CN112210501B - Lactarius hatsuke JH5 and application thereof - Google Patents
Lactarius hatsuke JH5 and application thereof Download PDFInfo
- Publication number
- CN112210501B CN112210501B CN202011115286.XA CN202011115286A CN112210501B CN 112210501 B CN112210501 B CN 112210501B CN 202011115286 A CN202011115286 A CN 202011115286A CN 112210501 B CN112210501 B CN 112210501B
- Authority
- CN
- China
- Prior art keywords
- lactarius
- hatsuke
- hatsudake
- culture
- inoculation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G17/00—Cultivation of hops, vines, fruit trees, or like trees
- A01G17/005—Cultivation methods
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G18/00—Cultivation of mushrooms
- A01G18/10—Mycorrhiza; Mycorrhizal associations
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H15/00—Fungi; Lichens
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
Abstract
The invention belongs to the technical field of edible fungi, and particularly relates to Lactarius hatsuke JH5 and application thereof. The invention provides a rapidly-propagated Lactarius ruscus (Lactarius hatsudake) JH5, wherein the preservation number of the Lactarius ruscus (Lactarius hatsudake) JH5 is CGMCC No. 19369. Under the same culture condition, the Lactarius hatsuke JH5 has stronger competitive power and growth speed, has stronger capability of synthesizing mycorrhiza with a host, has high quality of cultured mycorrhiza seedlings, and can be used for large-scale and high-efficiency culture of the Lactarius hatsuke mycorrhiza seedlings.
Description
Technical Field
The invention belongs to the technical field of edible fungi, and particularly relates to Lactarius hatsuke JH5 and application thereof.
Background
Lactarius hatsudake enobuj tanaka belongs to the kingdom fungis Fungi (Fungi), Basidiomycota (Basidiomycota), Agaricales (Agaricamycetes), Russulales (russulles), Russulaceae (Russulaceae), and Lactarius (Lactarius), and is a famous delicious edible fungus in the world. The fruit body of Lactarius hatsudake tanaka has rich nutrition, good taste, high edible and medicinal value, and is rich in protein, crude fiber, various amino acids, fungal polysaccharide, unsaturated fatty acid, nucleic acid derivatives, and vitamin B1、B2The biological active ingredients such as vitamin C, vitamin PP and the like have medicinal effects of benefiting intestines and stomach, treating diabetes, improving human body immunity, resisting cancer and the like, are ideal multifunctional forest food, are deeply favored by domestic and foreign consumers, can be eaten fresh, quick-frozen or processed into fungus oil, and have long industrial chain, large market capacity and wide development prospect.
The wild lactarius hatsudake tanaka is the most important and most active wild fungus in the market in the production place and the surrounding areas, but the wild yield is low and uncontrollable. And the wild environment is frequently damaged, the market demand cannot be met, the sustainable utilization and the artificial cultivation of the lactarius hatsudake tanaka are realized, and the dream of people for cumin is realized.
In recent years, cultivation of lactarius hatsudake tanaka has quietly risen. The lactarius hatsudake tanaka is typical mycorrhizal edible fungi which are symbiotic with pine and oak species, the life history can not be normally finished after leaving a host, and the lactarius hatsudake tanaka can not be successfully cultivated according to a saprophytic edible fungi cultivation mode at present. The research of Tanzhiming et al shows that it is feasible to establish large-scale plantation of ectogenic basidiomycetous mycorrhizal edible fungus-Lactarius hatsudake. Lactarius rufuscus becomes the first basidiomycete mycorrhizal edible fungus which is successfully planted by manpower in China and even all over the world, the cultivation of the edible fungus has economic and ecological benefits, is popular with the market, and is an under-forest economic mode and characteristic planting industry which is promoted in the southeast region of China and is based on ecological priority in recent years.
The research on lactarius hatsudake tanaka at home and abroad mainly focuses on the aspects of nutrient content, health care function, strain separation, fermentation culture, mycorrhiza synthesis, indoor simulation of wild growth environment and the like of the sporocarp of the lactarius hatsudake tanaka. For example, patent No. ZL20130238366.8 (a method for preparing lactobacillus plantarum) provides a method for preparing lactobacillus plantarum, that is, a tissue separation method is adopted, tissue between a stipe and a pileus of lactobacillus plantarum is taken under aseptic conditions to be inoculated on a PDA test tube slant culture medium, after hyphae grow on tissue blocks of the PDA test tube slant culture medium, the tissue blocks are transferred to a WAY test tube slant culture medium to be cultured in a dark place, pure lactobacillus plantarum hyphae, a lactobacillus plantarum liquid microbial inoculum and a solid microbial inoculum are obtained after the culture, the pure lactobacillus plantarum hyphae, the lactobacillus plantarum liquid microbial inoculum and the solid microbial inoculum are respectively inoculated on the root system of a chestnut aseptic seedling of one year of age to be cultured for at least three months, and the lactobacillus plantarum mycorrhiza is obtained from the root system of the chestnut aseptic seedling. The invention focuses on the preparation of the microbial inoculum. Application No. 201710535014.7 (a complete artificial cultivation and planting method for lactarius hatsudake tanaka) discloses a complete artificial cultivation and planting method for preparing lactarius hatsudake tanaka stock seeds, preparing production seeds and artificially cultivating, namely, culturing for 270-295 hours on a stock seed culture medium containing an ant nest to obtain mature stock seeds, inoculating the mature stock seeds into the stock seed culture medium which takes cottonseed hulls, bran and ant nest leachate as main raw materials, culturing for 30-40 days to obtain the stock seeds, inoculating the production seeds which take the cottonseed hulls, the bran, sucrose and diamond chips as main raw materials again to the production seed culture medium which takes the cottonseed hulls, the bran, the sucrose and the diamond chips as main raw materials to obtain mature production seeds, directly embedding the production seeds with bags filled with mycelia into an intelligent fruiting room culture box, and controlling the temperature to 22-25 ℃ and the humidity to 85-95% to carry out fruiting management. The first batch of fruiting bodies are said to grow after about 20 days of growth cycle.
