peptide; preferably, the signal peptide is a CD8 signal peptide; preferably, the amino acid sequence of the CD8 signal peptide is as shown in SEQ ID NO:1;

(2) the amino acid sequence of the CD28-activated single-chain antibody is shown in SEQ ID NO: 2; the ligand of CD28 is CD80/CD86;

(3) the extracellular hinge region is one or more selected from the group consisting of an IgG4Fc CH2CH3 hinge region, a CD28 hinge region, and a CD8 hinge region; preferably, a CD8 hinge region; preferably, the amino acid sequence of the CD8 hinge region As shown in SEQ ID NO: 3;

(4) the transmembrane region is one selected from the group consisting of a CD28 transmembrane region, a CD8 transmembrane region, a CD3ζ transmembrane region, a CD134 transmembrane region, a CD137 transmembrane region, an ICOS transmembrane region, and a DAP10 transmembrane region. a plurality of; preferably, the transmembrane region is a CD28 transmembrane region; preferably, the amino acid sequence of the CD28 transmembrane region is set forth in SEQ ID NO: 4;

(5) The intracellular costimulatory signal molecule is selected from the group consisting of a CD28 intracellular domain, a CD134/OX40 intracellular domain, a CD137/4-1BB intracellular domain, an LCK intracellular domain, an ICOS intracellular domain, and DAP10. One or more of the intracellular domains; preferably, the intracellular costimulatory signal molecule is a CD28 intracellular domain and/or a CD137 intracellular domain; preferably, the amino acid of the CD28 intracellular domain The sequence is set forth in SEQ ID NO: 5; preferably, the amino acid sequence of the intracellular domain of CD137 is set forth in SEQ ID NO: 6.

In one or more embodiments of the invention, the polypeptide, in order from the N-terminus to the C-terminus, comprises the following elements:

An alternative CD8 signal peptide, a CD28 activated single chain antibody, a CD8 extracellular hinge region, a CD28 transmembrane region, a CD28 intracellular domain, and/or a CD137 intracellular domain.

In one or more embodiments of the invention, the polypeptide is as shown in Figures 1A-1D.

In one or more embodiments of the invention, the polypeptide has an amino acid sequence as set forth in any one of SEQ ID NO: 7 to SEQ ID NO: 14.

Another aspect of the invention relates to an isolated polynucleotide encoding the isolated polypeptide of any of the invention; preferably, the sequence of the isolated polynucleotide is SEQ ID NO: 15 to SEQ ID NO: 22 is shown in any of the sequences.

A further aspect of the invention relates to a nucleic acid construct comprising a polynucleotide of the invention.

A further aspect of the present invention relates to a recombinant vector comprising the polynucleotide of the present invention or the nucleic acid construct of the present invention; preferably, the recombinant vector is a recombinant cloning vector, a recombinant eukaryotic expression plasmid or a recombinant viral vector; Preferably, the recombinant expression vector is a recombinant transposon vector; preferably, the transposon vector contains a transposable element selected from the group consisting of piggybac, sleeping beauty, frog prince, Tn5 or Ty; preferably, the recombination The expression vector is a recombinant vector obtained by recombining the polynucleotide of the present invention and the PS328b vector.

A further aspect of the invention relates to a recombinant vector combination comprising a first recombinant vector and a recombinant vector 2, wherein:

The first recombinant vector is a recombinant vector of the present invention,

The second recombinant vector contains a coding sequence for a first generation chimeric antigen receptor; preferably, the first generation chimeric antigen receptor is a first generation chimeric antigen receptor that targets Mucl; preferably, The amino acid sequence of the first generation chimeric antigen receptor is set forth in SEQ ID NO: 23; preferably, the nucleic acid sequence of the first generation chimeric antigen receptor is as set forth in SEQ ID NO:24;

Preferably, the second recombinant vector is a recombinant PNB328B vector.

Here, the "first" and "second" in the above "first recombination vector" and "second recombination vector" are merely for the purpose of distinction and do not have the meaning of order.

A further aspect of the invention relates to a recombinant host cell, wherein the cell comprises a polynucleotide of the invention, a nucleic acid construct of the invention, a recombinant vector of the invention or a recombinant vector combination of the invention; preferably, The recombinant host cell is a recombinant mammalian cell; preferably, the recombinant host cell is a recombinant T cell; preferably, the recombinant T cell is a recombinant peripheral blood mononuclear cell.

The bidirectionally activated costimulatory molecule receptors of the invention can also be used in conjunction with first generation chimeric antigen receptors.

A further aspect of the invention relates to a T cell expressing a polypeptide according to any of the preceding claims, and a first generation chimeric antigen receptor; preferably, the recombinant T cell is recombinant peripheral blood Mononuclear cells; preferably, the first generation chimeric antigen receptor is a first generation chimeric antigen receptor that targets Mucl; preferably, the amino acid sequence of the first generation chimeric antigen receptor is SEQ ID NO: 23 is shown.

A further aspect of the present invention relates to a pharmaceutical composition comprising the polypeptide of any one of the present invention, the polynucleotide of the present invention, the nucleic acid construct of the present invention, the recombinant vector of the present invention, and the present invention A recombinant vector combination, a recombinant host cell of the invention or a T cell of the invention; optionally, further comprising a pharmaceutically acceptable excipient.

A further aspect of the invention relates to the polypeptide of any one of the invention, the polynucleotide of the invention, the nucleic acid construct of the invention, the recombinant vector of the invention, the recombinant vector combination of the invention, the recombinant host of the invention Use of a cell or a T cell of the present invention for the preparation of a medicament for treating and/or preventing cancer; preferably, the cancer is a cancer whose surface of the cancer cell abnormally expresses Mucl; preferably, the cancer is selected from the group consisting of: adenocarcinoma, Lung cancer, colon cancer, colon cancer, breast cancer, ovarian cancer, cervical cancer, stomach cancer, cholangiocarcinoma, gallbladder cancer, esophageal cancer, pancreatic cancer or prostate cancer.

A further aspect of the invention relates to the polypeptide of any one of the invention, the polynucleotide of the invention, the nucleic acid construct of the invention, the recombinant vector of the invention, the recombinant vector combination of the invention, the recombinant host of the invention Use of a cell or a T cell of the present invention for the preparation of a medicament for inhibiting cancer cells; preferably, the cancer cell is a cancer cell having a cell surface abnormally expressing Mucl; preferably, the cancer cell is selected from the group consisting of cancer cells of the following cancer: Adenocarcinoma, lung cancer, colon cancer, colorectal cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, cholangiocarcinoma, gallbladder cancer, esophageal cancer, pancreatic cancer or prostate cancer.

A further aspect of the invention relates to a method of inhibiting cancer cells in vivo or in vitro, comprising administering to a cancer cell an effective amount of a polypeptide of any of the invention, a polynucleotide of the invention, a nucleic acid of the invention a recombinant vector of the present invention, a recombinant vector combination of the present invention, a recombinant host cell of the present invention or a T cell of the present invention; preferably, the cancer cell is a cancer cell having a cell surface abnormally expressing Mucl; preferably, The cancer cells are selected from cancer cells of the following cancers: adenocarcinoma, lung cancer, colon cancer, colon cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, cholangiocarcinoma, gallbladder cancer, esophageal cancer, pancreatic cancer or prostate cancer.