Although some prior arts claim to be unique in the acquisition of mycorrhiza of lactarius rufuscus or the cultivation of fruiting bodies, there has been no report on the acquisition of superior strains of lactarius rufuscus so far.
Disclosure of Invention
In order to solve the problems, the invention provides a Lactarius hatsuke JH5 strain and application thereof. The Lactarius hatsuke JH5 provided by the invention has the characteristics of rapid propagation, strong adaptability and high host infection capacity, and can effectively improve the cultivation effect of the Lactarius hatsuke mycorrhizal seedlings.
In order to achieve the purpose, the invention provides the following technical scheme:
the invention provides a Lactarius hatsuke JH5 strain, which is characterized in that the preservation number of the Lactarius hatsuke JH5 is CGMCC No. 19369.
The invention also provides a culture method based on the Lactarius hatsuke JH5, which comprises the following steps:
and (3) performing solid culture on the Lactarius hatsuke JH5 in a PDA (PDA) plate culture medium, inoculating the obtained hypha blocks into a liquid culture medium, and performing liquid culture by shaking a shaking table to obtain the Lactarius hatsuke JH5 inoculation microbial inoculum.
Preferably, the liquid culture medium comprises the following components in mass concentration: 0.1g/L of calcium chloride dihydrate, 0.5g/L of potassium dihydrogen phosphate, 0.5g/L of magnesium sulfate heptahydrate, 0.05mg/L of inositol, 0.1mg/L of folic acid, 0.05mg/L of vitamin B, 0.05mg/L of oligosaccharide, 0.001mg/L of triacontanol, 0.005g/L of manganese sulfate, 0.01g/L of zinc sulfate heptahydrate, 0.01g/L of ferric chloride hexahydrate, 30g/L of glucose, 0.2g/L of yeast extract and 2g/L of peptone.
Preferably, the shaking table shaking liquid culture temperature is 18-24 ℃, the rotating speed is 160-210 r/min, and the time is 18-35 days; the initial pH value of the liquid culture medium is 5.0-6.5, and the liquid loading amount is (200-300) mL/500 mL.
The invention also provides application of the Lactarius hatsuke JH5 in cultivation of Lactarius hatsudake mycorrhizal seedlings.
The invention provides a method for cultivating Lactarius rufuscus (Lactarius hatsudake) JH5 mycorrhizal seedlings based on Lactarius rufuscus (Lactarius hatsudake) JH5, which comprises the following steps:
(1) preparing a seedling culture substrate; the seedling substrate comprises peat soil, vermiculite and yellow core soil, and the water content is 60%; the volume ratio of the peat soil to the vermiculite to the yellow core soil is 2:1: 1; the components of the seedling substrate are mixed and then sterilized;
(2) carrying out pregermination and sowing on the host seeds to obtain seedlings of Pinaceae plants;
(3) preparing an inoculation microbial inoculum of Lactarius hatsuke JH 5;
(4) inoculating the inoculated microbial inoculum obtained in the step (3) to the seedling of the Pinaceae plant obtained in the step (2), and culturing a mycorrhizal seedling to obtain a Lactarius hatsuke JH5 mycorrhizal seedling; the method of inoculation comprises: when the seedlings of the Pinaceae plants are cultured for 25-40 days, injecting the diluted inoculation microbial inoculum into the roots of the seedlings, culturing for 90-150 days after inoculation, enabling the Lactarius hatsudake (Lactarius hatsudake) JH5 strain and a host to form a stable symbiotic relationship, and culturing for 60-90 days to obtain the Lactarius hatsudake (Lactarius hatsudake) JH5 mycorrhizal seedlings;
there is no requirement for time sequence between the steps (3) and (1) and (2).
Preferably, the Pinaceae plant includes Pinus massoniana, Pinus domestica, Pinus armandi, Pinus yunnanensis.
Preferably, the method for accelerating germination in step (2) comprises: soaking host seeds in sterile water for 16-24 hours, taking out the host seeds after soaking, placing the host seeds in a hydrogen peroxide aqueous solution with the hydrogen peroxide mass percentage of 30%, oscillating and soaking for 10-15 min, flushing the host seeds with sterile water for 4-5 times after oscillating and soaking, placing the flushed host seeds in a cotton bag, accelerating germination in an environment at 24-26 ℃, and spraying water every day during accelerating germination;
the method for sowing in the step (2) comprises the following steps: when the germination rate of the host seeds is more than or equal to 80 percent, the germinated host seeds are dibbled to a sterilized seedling raising substrate and placed in a greenhouse for seedling raising.
Preferably, the preparation method of the microbial inoculum for inoculation in the step (3) comprises the following steps: and (3) smashing a red-juice Lactarius hatsuke JH5 culture solution which is subjected to liquid culture for 21-28 days to obtain mycelium suspension with mycelium pellet diameter smaller than 2mm, namely the inoculation microbial inoculum.
Preferably, the dilution multiple of the microbial inoculum in the step (4) is 8-10 times; the inoculation amount of the diluted microbial inoculum is 5-10 mL per strain.