A further aspect of the invention relates to a method of treating and/or preventing cancer comprising administering to a subject in need thereof an effective amount of a polypeptide of any of the invention, a polynucleotide of the invention, the invention a nucleic acid construct, a recombinant vector of the present invention, a recombinant vector combination of the present invention, a recombinant host cell of the present invention or a T cell of the present invention; preferably, the cancer is a cancer in which a cancer cell surface abnormally expresses Mucl; Preferably, the cancer is selected from the group consisting of adenocarcinoma, lung cancer, colon cancer, colon cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, cholangiocarcinoma, gallbladder cancer, esophageal cancer, pancreatic cancer or prostate cancer.

A further aspect of the invention relates to the polypeptide of any one of the invention, the polynucleotide of the invention, the nucleic acid construct of the invention, the recombinant vector of the invention, the recombinant vector combination of the invention, the recombinant host of the invention Use of a cell or a T cell of the invention for the preparation of a medicament for promoting secretion of a cytokine, wherein the cytokine is selected from the group consisting of IL-2, IL-4, IL-6, IL-10, TNF-α and IFN-γ One or more of them.

A further aspect of the invention relates to a method of promoting cytokine secretion of T cells in vivo or in vitro, comprising applying T cells in an effective amount of a polypeptide of any of the invention, a polynucleotide of the invention, a nucleic acid construct of the present invention, a recombinant vector of the present invention, a recombinant vector combination of the present invention, a recombinant host cell of the present invention or a T cell of the present invention; wherein the cytokine is selected from the group consisting of IL-2 and IL-4 One or more of IL-6, IL-10, TNF-α and IFN-γ.

In the present invention, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art, unless otherwise stated. Moreover, the cell culture, molecular genetics, nucleic acid chemistry, and immunology laboratory procedures used herein are all routine steps widely used in the corresponding art. Also, for a better understanding of the present invention, definitions and explanations of related terms are provided below.

In the present invention, the term "isolated" or "isolated" refers to that obtained by artificial means from a natural state. If a certain “separated” substance or component appears in nature, it may be that the natural environment in which it is located has changed, or that it has been isolated from the natural environment, or both. For example, a certain living animal has a naturally isolated polynucleotide or polypeptide that is not isolated, and the high purity of the same polynucleotide or polypeptide isolated from this natural state is called separation. of. The term "isolated" or "isolated" does not exclude the inclusion of artificial or synthetic materials, nor does it exclude the presence of other impure substances that do not affect the activity of the material.

In the present invention, the term "vector" means a nucleic acid delivery vehicle into which a polynucleotide can be inserted. A vector is referred to as an expression vector when the vector enables expression of the protein encoded by the inserted polynucleotide. The vector can be introduced into the host cell by transformation, transduction or transfection, and the genetic material element carried thereby can be expressed in the host cell. Vectors are well known to those skilled in the art and include, but are not limited to, plasmids; phagemids; cosmids; artificial chromosomes, such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1 derived artificial chromosomes (PAC). Phage such as lambda phage or M13 phage and animal virus. Animal viruses useful as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, nipples Multi-tumor vacuolar virus (such as SV40). A vector may contain a variety of elements that control expression, including, but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. In addition, the vector may also contain an origin of replication.

In the present invention, the term "host cell" means a cell which can be used for introduction into a vector, which includes, but is not limited to, a prokaryotic cell such as Escherichia coli or Bacillus subtilis, a fungal cell such as a yeast cell or an Aspergillus, such as S2 fruit. Fly cells such as fly cells or Sf9, or animal cells such as fibroblasts, CHO cells, COS cells, NSO cells, HeLa cells, BHK cells, HEK 293 cells or human cells.

In the present invention, the term "chimeric antigen receptor" is an artificially engineered receptor capable of anchoring a specific molecule (such as an antibody) that recognizes a tumor antigen to an immune cell (such as a T cell), so that the immune cell recognizes the tumor antigen or Viral antigens and cells that kill tumor cells or virus infection.

In the present invention, the term "CD28", the official ID number of the NCBI gene bank is 940, expressed in T cells, and promotes proliferation and activation of T cells. In the second generation of chimeric antigen receptor-modified T cell therapy, it is often used as an intracellular costimulatory signal to enhance the activation and proliferation of T cells.

In the present invention, the term "CD137", the official ID number of the NCBI gene bank is 3604, expressed in T cells, and promotes proliferation and activation of T cells. In the second generation of chimeric antigen receptor-modified T cell therapy, it is often used as an intracellular costimulatory signal to enhance the activation and proliferation of T cells.

In the present invention, the term "single-chain antibody variable fragment" (scFv) refers to an antibody fragment having the ability to bind antigen by linking the amino acid sequence of the _VL region of the antibody and the amino acid sequence of the _VH region via Linker. Wherein V _L and V _H domains by a linker makes it possible to produce a single polypeptide chain pair to form monovalent molecules (see, e.g., Bird et al., Science 242: 423-426 (1988) and Huston et al., Proc. Natl .Acad.Sci. USA 85: 5879-5883 (1988)). Such scFv molecules can have the general structure: NH ₂ -V _L - linker -V _H -COOH or NH ₂ -V _H - linker -V _L -COOH. Suitable prior art linkers consist of a repeating GGGGS amino acid sequence or variants thereof. For example, a linker having the amino acid sequence (GGGGS) ₄ can be used, but variants thereof can also be used (Holliger et al. (1993), Proc. Natl. Acad. Sci. USA 90:6444-6448). Other linkers useful in the present invention are by Alfthan et al. (1995), Protein Eng. 8: 725-731, Choi et al. (2001), Eur. J. Immunol. 31: 94-106, Hu et al. (1996), Cancer Res. 56: 3055-3061, Kipriyanov et al. (1999), J. Mol. Biol. 293: 41-56 and Roovers et al. (2001), Cancer Immunol.

In the present invention, the term "T cell activation-associated signal" means that the two signals required for T cell activation, that is, the T cell surface TCR-CD3 complex and the antigen peptide-MHC molecule, provide the first signal for T cell activation, Determining the kill specificity of T cells; co-stimulatory molecules on the surface of T cells (such as CD28) bind to the corresponding ligand (such as B7), providing a second signal of T cell activation, promoting T cell activation, proliferation and survival.

In the present invention, the immunoreceptor tyrosine activating motif is a tyrosine activating motif of CD3ζ and/or FcεRIγ; preferably, the immunoreceptor tyrosine activating motif is a CD3 ζ tyrosine activating group The amino acid sequence of the sequence is shown in SEQ ID NO: 25.

The term "co-stimulating molecule" in the present invention means some adhesion molecules on the surface of an immune cell, such as CD28, CD134/OX40, CD137/4-1BB, CD40, etc., activated by binding to its ligand. The second signal of immune cells enhances the proliferative capacity of immune cells and the secretory function of cytokines, prolonging the survival time of activated immune cells.

In the present invention, the term "PB" transposon is an abbreviation for Piggybac. A transposon is a mobile genetic factor. A DNA sequence can be replicated or fragmented separately from the in situ, cyclized and inserted into another site, and the subsequent genes are regulated. This process is called transposition. Since the transposon on the vector functions, the Muc1 G1 CAR and 28DCR are integrated into the T cell genome.