The invention provides a rapidly-propagated Lactarius ruscus (Lactarius hatsudake) JH5, wherein the preservation number of the Lactarius ruscus (Lactarius hatsudake) JH5 is CGMCC No. 19369. Under the same culture condition, the Lactarius hatsuke JH5 has stronger competitive power and growth speed, has stronger capability of synthesizing mycorrhiza with a host, has high quality of cultured mycorrhiza seedlings, and can be used for large-scale and high-efficiency culture of the Lactarius hatsuke mycorrhiza seedlings. According to the embodiment, the mycelium of the Lactarius hatsuke JH5 provided by the invention has the advantages of high growth speed, luxuriance and difficult aging, can grow over the whole dish in 28-35 days basically, and has low pollution rate; in the opposite culture, the colonies of the Lactarius ruscus (Lactarius hatsudake) JH5 are all larger than those of other strains; the single-plant root infection rate, mycorrhizal rate and mycorrhizal infection rate of Lactarius hatsuke JH5 are obviously higher than those of other strains, the single-plant root infection rate, the mycorrhizal infection rate and the mycorrhizal infection rate are respectively 60.33%, 90.67% and 79.60%, the average number of single-plant mycorrhizal is up to 48.65, and the mycorrhizal distribution in the root system is uniform.
Drawings
FIG. 1 is a graph comparing the growth of Lactarius rufuscus (Lactarius hatsudake) JH5 strain with that of other Lactarius rufuscus strains under the same culture conditions and time; wherein A is JH5, B is JH1, C is JH4, D is JH8, E is JH10, F is JH11, and G is JH 12;
FIG. 2 is a graph of the growth of different strains on PDA medium;
FIG. 3 is a photograph showing the observation of the competitive ability of Lactarius hatsuke JH5 with other strains; wherein A is strain JH5, B is strain JH1, C is strain JH4, D is strain JH8, E is strain JH10, F is strain JH11, and G is strain JH 12;
FIG. 4 shows mycorrhizal morphology of Lactarius rufus (Lactarius hatsudake) JH5 under a body microscope;
FIG. 5 shows a cultured Lactarius hatsuke JH5 mycorrhizal seedling;
FIG. 6 shows mycorrhiza formed by Lactarius hatsuke JH5 and Pinus massoniana;
FIG. 7 shows the cross-sectional scanning electron microscope morphology of Lactarius hatsuke (Lactarius hatsudake) JH5 mycorrhiza;
FIG. 8 is a statistical plot of the dry weight of mycelia obtained by culturing Lactarius hatsudake JH5 in different liquid strains;
FIG. 9 is the growth curve of Lactarius hatsuke JH5 under different cultivation conditions in example 7;
FIG. 10 is a tree of the evolution of Lactarius hatsuke JH 5;
FIG. 11 shows Lactarius hatsuke JH 5.
Detailed Description
The invention provides a Lactarius hatsuke JH5 strain, wherein the preservation number of the Lactarius hatsuke JH5 is CGMCC No. 19369; the ITS1 sequence of the Lactarius hatsuke JH5 is as follows:
GAGCCTTCCGTCTCGTGTGTGAGGCGTGTGAGGGCTGTCGCTGACTTTTTGACACAAAAGTCGTGCACGCCGGAGCACGTCCTCTCTCTCACATAAAATCCATCTCACCCTTTTGTGCACCACCGCGCGGGCACCCTTTGGGATGCTTGCGTTTTCACACAAACCCCTTTTAAAAAAGTGTAGAATGACCCCACTTTGCGATGACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTTCTCGGTTTTCTTCTGGACACCGAAGGAGGCTTGGACTTTGGAGGCCTTTGCTGGCGTCTCTCTAGAGCCAGCTCCTCTTAAATGAATTAGCGGGGTCCTCTTTGCCGATCCTTGACATGTGATAAGATGTTTCCATGACTCGGTTTCTGGCTCTGTTGCATTTGGGACCTGCTTCTAACCGTCTCGACGAGACGATGTTTGGGAGTGTCTCCCTTCTCGGGAGACTCTCTCGACCCCACGAACCCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAAGCATATCAATAAGCCGGAGGAA, SEQ ID NO: 1; the tree of the Lactarius hatsuke JH5 is shown in FIG. 10.
The Lactarius hatsuke JH5 provided by the invention has the advantages of excellent growth vigor, strong competitive power, extremely strong infection host capability, mycorrhizal synthesis capability and the like which are obviously superior to other strains, regular edges of bacterial colonies on a PDA culture medium commonly used by fungi, roundness, dense and white hyphae, fragrance of the mushroom, higher growth speed than other strains, competitive advantage over other strains and great application value. A schematic diagram of the growth of Lactarius hatsuke JH5 is shown in FIG. 11.
The invention also provides a culture method based on the Lactarius hatsuke JH5, which comprises the following steps:
and (3) performing solid culture on the Lactarius hatsuke JH5 in a PDA (PDA) plate culture medium, inoculating the obtained hypha blocks into a liquid culture medium, and shaking the liquid culture in a shaking table to obtain the Lactarius hatsuke JH5 liquid microbial inoculum. The method for culturing the Lactarius hatsuke JH5 can be used for efficiently culturing the Lactarius hatsuke JH 5.