Antibodies are classified into activated and blocked antibodies. In the present invention, the term "extracellular activated antibody" binds an antibody to the surface of a cell membrane and binds to a site of action of a cell surface molecule (ie, a ligand and a receptor binding site) to promote a cell biological function. CD28 extracellular activated antibody, because CD28 molecule is present on the surface of most T cells, is considered to be a T cell-specific surface molecule, CD28 extracellular activated antibody can effectively recognize and activate CD28 molecular signal, generate a second signal, CD28 can replace the second signal of APC.

In the present invention, the term "bystander function" means that when a tumor cell or a virus-infected cell, a single CAR-T cell can only activate the second signal of the self cell, and cannot further activate the peripheral T cell function, resulting in surrounding T cells. Can not cause a series of activated T cell function.

In the present invention, the term "cluster effect" means that a single modified T cell can continuously recruit and activate surrounding unactivated T cells, and activate peripheral T cell downstream signaling pathways, causing activation and proliferation of multiple T cell levels. .

In the present invention, the term "Muc1" is also called mucin, mucins, and the official ID number of the NCBI gene library is 4582. Muc1 is a kind of high molecular weight (>200kD) type I transmembrane glycoprotein (mostly linked by O/glycosidic bond to Ser/Thr on the polypeptide backbone), which is normally expressed mainly in epithelial cells in various tissues and organs. The lumen or glandular surface is apical and polar. At the time of tumorigenesis, Muc1 protein can be abnormally expressed on the surface of tumor cells, and the expression level is more than 100 times that of normal. Moreover, its polarity distribution on the cell surface is lost and can be evenly distributed throughout the cell surface. In addition, due to incomplete glycosylation, the structure of the Muc1 protein has also changed, and new sugar chains and peptide epitopes have emerged.

In the present invention, the term "pharmaceutically acceptable carrier and/or excipient" means a carrier and/or excipient which is pharmacologically and/or physiologically compatible with the subject and the active ingredient, which is It is well known in the art (see, for example, Remington's Pharmaceutical Sciences. Edited by Gennaro AR, 19th ed. Pennsylvania: Mack Publishing Company, 1995), and includes, but is not limited to, pH adjusting agents, surfactants, adjuvants, ionic strength enhancers. For example, pH adjusting agents include, but are not limited to, phosphate buffers; surfactants include, but are not limited to, cationic, anionic or nonionic surfactants such as Tween-80; ionic strength enhancers include, but are not limited to, sodium chloride.

In the present invention, the term "effective amount" means an amount sufficient to obtain or at least partially obtain a desired effect. For example, an effective amount to prevent a disease (eg, a tumor) refers to an amount sufficient to prevent, prevent, or delay the onset of a disease (eg, a tumor); treating an effective amount of the disease means sufficient to cure or at least partially arrest a patient already suffering from the disease. The amount of disease and its complications. Determination of such an effective amount is well within the capabilities of those skilled in the art. For example, the amount effective for therapeutic use will depend on the severity of the condition to be treated, the overall condition of the patient's own immune system, the general condition of the patient such as age, weight and sex, the mode of administration of the drug, and other treatments for simultaneous administration. and many more.

In the present invention, the subject may be a mammal, such as a human.

Advantageous effects of the invention

When it co-modifies T cells with the first generation CAR-T containing the first signal, it can produce a strong cluster effect and kill tumor cells. At the same time, the effect of this two-way activation is only limited to the T cells that are in contact with each other, and does not cause strong T cell immunity like the activated antibody injected with CD28, causing potentially serious side effects. The CD28 bi-directional costimulatory molecule activating receptor provided by the invention combined with the chimeric antigen receptor-modified T cell of Muc1 can specifically kill the tumor cell line with high expression of Muc1, and is superior to the first generation and second generation CAR- of Muc1. T, at the same time, has little or no killing effect on tumor cell lines which are not expressed, and has high efficiency and high specificity. The present invention can maintain the therapeutic effect of the first-generation and second-generation CAR, and the CD28 bi-directional costimulatory molecule-activated receptor-activated T cell can activate the second signal of the self-cell T cell, and the stronger the tumor-specific antigen is, the first The stronger the activation of the signal CD3ζ, the stronger the second signal associated with the activation of T cell activation by the extracellular activated antibody of CD28, which accumulates around the tumor and continuously recruits and activates surrounding unactivated T cells and activates T. The downstream signaling pathway of the cell causes activation, proliferation and survival of the T cell cascade.

DRAWINGS

Figure 1A: Schematic representation of the structure of CD28 bidirectionally activated costimulatory molecule receptor 28DCR1.

Figure 1B: Schematic representation of the structure of CD28 bidirectionally activated costimulatory molecule receptor 28DCR2.

Figure 1C: Schematic representation of the structure of CD28 bidirectionally activated costimulatory molecule receptor 28DCR3.

Figure 1D: Schematic representation of the structure of CD28 bidirectionally activated costimulatory molecule receptor 28DCR4.

Figure 1E: Schematic diagram of the Muc1 G1 CAR structure.

Figure 1F: Schematic diagram of the Muc1 G2 CAR structure.

Figure 2A: Expression of CD3ζ in a bidirectionally activated chimeric antigen receptor Mucl CAR-T cell. The internal reference is GADPH.

Figure 2B: Expression of copy number of 28DCR1, 28DCR2, 28DCR3 in the bidirectionally activated chimeric antigen receptor Mucl CAR-T cells.

Figure 3: Electrotransfer 28DCR function, recombinant cell 28DCR1/2/3 cell proliferation curve. The abscissa represents time (h) and the ordinate represents the number of cells (units).

Figure 4: Two-way activation of chimeric antigen receptor Mucl CAR-T cells, cell proliferation curve.

Figure 5A: Electrical 28DCR function, Mock T CD28 phenotype. Among them, the abscissa is the fluorescence intensity of a single CD28-positive cell, and the ordinate is the number of cells with different fluorescence intensities.

Figure 5B: Electroacoustic 28DCR1 function, CD28 phenotype of recombinant cell 28DCR1. Among them, the abscissa is the fluorescence intensity of a single CD28-positive cell, and the ordinate is the number of cells with different fluorescence intensities.

Figure 5C: Electrotransfer 28DCR2 function, CD28 phenotype of recombinant cell 28DCR2. Among them, the abscissa is the fluorescence intensity of a single CD28-positive cell, and the ordinate is the number of cells with different fluorescence intensities.

Figure 5D: Electroacoustic 28DCR3 function, CD28 phenotype of recombinant cell 28DCR3. Among them, the abscissa is the fluorescence intensity of a single CD28-positive cell, and the ordinate is the number of cells with different fluorescence intensities.

Figure 6A: The function of the electrotransfer 28DCR2 in combination with the Muc1 G1 CAR, the CD28 phenotype of the Mock T. Among them, the abscissa is the fluorescence intensity of a single CD28-positive cell, and the ordinate is the number of cells with different fluorescence intensities.

Figure 6B: CD28 phenotype of electroporation 28DCR2 in combination with Muc1 G1 CAR, recombinant cell Muc1 G1 CAR. Among them, the abscissa is the fluorescence intensity of a single CD28-positive cell, and the ordinate is the number of cells with different fluorescence intensities.