In the present invention, the liquid medium preferably includes the following components in mass concentrations: calcium chloride dihydrate 0.1g/L, potassium dihydrogen phosphate 0.5g/L, magnesium sulfate heptahydrate 0.5g/L, inositol 0.05mg/L, folic acid 0.1mg/L, vitamin B10.05mg/L, oligosaccharide 0.05mg/L, triacontanol 0.001mg/L, manganese sulfate 0.005g/L, zinc sulfate heptahydrate 0.01g/L, ferric chloride hexahydrate 0.01g/L, glucose 30g/L, yeast extract 0.2g/L and peptone 2 g/L. In the present invention, Lactarius hatsudake JH5 is cultured in liquidThe growth speed in the culture medium is high, the amount of the obtained dry hyphae is large, and the pollution rate is low.
In the present invention, the shaking table shaking liquid culture conditions are preferably: the culture temperature is 18-24 ℃, the rotation speed is 160-210 r/min, the initial pH value is 5.0-6.5, and the liquid loading amount is preferably (200-300) mL/500 mL.
The culture method provided by the invention can effectively improve the mycelium dry weight of the Lactarius hatsuke JH5 obtained by culture, and shorten the culture period of Lactarius hatsuke JH 5.
The invention also provides application of the Lactarius hatsuke JH5 in cultivation of Lactarius hatsudake mycorrhizal seedlings. The Lactarius hatsuke JH5 provided by the invention has strong capability of synthesizing mycorrhiza with a host in the cultivation of Lactarius hatsuke mycorrhiza seedlings.
The invention provides a method for cultivating lactobacillus plantarum mycorrhiza seedlings by lactobacillus hatsuke JH5, which comprises the following steps:
(1) preparing a seedling culture substrate; the seedling substrate comprises peat soil, vermiculite and yellow core soil, and the water content is 60%; the volume ratio of the peat soil to the vermiculite to the yellow core soil is 2:1: 1; the components of the seedling substrate are mixed and then sterilized;
(2) carrying out pregermination and sowing on the host seeds to obtain seedlings of Pinaceae plants;
(3) preparing an inoculation microbial inoculum of Lactarius hatsuke JH 5;
(4) inoculating the inoculated microbial inoculum obtained in the step (3) to the seedling of the Pinaceae plant obtained in the step (2), and culturing a mycorrhizal seedling to obtain a Lactarius hatsuke JH5 mycorrhizal seedling; the method of inoculation comprises: when the seedlings of the Pinaceae plants are cultured for 25-40 days, injecting the diluted inoculation microbial inoculum into the roots of the seedlings, culturing for 90-150 days after inoculation, enabling the Lactarius hatsudake (Lactarius hatsudake) JH5 strain and a host to form a stable symbiotic relationship, and culturing for 60-90 days to obtain the Lactarius hatsudake (Lactarius hatsudake) JH5 mycorrhizal seedlings;
there is no requirement for time sequence between the steps (3) and (1) and (2).
The quality of mycorrhizal seedlings cultivated by the method provided by the invention is higher than that of other strains, and the method is suitable for large-scale efficient cultivation of the Lactarius rufuscus mycorrhizal seedlings.
In the present invention, the Pinaceae plant preferably includes Pinus massoniana, Pinus abroad, Pinus armandi, Pinus yunnanensis.
In the present invention, the method for accelerating germination in step (2) preferably comprises: soaking host seeds in sterile water for 16-24 hours, taking out the host seeds after soaking, placing the host seeds in aqueous hydrogen peroxide solution with the hydrogen peroxide content of preferably 30% by mass, oscillating and soaking for 10-15 min, washing the host seeds for 4-5 times by using sterile water after oscillating and soaking, placing the washed host seeds in a cotton bag, accelerating germination in an environment at 24-26 ℃, and spraying water every day during accelerating germination;
the method for sowing in the step (2) preferably comprises: when the germination rate of the host seeds is more than or equal to 80 percent, the germinated host seeds are dibbled to a sterilized seedling raising substrate and placed in a greenhouse for seedling raising. All operations in the step (2) are under aseptic conditions; the sterilization treatment method under the aseptic condition preferably comprises high temperature, anaerobic treatment, ozone and ultraviolet; the clean environment refers to an environment without mycorrhizal sundry fungus pollution except for lactarius hatsudake tanaka, and comprises air, water, a substrate, a container and the like which are used for culturing mycorrhizal seedlings and cannot be infected with mycorrhizal sundry fungus.
In the present invention, the method for preparing the microbial inoculum for inoculation in the step (3) preferably comprises: and (3) smashing a red-juice Lactarius hatsuke JH5 culture solution which is subjected to liquid culture for 21-28 days to obtain mycelium suspension with mycelium pellet diameter smaller than 2mm, namely the inoculation microbial inoculum.
In the invention, the dilution multiple of the microbial inoculum in the step (4) is preferably 8-10 times; the inoculation amount of the diluted microbial inoculum is preferably 5-10 mL/strain.
For further illustration of the present invention, a lactobacillus plantarum (lacteus hatsudake) JH5 and its application will be described in detail with reference to the drawings and examples, but they should not be construed as limiting the scope of the present invention.