Figure 6C: The function of electrotransformation 28DCR2 in combination with Muc1 G1 CAR, the CD28 phenotype of recombinant cell Muc1 G2 CAR. Among them, the abscissa is the fluorescence intensity of a single CD28-positive cell, and the ordinate is the number of cells with different fluorescence intensities.

Figure 6D: The function of electroporation 28DCR2 in combination with Muc1 G1 CAR, CD28 phenotype of recombinant cell Muc1 G1 CAR-28DCR1. Among them, the abscissa is the fluorescence intensity of a single CD28-positive cell, and the ordinate is the number of cells with different fluorescence intensities.

Figure 7A: The function of the electric 28DCR2 combined with the Muc1 G1 CAR, the CD45RO phenotype of the Mock T. Among them, the abscissa is the fluorescence intensity of a single CD45RO-positive cell, and the ordinate is the number of cells with different fluorescence intensities.

Figure 7B: CDBRO phenotype of the recombinant cell Muc1 G1 CAR, the function of electrotransformation 28DCR2 in combination with Muc1 G1 CAR. Among them, the abscissa is the fluorescence intensity of a single CD45RO-positive cell, and the ordinate is the number of cells with different fluorescence intensities.

Figure 7C: The function of electroporation 28DCR2 in combination with Muc1 G1 CAR, the CD45RO phenotype of recombinant cell Muc1 G2 CAR. Among them, the abscissa is the fluorescence intensity of a single CD45RO-positive cell, and the ordinate is the number of cells with different fluorescence intensities.

Figure 7D: The function of electroporation 28DCR in combination with Muc1 G1 CAR, the CD45RO phenotype of recombinant cell Muc1 G1 CAR-28DCR1. Among them, the abscissa is the fluorescence intensity of a single CD45RO-positive cell, and the ordinate is the number of cells with different fluorescence intensities.

Figure 8A: The function of the electric 28DCR2 combined with the Muc1 G1 CAR, the memory T phenotype of the Mock T. Among them, the abscissa is the fluorescence intensity of a single CD62L-positive cell, and the ordinate is the fluorescence intensity of a cell not positive for a single CCR7.

Figure 8B: The function of electroporation 28DCR2 in combination with Muc1 G1 CAR, the memory T phenotype of recombinant cell Muc1 G1 CAR. Among them, the abscissa is the fluorescence intensity of a single CD62L-positive cell, and the ordinate is the cell fluorescence intensity of a single CCR7-positive cell.

Figure 8C: The function of electrotransformation 28DCR2 in combination with Muc1 G1 CAR, the memory T phenotype of recombinant cell Muc1 G2 CAR. Among them, the abscissa is the fluorescence intensity of a single CD62L-positive cell, and the ordinate is the fluorescence intensity of a cell not positive for a single CCR7.

Figure 8D: The function of electrotransformation 28DCR in combination with Muc1 G1 CAR, the memory T phenotype of recombinant cell Muc1 G1 CAR-28DCR1. Among them, the abscissa is the fluorescence intensity of a single CD62L-positive cell, and the ordinate is the fluorescence intensity of a cell not positive for a single CCR7.

Figure 9A: Two-way activation of chimeric antigen receptor Mucl CAR-T cells in vitro against MCF7 tumor cell line with a target ratio of 8:1 killing.

Figure 9B: Two-way activation of the chimeric antigen receptor Mucl CAR-T cells in vitro against MCF7 tumor cell line with a target ratio of 4:1 killing.

Figure 9C: Two-way activation of chimeric antigen receptor Mucl CAR-T cells in vitro against A549 tumor cell line with a target ratio of 8:1 killing.

Figure 9D: Two-way activation of the chimeric antigen receptor Mucl CAR-T cells in a 4:1 killing effect on A549 tumor cell lines in vitro.

Figure 10: Changes in IL-2, IL-4, IL-6, IL-10, TNF-α and IFN-γ cytokines stimulated by Muc1 antigen in a bidirectionally activated chimeric antigen receptor Muc1 CAR-T cells.

Figure 11: Therapeutic effect of two-way activation of the chimeric antigen receptor Mucl CAR-T cells on a transplanted tumor model of ovarian cancer mice.

The partial sequence involved in the present invention is as follows:

1. Amino acid sequence of CD8 signal peptide (SEQ ID NO: 1)

2. Amino acid sequence of CD28 extracellular activated single-chain antibody (SEQ ID NO: 2)

3. Amino acid sequence of the CD8α hinge region (SEQ ID NO: 3)

4. Amino acid sequence of the CD28 transmembrane region (SEQ ID NO: 4)

5. Amino acid sequence of the intracellular domain of CD28 intracellular costimulatory signal (SEQ ID NO: 5)

6. Amino acid sequence of the intracellular domain of CD137 intracellular costimulatory signal (SEQ ID NO: 6)

7. Amino acid sequence of 28DCR1 (including signal peptide) (SEQ ID NO: 7)

8. Amino acid sequence of 28DCR2 (including signal peptide) (SEQ ID NO: 8)

9. Amino acid sequence of 28DCR3 (containing signal peptide) (SEQ ID NO: 9)

10. Amino acid sequence of 28DCR4 (containing signal peptide) (SEQ ID NO: 10)

11. Amino acid sequence of 28DCR1 (without signal peptide) (SEQ ID NO: 11)

12. Amino acid sequence of 28DCR2 (without signal peptide) (SEQ ID NO: 12)

13. Amino acid sequence of 28DCR3 (without signal peptide) (SEQ ID NO: 13)

14. Amino acid sequence of 28DCR4 (without signal peptide) (SEQ ID NO: 14)

15. Nucleic acid sequence of 28DCR1 (containing signal peptide) (SEQ ID NO: 15)

16. Nucleic acid sequence of 28DCR2 (containing a signal peptide) (SEQ ID NO: 16)

17. Nucleic acid sequence of 28DCR3 (containing signal peptide) (SEQ ID NO: 17)

18. Nucleic acid sequence of 28DCR4 (containing a signal peptide) (SEQ ID NO: 18)

19. Nucleic acid sequence of 28DCR1 (without signal peptide) (SEQ ID NO: 19)

20. Nucleic acid sequence of 28DCR2 (without signal peptide) (SEQ ID NO: 20)

21. Nucleic acid sequence of 28DCR3 (without signal peptide) (SEQ ID NO: 21)

22. Nucleic acid sequence of 28DCR4 (without signal peptide) (SEQ ID NO: 22)

23. The amino acid sequence of Muc1 G1 CAR (SEQ ID NO: 23)

24. The nucleic acid sequence of Muc1 G1 CAR (SEQ ID NO: 24)

25. CD3ζ tyrosine activation motif (SEQ ID NO: 25)

26. Nucleotide sequence of Muc1 G2 CAR (SEQ ID NO: 26)

27. The nucleic acid sequence of the PS328b vector (SEQ ID NO: 27)

28. Base sequence of primer CD28-F (SEQ ID NO: 28)

29. Base sequence of primer CD28-R (SEQ ID NO: 29)

30. Base sequence in probe Taqman (SEQ ID NO: 30)

Detailed ways

Embodiments of the present invention will be described in detail below with reference to the embodiments. Those skilled in the art will appreciate that the following examples are merely illustrative of the invention and are not to be considered as limiting the scope of the invention. In the examples, the specific techniques or conditions are not indicated, according to the techniques or conditions described in the literature in the field (for example, refer to J. Sambrook et al., Huang Peitang et al., Molecular Cloning Experimental Guide, Third Edition, Science Press) or in accordance with the product manual. The reagents or instruments used are not specified by the manufacturer, and are conventional products that can be purchased through the market.