Example 1
Isolation of Lactarius rufuscus strain
In 11 months from 2016 to 2017, in a pinus massoniana forest which generates a large amount of lactarius hatsudake in Jianhe county, Chenzhou, Hunan province, under a host forest canopy which has a large amount of lactarius hatsudake produced in one time and is dense in mushroom production, the applicant selects fresh lactarius hatsudake without diseases and insect pests, robustness and 3-5 cm of pileus diameter, and is not opened, only 3-4 lactarius hatsudake fruit bodies meeting the requirements are selected for each host, and the host is brought back to a laboratory at low temperature to separate strains by adopting a tissue separation method. The method comprises the following specific steps: slightly wiping the surface of a fruit body with cotton swabs or degreased cotton dipped with 75% alcohol on an ultra-clean bench, then sucking water on the surface of the fruit body with sterile filter paper, cutting pileus, stipe and inner-layer tissues at the junction of the pileus and the stipe, placing on a PDA (personal digital assistant) flat plate, removing polluted bacterial colonies after the bacterial colonies grow out, selecting hyphae at the edge of the pollution-free bacterial colonies to be cultured in a fresh PDA flat plate, and editing the obtained isolate of each fruit body of each tree into the same number, wherein one fruit body is one number, such as JH1-1, JH1-2, JH1-3 and JH 1-4; JH2-1, JH2-2, JH2-3 and JH 2-4; JH3-1, JH3-2, JH3-3 and JH 3-4; JH4-1 … …; the strains which are successfully isolated and grow most vigorously per tree are retained, and the numbers of the retained trees are JH1, JH2, JH3, JH4, JH5 and JH6 … ….
Example 2
The strain provided in example 1 was taken. A9 cm glass petri dish was used, and 10ml of sterilized PDA medium was poured into each dish for use. After the same batch of the strains are subjected to activated culture for the same time, tissue blocks with the same size are taken down from a flat plate by a hole puncher with the diameter of 0.5cm and are respectively inoculated on spare flat plates, each strain is cultured for 3 dishes and repeated for three times, after inoculation, the strain is cultured in an environment with the temperature of 21-24 ℃, the diameter of a bacterial colony is investigated by a cross method every 7 days, and a growth curve of the lactarius rufuscus is drawn. FIG. 1 shows the growth of different strains on PDA medium for 35 days, and FIG. 2 shows the growth curves of different strains on PDA medium.
TABLE 1 JH5 comparison with growth of other strains on PDA medium
As can be seen from FIG. 1, FIG. 2 and Table 1, in comparison with other strains, the hyphae of Lactarius hatsuke JH5 are pure white and flourishing, the hyphae outside the substrate grows faster, is dense and not easy to age, can grow over the whole plate in 28-35 days, and has low pollution rate in the same culture time.
Example 3
The strain provided in example 1 was taken. JH5 and other strains were cultured in different media, and JH5 and other strains were examined for nutritional adaptation, the formulations of the different media are shown in Table 2, and the culture results are shown in tables 3 and 4.
TABLE 2 numbering of the different media and the corresponding formulations
TABLE 3 growth rates of JH5 and other strains under different nutritional conditions
TABLE 4 colony morphology of JH5 and other strains under different nutritional conditions
As can be seen from tables 3 and 4, the Lactarius hatsudake JH5 can adapt to different nutritional conditions compared with other strains, and the extracellular hyphae of the Lactarius hatsudake JH5 is more flourishing, white and dense under each nutritional condition, and is obviously superior to other strains.
Example 4
The competitive power of Lactarius hatsuke JH5 was tested by plate confrontation. JH5 and another strain with the diameter of 0.5cm are respectively inoculated on a PDA plate culture medium with the diameter of 9cm at a distance of 3cm, hypha fragments of unified strains are contrasted and cultured in a constant-temperature incubator at 24 ℃, and after two bacterial colonies are intersected, the two bacterial colonies are cultured for 6 days, and whether the two bacterial colonies are fused or have an obvious antagonism is observed to judge whether the antagonism exists or not and the competitive power. The test results are shown in FIG. 3 and Table 5.
TABLE 5 examination of Lactarius hatsuke JH5 for its competence with other strains
As can be seen from FIG. 3 and Table 5, Lactarius russula (Lactarius hatsudake) JH5 has antagonistic bands with other strains, and colonies of Lactarius russula (Lactarius hatsudake) JH5 were larger than those of other strains in the confronted culture.
Example 5
The mycorrhizal forming ability of Lactarius hatsuke (Lactarius hatsuke) JH5 is detected by taking masson pine as a host. The preparation of the matrix formula and the sterilized matrix comprises the following steps: peat soil: vermiculite: mixing loess 2:1:1 (volume ratio), water content of 60%, stirring, and heating at 121 deg.C under high pressure (1.5 kg cm)-2) Sterilizing for 2 hours, and cooling for later use.
Host pinus massoniana seed pregermination and sowing: and (4) selecting full and insect-free masson pine seeds. In a room, firstly soaking the seeds in sterile water for 16-24 h, then soaking the seeds in 30% hydrogen peroxide for 15min in a shaking way, then washing the seeds with the sterile water for 4-5 times, placing the seeds in a culture dish or a transparent plastic box which is padded with sterilized wet gauze, and accelerating germination in an incubator at 24-26 ℃. Spraying a proper amount of sterile water with a watering can every day, preserving gauze for moistening, dibbling the germinated seeds into a 32-grid seedling culture container tray filled with a sterilized matrix when the germination rate of the seeds reaches more than 80%, and placing the seedling culture container tray in a greenhouse for seedling culture management.
Preparing an inoculation microbial inoculum: filtering each red-juice lactarius strain mycelium subjected to liquid culture for 21-28 days on a sterile operating platform by using sterile gauze, washing the mycelium by using filtrate, putting the filtrate into a sterile beaker, adding a proper amount of filtrate, smashing the mycelium by using a tissue stirrer for about 1min, mixing the mycelium suspension and the filtrate to obtain a microbial inoculum, and putting the microbial inoculum into a refrigerator at 4 ℃ for storage.
Synthesizing lactarius hatsudake-masson pine mycorrhiza: and (3) when the masson pine seedlings are cultured in a sterile matrix for 25-40 days, injecting a 10-time diluted microbial inoculum into the roots of the seedlings by using a sterile medical injector, wherein the inoculation amount is 5 ml/plant. Watering with sterile water during the culture period, maintaining the substrate humidity at the field water capacity, inoculating 160 strains of each strain, and repeating for three times; the Control (CK) group was kept identical except for the non-inoculated strain. After 7 months of inoculation, randomly extracting 30 seedlings per treatment, and investigating seedling height, main root length, ground diameter, primary side root number, secondary side root number (more than 2 cm), mycorrhiza number per unit centimeter, overground dry weight, underground dry weight, mycorrhiza (binary branching) number, mycorrhiza rate, single root system mycorrhiza rate and mycorrhiza infection rate.
Calculating the mycorrhization rate (the number of strains forming mycorrhiza/the number of inoculated strains) multiplied by 100%;
the mycorrhization rate of the single root system is (the root system number of the single plant with mycorrhiza/the total number of the first-level and second-level lateral roots of the single plant) multiplied by 100 percent;
the mycorrhizal infection rate is equal to the number of root segments with mycorrhiza/total root segment number multiplied by 100 percent;
the number of mycorrhiza per centimeter is the number of mycorrhiza per root length on a single root.
The test results are shown in fig. 4-fig. 7, tables 6 and 7, wherein fig. 4 shows mycorrhizal morphology of Lactarius rufuscus (Lactarius hatsuke) JH5 under a body type microscope; FIG. 5 shows a cultured Lactarius hatsuke JH5 mycorrhizal seedling; FIG. 6 shows mycorrhiza formed by Lactarius hatsuke JH5 and Pinus massoniana; FIG. 7 shows the cross-sectional scanning electron microscope morphology of the mycorrhiza of Lactarius hatsuake JH 5.
TABLE 6 comparison of the ability of JH5 to form mycorrhiza with other strains
TABLE 7 Effect of inoculation of different strains on the growth of the host Pinus massoniana seedlings
As can be seen from tables 6 and 7, compared with other strains, the single-strain root infection rate, mycorrhizal infection rate and mycorrhizal infection rate of JH5 are significantly higher than those of other strains, and respectively reach 60.33%, 90.67% and 79.60%; the number of the mycorrhiza of the single strain is the highest, the average number is 48.65, and the mycorrhiza in the root system is uniformly distributed. The CK group without inoculation did not have any mycorrhiza formed. The seedling height, main root length, ground diameter, total biomass and root-crown ratio of the masson pine seedling inoculated with the Lactarius hatsuke JH5 strain are all higher than those of a control without inoculation. Lactarius hatsudake (Lactarius hatsudake) JH5 strain can be used for cultivating mycorrhizal seedlings suitable for field planting.
Example 6
Respectively culturing JH5 strain under the same conditions (liquid loading of each bottle is 250mL/500mL, 24 ℃, 180r, and pH value is 5.5), and screening the optimal liquid culture formula JH 5. The method comprises the following steps: a bacterial strain plate of Lactarius hatsuke JH5 for 18-21 d of red-juice Lactarius is subjected to enlarged culture on a culture dish filled with a PDA culture medium by using a sterilized puncher, two hypha blocks are picked together with the culture medium by using an inoculation hook and are placed into culture bottles of different culture media, the dry weight of the hypha is measured once every 5 days, the three times of repetition are carried out, and a growth curve is drawn according to the result. The hypha dry weight determination method comprises the following steps: filtering the culture solution with 5 layers of gauze, washing with distilled water thoroughly until the culture solution is not sticky, drying at 60 deg.C to constant weight, and weighing with electronic balance.
The statistical result is shown in FIG. 8, and it can be seen from FIG. 8 that Lactarius hatsuke JH5 grows faster and has a larger amount of dry mycelia in BAF, PDA, WPM and BAF-1 four liquid culture media, but the growth speed is fastest under the nutrition condition of BAF-1, the dry weight of the mycelia can reach 0.49-0.55 g/L when cultured for 20-25 days, and the pollution rate is lowest in the experimental process. BAF-1 is the optimal culture medium for JH5 liquid microbial inoculum production.
Example 7
BAF-1 is used as a culture medium, a single-factor method is adopted, shaking table culture is carried out, and various culture conditions of Lactarius hatsuke JH5 are optimized in sequence, namely, the initial pH value (4, 4.5, 5.0, 5.5, 6, 6.5, 7, 7.5, 8, 8.5 and 9) of the culture medium, the liquid loading amount (50mL, 100mL, 150mL, 200mL, 250mL, 300mL, 350mL and 400mL) of the culture medium, the culture temperature (15 ℃, 18 ℃, 21 ℃, 24 ℃, 27 ℃, 30 ℃, 33 ℃ and 36 ℃) and the shaking table rotation speed (100r/min, 120r/min, 140r/min, 160r/min, 180r/min, 200r/min and 220r/min) are optimized respectively. Results FIG. 9 shows that the relatively good culture conditions for Lactarius hatsuke JH5 are: the culture temperature is 18-24 ℃, the rotation speed is 160-210 r/min, the initial pH value is 5.0-6.5, the liquid loading amount is (200-300) mL/500mL, the culture is carried out for 20-25 days under the condition, and the dry weight of hyphae can reach 0.62-0.84 g/L.
Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
Sequence listing
<110> scientific college for forestry in Hunan province
<120> Lactarius hatsudake strain JH5 and application thereof
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 693
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gagccttccg tctcgtgtgt gaggcgtgtg agggctgtcg ctgacttttt gacacaaaag 60
tcgtgcacgc cggagcacgt cctctctctc acataaaatc catctcaccc ttttgtgcac 120
caccgcgcgg gcaccctttg ggatgcttgc gttttcacac aaaccccttt taaaaaagtg 180
tagaatgacc ccactttgcg atgacacgca atcaatacaa ctttcaacaa cggatctctt 240
ggctctcgca tcgatgaaga acgcagcgaa atgcgatacg taatgtgaat tgcagaattc 300
agtgaatcat cgaatctttg aacgcacctt gcgccccttg gtattccgag gggcacaccc 360
gtttgagtgt cgtgaaaatc tcaaccttct cggttttctt ctggacaccg aaggaggctt 420
ggactttgga ggcctttgct ggcgtctctc tagagccagc tcctcttaaa tgaattagcg 480
gggtcctctt tgccgatcct tgacatgtga taagatgttt ccatgactcg gtttctggct 540
ctgttgcatt tgggacctgc ttctaaccgt ctcgacgaga cgatgtttgg gagtgtctcc 600
cttctcggga gactctctcg accccacgaa cccttgacct caaatcgggt gagactaccc 660
gctgaactta agcatatcaa taagccggag gaa 693
Claims (10)
1. The Lactarius hatsuke JH5 is characterized in that the preservation number of the Lactarius hatsuke JH5 is CGMCC No. 19369.
2. The cultivation method of Lactarius hatsuke (Lactarius hatsudake) JH5 according to claim 1, comprising the steps of:
the Lactarius hatsuke JH5 of claim 1 is subjected to solid culture in a PDA plate culture medium, the obtained hypha blocks are inoculated in a liquid culture medium, and the liquid culture is carried out by shaking a shaking table to obtain the Lactarius hatsuke JH5 inoculation microbial inoculum.
3. The culture method according to claim 2, wherein the liquid medium comprises the following components in mass concentration: 0.1g/L of calcium chloride dihydrate, 0.5g/L of potassium dihydrogen phosphate, 0.5g/L of magnesium sulfate heptahydrate, 0.05mg/L of inositol, 0.1mg/L of folic acid, 10.05mg/L of vitamin B, 0.05mg/L of oligosaccharide, 0.001mg/L of triacontanol, 0.005g/L of manganese sulfate, 0.01g/L of zinc sulfate heptahydrate, 0.01g/L of ferric chloride hexahydrate, 30g/L of glucose, 0.2g/L of yeast extract and 2g/L of peptone.
4. The cultivation method according to claim 2, wherein the shaking table shaking liquid cultivation temperature is 18-24 ℃, the rotation speed is 160-210 r/min, and the time is 18-35 days; the initial pH value of the liquid culture medium is 5.0-6.5, and the liquid loading amount is (200-300) mL/500 mL.
5. Use of Lactarius hatsudake (Lactarius hatsudake) JH5 as claimed in claim 1 for cultivating Lactarius hatsudake mycorrhizal plantlets.
6. A method for cultivating Lactarius rufuscus hatsuke JH5 mycorrhizal seedlings based on Lactarius rufuscus (Lactarius hatsudake) JH5 as claimed in claim 1, comprising the steps of:
(1) preparing a seedling culture substrate; the seedling substrate comprises peat soil, vermiculite and yellow core soil, and the water content is 60%; the volume ratio of the peat soil to the vermiculite to the yellow core soil is 2:1: 1; the components of the seedling substrate are mixed and then sterilized;
(2) carrying out pregermination and sowing on the host seeds to obtain seedlings of Pinaceae plants;
(3) preparing an inoculation microbial inoculum of Lactarius hatsuke JH 5;
(4) inoculating the inoculated microbial inoculum obtained in the step (3) to the seedling of the Pinaceae plant obtained in the step (2), and culturing a mycorrhizal seedling to obtain a Lactarius hatsuke JH5 mycorrhizal seedling; the method of inoculation comprises: when the seedlings of the Pinaceae plants are cultured for 25-40 days, injecting the diluted inoculation microbial inoculum into the roots of the seedlings, culturing for 90-150 days after inoculation, enabling the Lactarius hatsudake (Lactarius hatsudake) JH5 strain and a host to form a stable symbiotic relationship, and culturing for 60-90 days to obtain the Lactarius hatsudake (Lactarius hatsudake) JH5 mycorrhizal seedlings;
there is no requirement for time sequence between the steps (3) and (1) and (2).
7. The method of claim 6, wherein the Pinaceae plant comprises Pinus massoniana, Pinus abroad, Pinus armandi, Pinus yunnanensis.
8. The method of claim 6, wherein the pregermination method in the step (2) comprises the following steps: soaking host seeds in sterile water for 16-24 hours, taking out the host seeds after soaking, placing the host seeds in a hydrogen peroxide aqueous solution with the hydrogen peroxide mass percentage of 30%, oscillating and soaking for 10-15 min, flushing the host seeds with sterile water for 4-5 times after oscillating and soaking, placing the flushed host seeds in a cotton bag, accelerating germination in an environment at 24-26 ℃, and spraying water every day during accelerating germination;
the method for sowing in the step (2) comprises the following steps: when the germination rate of the host seeds is more than or equal to 80 percent, the germinated host seeds are dibbled to a sterilized seedling raising substrate and placed in a greenhouse for seedling raising.