Example 1: Five recombinant plasmids, recombinant plasmid pNB328-Muc1 G1 CAR, pNB328-Muc1 G2 CAR, Construction of PS328b 28DCR1, PS328b 28DCR2 and PS328b 28DCR3

1. Synthesize the gene of 28DCR1 (SEQ ID NO: 15), the gene of 28DCR2 (SEQ ID NO: 16), the gene of 28DCR3 (SEQ ID NO: 17), the Muc1 G1 CAR gene (SEQ ID NO: 24), and Muc1 The G2 CAR gene (SEQ ID NO: 26), the structure of which is shown in Fig. 1A, Fig. 1B, Fig. 1C, Fig. 1E and Fig. 1F, respectively. The synthesized 5 genes were separately inserted into the PNB328 vector and the PS328b vector, between the EcoRI and SalI cleavage sites.

The pNB328 vector contains an EF1α promoter, a PB transposon, and the like, and the construction of the pNB328 vector is described in Example 2 of WO2017054647A1. PS328b is a synthetic sequence synthesized by Shanghai Jierui Bioengineering Co., Ltd., and the sequence is shown in SEQ ID NO:27.

The constructed recombinant plasmids were designated as pNB328-Muc1 G1 CAR plasmid, pNB328-Muc1 G2 CAR plasmid, PS328b 28DCR1 plasmid, PS328b 28DCR2 plasmid and PS328b 28DCR3 plasmid, respectively. The constructed recombinant plasmid can carry the foreign gene into the genome of the host cell, respectively.

Example 2: 9 chimeric antigen receptor-modified T cells, ie, recombinant cells Muc1 G1 CAR, Muc1 G2 CAR, Muc1 G1 CAR-28DCR1, Muc1 G1 CAR-28DCR2, Muc1 G1 CAR-28DCR3, Construction and identification of 28DCR1, 28DCR2, 28DCR3 and Mock T

(1) Construction of 9 recombinant cells

Peripheral blood mononuclear cells (PBMCs) were cultured for 2-4 h, and the unattached suspension cells were initial T cells. The suspended cells were collected into a 15 ml centrifuge tube, centrifuged at 1200 rmp for 3 min, and the supernatant was discarded; physiological saline was added, centrifuged at 1200 rmp for 3 min, physiological saline was discarded, and the procedure of "adding physiological saline, centrifugation at 1200 rmp for 3 min, and abandoning physiological saline" was repeated three times.

Take 8 1.5ml centrifuge tubes, add 5×106 cells in each tube, numbered a, b, c, d, e, f, g, h, centrifuge at 1200rmp for 3min, discard the supernatant, and take the electrotransfer kit ( From Lonza), each tube is proportionally added to a total of 100μl of electroporation reagents, of which:

a tube was added to the pNB328-Muc1 G1 CAR plasmid 8 μg,

b tube was added to the pNB328-Muc1 G2 CAR plasmid 8 μg,

c tube was added to the PS328b 28DCR1 plasmid and the pNB328-Muc1 G1 CAR plasmid was 4 μg each.

d tube was added to the PS328b 28DCR2 plasmid and the pNB328-Muc1 G1 CAR plasmid was 4 μg each.

The e tube was added with 4 μg of PS328b 28DCR3 plasmid and pNB328-Muc1 G1 CAR plasmid.

f tube was added to the PS328b 28DCR1 plasmid 8μg,

g tube was added to the PS328b 28DCR2 plasmid 8 μg,

h tube was added to PS328b 28DCR3 plasmid 8μg,

Each of the above 8 tubes was resuspended and mixed to obtain a mixed solution.

Transfer each mixture to an electric rotor, place it in an electrorotator, select the desired procedure, and perform an electric shock; use a micropipette in the kit to transfer the electrically transferred cell suspension to a six-well plate with the well-welld solution ( AIM-V medium containing 2% FBS), mixed, placed at 37 ° C, 5% CO ₂ incubator for 6 hours, then added stimulating factors IL-2 and Muc1/anti-CD28, 37 ° C, 5% CO ₂ Incubate for 3-4 days to observe the growth of T cells. Thus, the expressions pNB328-Muc1 G1 CAR, pNB328-Muc1 G2 CAR, pNB328-Muc1 G1 CAR-28DCR1, pNB328-Muc1 G1 CAR-28DCR2, pNB328-Muc1 G1 CAR-28DCR3, PS328b 28DCR1, PS328b 28DCR2 and PS328b 28DCR3 were obtained, respectively. The recombinant T cells of the gene are named as recombinant cell Muc1 G1 CAR, recombinant cell Muc1 G2 CAR, recombinant cell Muc1 G1 CAR-28DCR1, recombinant cell Muc1 G1 CAR-28DCR2, and recombinant cell Muc1 G1 CAR-28DCR3, recombinant cell 28DCR1, recombinant Cell 28DCR2 and recombinant cell 28DCR3.

In addition, in another centrifuge tube (No. i), add 5×10 ⁶ cells, centrifuge at 1200 rpm for 3 min, discard the supernatant, take the electrotransfer kit (purchased from Lonza), add 100 μl of the electroporation reagent in proportion, and add 8 μg. Control plasmid (PNB328) was constructed as described above to obtain control T cells, designated Mock T.

(2) Identification of positive recombinant cells

1Western blot assay for expression of Muc1 G1 CAR or Muc1 G2 CAR gene

The above recombinant cells Muc1 G1 CAR, Muc1 G2 CAR, Muc1 G1 CAR-28DCR1, Muc1 G1 CAR-28DCR3, and Mock-T cells were separately collected and washed twice with physiological saline.

160 μl of cell lysate was added and placed on ice for 10 min; after the cells were fully lysed, centrifuged at 12000 rpm, 4 ° C for 10 min, and the supernatant was collected. Add 40 μl of 5×loading Buffer, cook at 100 ° C for 10 min, then place on ice for 5 min.

CD3ζ antibody (purchased from abcam), GAPDH antibody (purchased from Beyotime), HRP goat anti-mouse secondary antibody (purchased from Jackson), and the expression of CD3ζ in the previously constructed recombinant cells were detected by western blot or the like. As shown in Figure 2A.

The results showed that CD3ζ was highly expressed in the recombinant T cells constructed.

2RT-PCR detection of 28DCR1-3 gene expression

Genomic DNA (kit method) of recombinant cells Muc1 G1 CAR, Muc1 G2 CAR, Muc1 G1 CAR-28DCR1, Muc1 G1 CAR-28DCR2, Muc1 G1 CAR-28DCR3 and Mock-T were extracted, and the experimental procedure was carried out with reference to the kit. Instructions.

The concentration of DNA in each recombinant cell was determined, and the expression level of 28DCR gene was detected by real-time quantitative PCR. The reaction was: 95 ° C, 15 s; 95 ° C, 5 s; 60 ° C, 15 s. 40 cycles.

The PCR reaction system (20 μl) was as follows:

Taqman: 10μl

CD28-F: 0.4μl

CD28-R: 0.4μl

CD28-probe: 0.2μl

Actin mix: 1μl

H ₂ O: 7 μl

The primer sequences are as follows:

CD28-F: GCTTCTGGATACACCTTC (SEQ ID NO: 28)

CD28-R: CCTTGAACTTCTCATTATAGTTAG (SEQ ID NO: 29)

Taqman: 5'FAM-AATACATCCAATCCACTCAAGCC-Trama (SEQ ID NO: 30)

The result is shown in Figure 2B. The results showed that the expression levels of 28DCR1, 28DCR2 or 28DCR3 genes were high in the recombinant cells Muc1 G1 CAR-28DCR1, Muc1 G1 CAR-28DCR2, Muc1 G1 CAR-28DCR3 cells.

Example 3: Cell Proliferation Viability Kit Detection Cell Technology Detection of Cell Proliferation Activity

1. Experimental samples and reagents

Recombinant cells Muc1 G1 CAR, Muc1 G2 CAR, Muc1 G1 CAR-28DCR2, 28DCR1, 28DCR2, 28DCR3 and Mock T prepared in Example 2.

Luminescent Cell Viability Assay, Promega, Cat. #G7570.

2. Experimental methods

(1) A 96-well white plate was prepared, and each of the above cells on the 8th day of culture was separately taken, and 100 μL of cell-containing AIM-V medium was added to each well.

(2) Prepare a blank control without cells to obtain background fluorescence values.

(3) Add the compound to be tested to the well plate and incubate in the incubator for 30 min.

(4) Add 100 μL of CellTiter-Glo reagent, mix on an shaker for 2 min, and incubate for 10 min at room temperature for reading.

(5) On days 8, 9, and 10 of the culture, the above steps were performed every day.

3. Experimental results

See Figure 3 and Figure 4, respectively.

Figure 3 shows that Mock T has the slowest proliferation rate and 28DCR proliferation rate is faster.

Figure 4 shows that Mock T has the slowest proliferation rate, Muc1 G1 CAR has a slower proliferation rate, Muc1 G2 CAR has a faster proliferation rate, and Muc1 G1 CAR-28DCR2 has the fastest proliferation rate.

Example 4: Flow cytometry detection of Muc1 antigen-stimulated bi-directional costimulatory molecule-activated receptor 28DCR in combination with Muc1 G1 CAR-T cell phenotype

Experimental sample

Recombinant cells Muc1 G1 CAR, Muc1 G2 CAR, Muc1 G1 CAR-28DCR3, 28DCR1, 28DCR2, 28DCR 3 and Mock T prepared in Example 2.

2. Experimental methods

The above cells were collected separately, counted, and added to a 1.5 ml EP tube at 1×10 ⁶ cells/tube, washed twice with PBS, centrifuged at 1200 rpm for 5 min, and added 2 μl of the isotype control antibody IgG1-PE, fluorescent flow antibody. anti-CD137, isotype control (IgG1FITC+IgG1PC5+IgG1PE), (anti-CD45RO-PC5, anti-CD62L-FITC, anti-CCR7-PE), lightly precipitated and mixed evenly, incubate at room temperature for 30 min in the dark, PBS wash Once again, add 400 μl PBS to transfer the cells to a flow tube and test on the machine.

3. Experimental results

5A-5D, 6A-6D, 7A-7D, and 8A-8D. among them:

Figures 5A-5D show three single-transformed cells of three 28DCR1, 28DCR2, and 28DCR3, and the CD137 phenotype is greatly improved relative to Mock T.

Figures 6A-6D show the CD137 phenotype of Mock T, Muc1 G1 CAR, Muc1 G2 CAR, Muc1 G1 CAR-28DCR2, and the Muc1 G1 CAR-28DCR2 is greatly improved compared to the other three groups.

Figures 7A-7D show the CD45RO phenotype of Mock T, Muc1 G1 CAR, Muc1 G2 CAR, Muc1 G1 CAR-28DCR2, indicating the degree of cell activation, all of which have been activated in large amounts.

8A-8D are memory T phenotypes of Mock T, Muc1 G1 CAR, Muc1 G2 CAR, and Muc1 G1 CAR-28DCR2, and Muc1 G1 CAR-28DCR2 promotes the formation of memory T relative to the other three groups.

Example 5: Real-time label-free cell function analyzer detects bidirectional costimulatory molecule-activated receptor 28DCR combination In vitro killing effect of Muc1 G1 CAR-T cells on tumor cells

Experimental sample

Effector cells: Recombinant cells Muc1 G1 CAR, Muc1 G2 CAR, Muc1 G1 CAR-28DCR1, Muc1 G1 CAR-28DCR3, 28DCR1, 28DCR2, and 28DCR3 and Mock T prepared in Example 2.

Target cells: cervical cancer Hela, ovarian cancer cell SK-OV-3 (both purchased from the American Type Culture Collection ATCC).

2. Experimental methods

The effector cells and target cells matched by MHC class I were selected, and the in vitro killing activity of the cells was detected by real-time label-free cell function analyzer (RTCA). The specific steps are as follows:

(1) Zero adjustment: add 50μl DMEM or 1640 culture solution to each well, put it into the instrument, select step 1, and adjust to zero;

(2) Target cell plating: cervical cancer cell Hela and ovarian cancer cell SK-OV-3 were plated in a plate containing the detection electrode at 10 ⁴ cells/50 μl per well, and left for a few minutes, until the cells were stabilized, and then placed. Into the instrument, start step 2, culture the cells;

(3) Adding effector cells: After 24 hours of target cell culture, stop step 2, add effector cells, 50 μl per well, and set the effective target ratio to 8:1, 4: (all tumor cells are 10 ⁴ )1 The plasmid Mock T cells were used as a control, and step 3 was started. After co-culture for 24 hours, the cell proliferation curve was observed.

2. Experimental results

As shown in Figures 9A-9D.

The results showed that Mock T had the weakest killing effect on tumor cells, Muc1 G1 CAR had weaker killing effect on tumor cells, Muc1 G2 CAR had stronger killing effect on tumor cells, Muc1 G1 CAR-28DCR1, Muc1 G1 CAR-28DCR3 pair Tumor cells have the strongest killing effect.

Example 6: Flow cytometry detection of Muc1 CAR-T cytokine secretion under Muc1 antigen stimulation

Experimental sample

Recombinant cells Muc1 G1 CAR, Muc1 G2 CAR, Muc1 G1 CAR-28DCR1 and Mock T prepared in Example 2.

2. Experimental methods

1. A 96-well plate was coated with 5 μg/ml of Muc1 antigen, coated at 4 ° C overnight, washed 3 times with PBS, and 1 × 10 ⁵ of each sample cell was added, and the cell supernatant was collected after 24 hours of culture. With ^{BD TM CBA Human Th1 / Th2 Cytokine} Kit II detecting Muc1 CAR-T cell cytokine secretion after stimulation by antigen Muc1.

Specific steps are as follows:

(1) Mix human IL-2, IL-4, IL-6, IL-10, TNF, IFN-γ to capture magnetic beads, vortex and mix to capture the magnetic beads, add 50 μl of mixed magnetic capture after each tube Bead

(2) Add 50 μl of human Th1/Th2 cytokine standard (double dilution 5000pg/ml, 2500pg/ml, 1250pg/ml, 625pg/ml, 312.5pg/ml, 156pg/ml, 80pg/ml, 40pg/ml) , 20 pg/ml, 0 pg/ml) and 50 μl of the sample to be tested (diluted 2-fold by dilution).

(3) adding 50 μl of human Th1/Th2-II-PE detection antibody per tube;

(4) Incubate for 3 hours at room temperature in the dark;

(5) Add 1 ml of Wash Buffer to each tube, centrifuge at 200 for 5 min, discard the supernatant;

(6) 300 μl of Wash Buffer was resuspended in each tube and transferred to a flow tube, and the fluorescence value was measured by flow cytometry.

3. Experimental results

As shown in Figure 10.

The results showed that compared with Mock T cells, the secretion of various cytokines (IL-2, IL-4, IL-6, IL-10, TNF-α and IFN-γ) in the other cells was greatly improved. . The secretion of various cytokines in Mock T is the weakest. The secretion of various cytokines in Muc1 G1 CAR is weak. The secretion of various cytokines in Muc1 G2 CAR is strong. The secretion of various cytokines in Muc1 G1 CAR-28DCR1 The strongest.

Example 7: In vivo work of bidirectional costimulatory molecule-activated receptor 28DCR in combination with Muc1 G1 CAR-T cells Can experiment

1. Experimental samples and experimental animals

Twenty N-6 fully immunodeficient mice of 4-6 weeks old, with an average weight of 22-27 g, were provided by Beijing Weitongda Biotechnology Co., Ltd. and raised in SPF animal laboratory.

Recombinant cells Muc1 G1 CAR, Muc1 G2 CAR, Muc1 G1 CAR-28DCR3 and Mock T prepared in Example 2.

Ovarian cancer cell SK-OV-3-luc (purchased from Shanghai Huiying Biotechnology Co., Ltd.).

2. Experimental methods

(1) Human ovarian cancer cell line SK-OV-3-luc was cultured in vitro, adherent growth cells in logarithmic growth phase were taken, digested with 0.25% trypsin, centrifuged, collected, resuspended in PBS, centrifuged at 1000 rpm for 2 minutes at room temperature. The supernatant was discarded, resuspended in PBS, and the cells were collected by centrifugation, and the cell suspension concentration was adjusted to 5 × 10 ⁷ /ml.

(2) SK-OV-3-luc cells were inoculated subcutaneously in the right flank of the mouse, 0.1 ml/mouse. After 10 days of inoculation, tumor size can be observed by a live imager.

(3) NSG immunodeficient mice were randomly divided into 4 groups, 5 in each group. The administration route was direct tail vein injection, each 0.1 ml/only, that is, 5×10 ⁶ positive cells, and the solvent was PBS. Only once.

(4) The living state of the mice was observed daily and the tumor changes of the mice were observed by a living imager every 10 days.

3. Experimental results

As shown in Figure 11.

The results showed that Mock T was a control group, the fluorescence intensity of tumor cells was strong, Muc1 G1 CAR was a generation of CAR targeting Mucl, and the fluorescence intensity of tumor cells was weakened, indicating a certain therapeutic effect. The fluorescence intensity of Muc1 G2 CAR tumor cells was weaker, indicating With further good therapeutic effects, the fluorescence intensity of Muc1 G1 CAR-28DCR3 tumor cells was the weakest, indicating the best therapeutic effect.

Although specific embodiments of the invention have been described in detail, those skilled in the art will understand. Various modifications and alterations of the details are possible in light of the teachings of the invention. The full scope of the invention is given by the appended claims and any equivalents thereof.

Claims (20)

1. An isolated polypeptide comprising, in order from the N-terminus to the C-terminus, the following elements:

   An alternative signal peptide, a polypeptide that activates CD28 (eg, a CD28 activated single chain antibody or a ligand for CD28), an extracellular hinge region, a transmembrane region, and an intracellular costimulatory signaling molecule.
2. The polypeptide according to claim 1, which is characterized by any one, two, three, four or five of the following items (1) to (5):

   (1) the signal peptide is a membrane protein signal peptide; preferably, the signal peptide is one or more selected from the group consisting of a CD8 signal peptide, a CD28 signal peptide, and a CD4 signal peptide; preferably, the signal peptide is a CD8 signal peptide; preferably, the amino acid sequence of the CD8 signal peptide is as shown in SEQ ID NO:1;

   (2) the amino acid sequence of the CD28-activated single-chain antibody is shown in SEQ ID NO: 2; the ligand of CD28 is CD80/CD86;

   (3) the extracellular hinge region is one or more selected from the group consisting of an IgG4Fc CH2CH3 hinge region, a CD28 hinge region, and a CD8 hinge region; preferably, a CD8 hinge region; preferably, the amino acid sequence of the CD8 hinge region As shown in SEQ ID NO: 3;

   (4) the transmembrane region is one selected from the group consisting of a CD28 transmembrane region, a CD8 transmembrane region, a CD3ζ transmembrane region, a CD134 transmembrane region, a CD137 transmembrane region, an ICOS transmembrane region, and a DAP10 transmembrane region. a plurality of; preferably, the transmembrane region is a CD28 transmembrane region; preferably, the amino acid sequence of the CD28 transmembrane region is set forth in SEQ ID NO: 4;

   (5) The intracellular costimulatory signal molecule is selected from the group consisting of a CD28 intracellular domain, a CD134/OX40 intracellular domain, a CD137/4-1BB intracellular domain, an LCK intracellular domain, an ICOS intracellular domain, and DAP10. One or more of the intracellular domains; preferably, the intracellular costimulatory signal molecule is a CD28 intracellular domain and/or a CD137 intracellular domain; preferably, the amino acid of the CD28 intracellular domain The sequence is set forth in SEQ ID NO: 5; preferably, the amino acid sequence of the intracellular domain of CD137 is set forth in SEQ ID NO: 6.
3. The polypeptide according to claim 1 or 2, which comprises, in order from the N-terminus to the C-terminus, the following elements:

   An alternative CD8 signal peptide, a CD28 activated single chain antibody, a CD8 extracellular hinge region, a CD28 transmembrane region, a CD28 intracellular domain, and/or a CD137 intracellular domain.
4. The polypeptide according to any one of claims 1 to 3, which has the amino acid sequence shown in any one of SEQ ID NO: 7 to SEQ ID NO: 14.
5. An isolated polynucleotide encoding the isolated polypeptide of any one of claims 1 to 4; preferably, the sequence of the isolated polynucleotide is SEQ ID NO: 15 to SEQ ID NO: Any of the sequences shown in 22.
6. A nucleic acid construct comprising the polynucleotide of claim 5.
7. A recombinant vector comprising the polynucleotide of claim 5 or the nucleic acid construct of claim 6; preferably, the recombinant vector is a recombinant cloning vector, a recombinant eukaryotic expression plasmid or a recombinant viral vector; preferably The recombinant expression vector is a recombinant transposon vector; preferably, the transposon vector contains a transposable element selected from the group consisting of piggybac, sleeping beauty, frog prince, Tn5 or Ty; preferably, the recombinant expression The vector is a recombinant vector obtained by recombining the polynucleotide of claim 5 and the PS328b vector.
8. A recombinant vector combination comprising a first recombinant vector and a second recombinant vector, wherein:

   The first recombinant vector is the recombinant vector of claim 7.

   The second recombinant vector contains a coding sequence for a first generation chimeric antigen receptor; preferably, the first generation chimeric antigen receptor is a first generation chimeric antigen receptor that targets Mucl; preferably, The amino acid sequence of the first generation chimeric antigen receptor is set forth in SEQ ID NO: 23; preferably, the nucleic acid sequence of the first generation chimeric antigen receptor is as set forth in SEQ ID NO:24;

   Preferably, the second recombinant vector is a recombinant PNB328B vector.
9. A recombinant host cell, wherein the cell comprises the polynucleotide of claim 5, the nucleic acid construct of claim 6, the recombinant vector of claim 7, or the recombinant vector combination of claim 8. Preferably, the recombinant host cell is a recombinant mammalian cell; preferably, the recombinant host cell is a recombinant T cell; preferably, the recombinant T cell is a recombinant peripheral blood mononuclear cell.
10. A T cell expressing the polypeptide of any one of claims 1 to 4, and a first generation chimeric antigen receptor; preferably, the recombinant T cell is a recombinant peripheral blood mononuclear cell; Preferably, the first generation chimeric antigen receptor is a first generation chimeric antigen receptor targeting Mucl; preferably, the amino acid sequence of the first generation chimeric antigen receptor is as set forth in SEQ ID NO:23. Show.
11. A pharmaceutical composition comprising the polypeptide according to any one of claims 1 to 4, the polynucleotide of claim 5, the nucleic acid construct of claim 6, and the method of claim 7. The recombinant vector, the recombinant vector combination of claim 8, the recombinant host cell of claim 9, or the T cell of claim 10; optionally, further comprising a pharmaceutically acceptable adjuvant.
12. The polypeptide according to any one of claims 1 to 4, the polynucleotide of claim 5, the nucleic acid construct of claim 6, the recombinant vector of claim 7, and the method of claim 8. Use of a recombinant vector combination, the recombinant host cell of claim 9, or the T cell of claim 10 for the preparation of a medicament for treating and/or preventing cancer; preferably, the cancer has abnormal expression of Muc1 on its cancer cell surface Preferably, the cancer is selected from the group consisting of: adenocarcinoma, lung cancer, colon cancer, colorectal cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, cholangiocarcinoma, gallbladder cancer, esophageal cancer, pancreatic cancer, or prostate cancer.
13. The polypeptide according to any one of claims 1 to 4, the polynucleotide of claim 5, the nucleic acid construct of claim 6, the recombinant vector of claim 7, and the method of claim 8. The use of the recombinant vector combination, the recombinant host cell of claim 9, or the T cell of claim 10 for the preparation of a medicament for inhibiting cancer cells; preferably, the cancer cell is a cancer cell having a cell surface abnormally expressing Mucl; Preferably, the cancer cell is selected from the group consisting of cancer cells of the following cancers: adenocarcinoma, lung cancer, colon cancer, colon cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, cholangiocarcinoma, gallbladder cancer, esophageal cancer, pancreatic cancer or prostate cancer.
14. The polypeptide according to any one of claims 1 to 4, the polynucleotide of claim 5, the nucleic acid construct of claim 6, the recombinant vector of claim 7, and the method of claim 8. Use of a recombinant vector combination, the recombinant host cell of claim 9, or the T cell of claim 10, for the preparation of a medicament for promoting secretion of a cytokine, wherein the cytokine is selected from the group consisting of IL-2, IL-4, One or more of IL-6, IL-10, TNF-α, and IFN-γ.
15. The polypeptide according to any one of claims 1 to 4, the polynucleotide of claim 5, the nucleic acid construct of claim 6, the recombinant vector of claim 7, and the method of claim 8. The recombinant vector combination, the recombinant host cell of claim 9, or the T cell of claim 10 for use in the treatment and/or prevention of cancer; preferably, the cancer is a cancer whose surface of the cancer cell abnormally expresses Mucl Preferably, the cancer is selected from the group consisting of: adenocarcinoma, lung cancer, colon cancer, colorectal cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, cholangiocarcinoma, gallbladder cancer, esophageal cancer, pancreatic cancer or prostate cancer.
16. The polypeptide according to any one of claims 1 to 4, the polynucleotide of claim 5, the nucleic acid construct of claim 6, the recombinant vector of claim 7, and the method of claim 8. The recombinant vector combination, the recombinant host cell of claim 9, or the T cell of claim 10, which is for inhibiting cancer cells; preferably, the cancer cell is a cancer cell having a cell surface abnormally expressing Mucl; preferably The cancer cell is selected from the group consisting of cancer cells of the following cancers: adenocarcinoma, lung cancer, colon cancer, colon cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, cholangiocarcinoma, gallbladder cancer, esophageal cancer, pancreatic cancer or prostate cancer.
17. The polypeptide according to any one of claims 1 to 4, the polynucleotide of claim 5, the nucleic acid construct of claim 6, the recombinant vector of claim 7, and the method of claim 8. The recombinant vector combination, the recombinant host cell of claim 9, or the T cell of claim 10 for promoting cytokine secretion, wherein the cytokine is selected from the group consisting of IL-2, IL-4, IL- 6. One or more of IL-10, TNF-α and IFN-γ.
18. A method of treating and/or preventing cancer, comprising administering to a subject in need thereof an effective amount of the polypeptide of any one of claims 1 to 4, the polynucleotide of claim 5, the claims The nucleic acid construct of claim 6, the recombinant vector of claim 7, the recombinant vector combination of claim 8, the recombinant host cell of claim 9, or the T cell of claim 10.

    Preferably, the cancer is a cancer whose surface of the cancer cell abnormally expresses Mucl;

    Preferably, the cancer is selected from the group consisting of adenocarcinoma, lung cancer, colon cancer, colon cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, cholangiocarcinoma, gallbladder cancer, esophageal cancer, pancreatic cancer or prostate cancer.
19. A method for inhibiting cancer cells in vivo or in vitro, comprising administering a cancer cell in an effective amount of the polypeptide of any one of claims 1 to 4, the polynucleotide of claim 5, and the method of claim 6. The nucleic acid construct, the recombinant vector of claim 7, the recombinant vector combination of claim 8, the recombinant host cell of claim 9, or the T cell of claim 10;

    Preferably, the cancer cell is a cancer cell whose cell surface abnormally expresses Mucl;

    Preferably, the cancer cell is selected from the group consisting of cancer cells of the following cancers: adenocarcinoma, lung cancer, colon cancer, colon cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, cholangiocarcinoma, gallbladder cancer, esophageal cancer, pancreatic cancer or prostate cancer.
20. A method for promoting secretion of cytokines of T cells in vivo or in vitro, comprising administering T cells in an effective amount of the polypeptide of any one of claims 1 to 4, the polynucleotide of claim 5, The nucleic acid construct according to claim 6, the recombinant vector of claim 7, the recombinant vector combination of claim 8, the recombinant host cell of claim 9, or the T cell of claim 10. Wherein the cytokine is selected from one or more of IL-2, IL-4, IL-6, IL-10, TNF-α and IFN-γ.

Images