9. The method according to claim 6, wherein the preparation method of the inoculant for inoculation in the step (3) comprises the following steps: and (3) smashing a red-juice Lactarius hatsuke JH5 culture solution which is subjected to liquid culture for 21-28 days to obtain mycelium suspension with mycelium pellet diameter smaller than 2mm, namely the inoculation microbial inoculum.
10. The method according to claim 6, wherein the microbial inoculum in the step (4) is diluted by 8-10 times; the inoculation amount of the diluted microbial inoculum is 5-10 mL per strain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011115286.XA CN112210501B (en) | 2020-10-19 | 2020-10-19 | Lactarius hatsuke JH5 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011115286.XA CN112210501B (en) | 2020-10-19 | 2020-10-19 | Lactarius hatsuke JH5 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112210501A CN112210501A (en) | 2021-01-12 |
| CN112210501B true CN112210501B (en) | 2021-08-27 |
Family
ID=74055665
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011115286.XA Active CN112210501B (en) | 2020-10-19 | 2020-10-19 | Lactarius hatsuke JH5 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112210501B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113973943A (en) * | 2021-10-27 | 2022-01-28 | 广东省科学院微生物研究所(广东省微生物分析检测中心) | Bright lactarius tea and preparation method thereof |
| CN116622553B (en) * | 2023-04-07 | 2023-12-08 | 四川省食用菌研究所 | Lactarius deliciosus mycorrhiza growth promoting bacterium, and preparation method and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103314782A (en) * | 2013-06-17 | 2013-09-25 | 吉林农业大学 | Method for preparing lactarius hatsudake mycorhiza |
| CN104522322A (en) * | 2014-12-29 | 2015-04-22 | 江苏千药堂国医研究院有限公司 | Preparing method for fungus bran protein of edible and medicinal funguses |
| CN107311721A (en) * | 2017-07-03 | 2017-11-03 | 株洲市金盟熹农业拓展有限公司 | A kind of complete artificial culture implantation methods of Lactrarius hatsudake |
-
2020
- 2020-10-19 CN CN202011115286.XA patent/CN112210501B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103314782A (en) * | 2013-06-17 | 2013-09-25 | 吉林农业大学 | Method for preparing lactarius hatsudake mycorhiza |
| CN104522322A (en) * | 2014-12-29 | 2015-04-22 | 江苏千药堂国医研究院有限公司 | Preparing method for fungus bran protein of edible and medicinal funguses |
| CN107311721A (en) * | 2017-07-03 | 2017-11-03 | 株洲市金盟熹农业拓展有限公司 | A kind of complete artificial culture implantation methods of Lactrarius hatsudake |
Non-Patent Citations (1)
| Title |
|---|
| Diversity and colonization of putative mycorrhizal fungi in Eucalytus plantations in southern China;Chen Y L等;《Forestry Studies in China》;20001231;第2卷(第2期);第34-42页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112210501A (en) | 2021-01-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102187787B (en) | Method for culturing rare edible fungi including tricholoma lobayense heim and clitocybe maxima by using vine shoot dust | |
| CN101659933B (en) | Antagonistic bacteria preventing and removing continuous cropping tomato bacterial wilt and microbial organic fertilizer thereof | |
| CN102584359B (en) | Composite biological agent and preparation method thereof | |
| CN103382134A (en) | Fermentation method of Agaricus bisporus (Lange) Sing cultivation matrix | |
| CN103382139A (en) | Agaricus bisporus (Lange) Sing culture medium | |
| CN112210501B (en) | Lactarius hatsuke JH5 and application thereof | |
| JP2007053928A (en) | New fungal strain and method for culturing new fruit body | |
| KR100823541B1 (en) | Mushroom cultivation method | |
| CN103704069A (en) | Method of three-dimensionally preventing and controlling tomato bacterial wilt | |
| CN112021073A (en) | Morchella esculenta external aid nutrition bag ingredient, nutrition bag and preparation method thereof | |
| CN108410741A (en) | A kind of obligate AM Inoculants of citrus and preparation method thereof | |
| KR20110006267A (en) | Raw material composite for culture of agaric mushroom and mathod for cultering agaric mushroom using the same | |
| CN105948831B (en) | A method of biological and ecological methods to prevent plant disease, pests, and erosion fertilizer is produced using brewex's grains | |
| KR101385540B1 (en) | Cultivation method for Cauliflower mushroom | |
| KR101239711B1 (en) | Manufacturing process of lentinus edodes culture | |
| CN101451112B (en) | Soil bacilli for preventing and controlling fruit tree crown gall and strain agent thereof and preparation method | |
| CN110122485A (en) | A kind of trichoderma, Trichoderma and preparation method thereof | |
| CN105296360B (en) | Phellinus parent species tissue detaches tube breeding method | |
| CN115725419B (en) | Phosphorus-dissolving blueberry endophytic trichoderma and application thereof | |
| KR100723068B1 (en) | Method for culturing flammulina velutipes including ginseng saponin | |
| CN110229757A (en) | One plant effectively facilitates the tangerine green trichoderma JS84 of plant growth and its biological organic fertilizer of development | |
| CN113040000B (en) | Phellinus igniarius cultivation method capable of achieving fast Phellinus igniarius emergence | |
| CN101619293A (en) | Streptomyces vinaceusdrappus, filtering method and application | |
| CN109628345B (en) | Composite microbial inoculum for preventing and treating brown rot of succulent plants as well as preparation method and application of composite microbial inoculum | |
| CN114395485A (en) | Mucuna strain TP-2 capable of promoting stem growth of dendrobium and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |