CN111961677B - Method for regulating and controlling chrysanthemum flower type and/or leaf shape and/or plant type and application - Google Patents
Method for regulating and controlling chrysanthemum flower type and/or leaf shape and/or plant type and application Download PDFInfo
- Publication number
- CN111961677B CN111961677B CN202010912874.XA CN202010912874A CN111961677B CN 111961677 B CN111961677 B CN 111961677B CN 202010912874 A CN202010912874 A CN 202010912874A CN 111961677 B CN111961677 B CN 111961677B
- Authority
- CN
- China
- Prior art keywords
- mcmcuc2
- plant
- gene
- chrysanthemum
- type
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
- C12N15/827—Flower development or morphology, e.g. flowering promoting factor [FPF]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Abstract
The invention belongs to the field of plant genetic engineering and transgenic breeding, and relates to a method for regulating and controlling flower type, leaf shape and plant type of chrysanthemum by transferring CmCUC2 gene, wherein a mutated CmCUC2 gene sequence (mCMUC 2) is artificially synthesized according to a CmCUC2 gene sequence in cut chrysanthemum 'Mare', and is transferred into chrysanthemum by adopting an agrobacterium-mediated method for culturing to preliminarily obtain a resistant plant. DNA and RNA level detection is carried out on the resistant plant, and the mCMCUC2 gene is confirmed to be integrated into the genome DNA of the transgenic plant and be transcribed. Carrying out phenotype observation and statistical analysis on the transgenic plant, wherein the petals of the transgenic plant are outwards turned, the tips of the petals are cracked, and the whole flower form is in a rolling form; the leaf fissure is deepened; the plants are short and the internode distance is shortened. The invention can be widely applied to the aspects of cultivating cut chrysanthemum and plains coreopsis, and the like, provides a novel and practical method for improving important agronomic characters of flowers by utilizing a genetic engineering technology and easily simplifying cultivation, and has higher application value.
Description
Technical Field
The invention belongs to the field of plant genetic engineering and transgenic breeding, and relates to a method for further cultivating dwarf chrysanthemum with curled petals and deepened leaf cracks by changing the shapes of petals and leaves of the chrysanthemum through a transgenic technology and application of the method.
Background
Chrysanthemum (Chrysanthemum x morifolium Ramat.) is one of the ten famous flowers in China and the four cut flowers in the world, and plays an important role in the flower industry. The chrysanthemum has various flowers, and is one of the most abundant important characters for the chrysanthemum to change most and reflect the ornamental value of the chrysanthemum. The cut chrysanthemum has developed into international commodity flowers with higher economic value. Compared with the abundant and various flower types of the traditional chrysanthemum, the cut flower chrysanthemum is single in shape, mostly in flat-petal internal leaven and totally in lotus-base shape or peony shape, and is difficult to meet the increasingly diversified consumption requirements. Therefore, the cultivation of the cut chrysanthemum with different flower types has important practical value and economic significance for promoting the consumption of the cut chrysanthemum, increasing the income of flower farmers and the like.
In recent years, with the rapid development of molecular biology, overexpression or site-specific knockout of specific endogenous genes in plants by agrobacterium-mediated genetic transformation technology to change agronomic traits of crops has gradually become an important means of modern breeding. Compared with the traditional breeding mode which takes hybridization as a main mode, the breeding method greatly improves the breeding efficiency, shortens the breeding time and provides a new means and way for improving the chrysanthemum varieties. At present, the case of improving chrysanthemum flower type by transgenic method is rarely reported.
Disclosure of Invention
The invention aims to simultaneously solve the problem of directionally improving the flower shape, the leaf shape and the plant type of the chrysanthemum, and provides a method for obtaining the chrysanthemum transformed with the CmCUC2 gene, which can regulate and control the leaf shape and the plant type while changing the flower shape and provide a new practical method for cultivating ornamental chrysanthemum varieties by utilizing a genetic engineering technology.
The purpose of the invention can be realized by the following technical scheme:
the first purpose of the invention is to provide a gene CmCUC2 related to chrysanthemum flower type and/or leaf shape and/or plant type, which is characterized in that the nucleotide sequence of the gene CmCUC2 is shown as SEQ ID NO. 1.
The second purpose of the invention is to provide a gene mCICUC 2 related to chrysanthemum flower type and/or leaf shape and/or plant type, wherein the nucleotide sequence of the gene mCICUC 2 is shown as SEQ ID NO. 2. The gene mCMCUC2 is characterized in that mutation is designed at a binding site of miRNA164 according to 'Neuma' CmCUC2 sequence information (SEQ ID NO.1), and specifically comprises the following steps: 708, 711, 714, 720, 721, 722 and 723 deoxynucleotides of a CmCUC2 Coding sequence (CDS sequence) are respectively mutated into thymine (T), adenine (A), thymine (T), adenine (A), guanine (G) and thymine (T), and a mutated CmCUC2 gene sequence (mCUC 2) is artificially synthesized, so that mCUC2 cannot be cut by miRNA164 on the premise of no change of an amino acid sequence, necessary conditions are provided for further construction of a required overexpression vector, and the mCUC2 gene nucleotide sequence is SEQ ID No. 2.
A third object of the present invention is to provide a plant expression vector comprising the aforementioned gene mcuc 2;
preferably, the plant expression vector is obtained by connecting the aforementioned mCmCUC2 into an overexpression vector.
Further preferably, the basic vector of the overexpression vector is a pBIG overexpression vector.
Further, the plant expression vector is obtained by the following method: designing a specific primer of the mCIC 2 gene according to the full-length gene sequence of the mCIC 2, carrying out PCR reaction by using high-fidelity enzyme by using a plasmid pMD 19-T-mCIC 2 as a template, and recycling glue to obtain an mCIC 2 gene fragment added with a restriction enzyme cutting site;
carrying out double enzyme digestion on the mCICUC 2 gene fragment added with the enzyme digestion site and the plant expression vector pBIG by using restriction enzymes XbaI and BamHI respectively;
recovering the enzyme digestion product, connecting by using ligase, transforming escherichia coli DH5 alpha competent cells, identifying to obtain a positive strain, extracting a positive cloning plasmid, and obtaining a plant expression vector pBIG-mCICUC 2;
the specific primer of the mCICUC 2 gene is as follows:
an upstream primer: mCICUC 2-XbaI-F:
5'-GCTCTAGAATGGCGTATTTTAACCAACATT-3′(SEQ ID NO.3)；
a downstream primer: mCICUC 2-BamHI-R:
5'-CGGGATCCTCAGAAGCTCCAGATGCAAT-3′(SEQ ID NO.4)。
the preparation method of the pMD 19-T-mCICUC 2 comprises the following steps: the mCICUC 2 gene sequence shown in SEQ ID NO.2 is connected with pMD19-T, DH5 alpha competent cells are transformed, positive strains are identified, and a positive plasmid pMD 19T-mCIC 2 is obtained.
The fourth purpose of the invention is to provide a method for regulating chrysanthemum flower type and/or leaf shape and/or plant type by expressing the mCUC2 gene, which comprises the following steps:
(1) obtaining a gene mCICUC 2 shown in SEQ ID NO.2, and constructing a positive plasmid pMD 19-T-mCICUC 2;
(2) constructing a plant expression vector pBIG-mCICUC 2: the basic vector of the plant expression vector pBIG-mCICUC 2 is a pBIG overexpression vector, and the plant expression vector pBIG-mCICUC 2 comprises a CmCUC2 gene sequence shown in SEQ ID No. 2;
(3) and (3) transferring the plant expression vector pBIG-mCICUC 2 constructed in the step (2) into chrysanthemum by adopting an agrobacterium-mediated method, and culturing and detecting to obtain a positive strain.
Further, the method for obtaining the gene mCICUC 2 shown in SEQ ID NO.2 in the step (1) comprises the following steps: according to the sequence information of 'Marma' CmCUC2 shown in SEQ ID NO.1, mutation is carried out at the binding site of miRNA164, and the mutation is specifically as follows: the 708 th, 711 th, 714 th, 720 th, 721 th, 722 th, 723 th deoxynucleotides of a CmCUC2 Coding sequence (CDS sequence) are respectively mutated into thymine (T), adenine (A), thymine (T), adenine (A), guanine (G), thymine (T), an mCMCUC2 gene sequence shown in SEQ ID NO.2 is artificially synthesized, PMD19-T is connected, DH5 alpha competent cells are transformed, positive strains are identified, and a positive plasmid pMD19-T-mCMCUC2 is obtained.
Further, the plant expression vector pBIG-mCICUC 2 in the step (2) is constructed by the following steps:
designing a specific primer of the mCICUC 2 gene according to the full-length gene sequence of the mCICUC 2, taking the pMD 19-T-mCICUC 2 plasmid obtained in the step (1) as a template, carrying out PCR reaction by using high-fidelity enzyme, and recovering glue to obtain an mCICUC 2 gene fragment added with a restriction enzyme cutting site;
carrying out double enzyme digestion on the mCUC2 gene fragment added with the enzyme digestion site and a plant expression vector pBIG by using restriction enzymes XbaI and BamHI respectively;
recovering the enzyme digestion product, connecting by using ligase, transforming DH5 alpha competent cells, identifying to obtain a positive strain, extracting a positive cloning plasmid, and obtaining a plant expression vector pBIG-mCICUC 2;
the specific primer of the mCICUC 2 gene is as follows:
an upstream primer: mCICUC 2-XbaI-F:
5'-GCTCTAGAATGGCGTATTTTAACCAACATT-3′(SEQ ID NO.3)；
a downstream primer: mCICUC 2-BamHI-R:
5'-CGGGATCCTCAGAAGCTCCAGATGCAAT-3′(SEQ ID NO.4)。
further, the step (3) comprises the following specific steps: transforming agrobacterium EHA105 competent cells by the plant expression vector pBIG-mCICUC 2 constructed in the step (2), identifying to obtain a positive strain, introducing mCICUC 2 into chrysanthemum by an agrobacterium-mediated leaf disc method, transferring the chrysanthemum to a screening culture medium added with kanamycin, and carrying out subculture to obtain a kanamycin-resistant plant; carrying out DNA and RNA level detection on kanamycin-resistant plants, and screening out positive mCUC2 transgenic plants which have genome inserted into mCUC2 and can be expressed smoothly; preferably, the chrysanthemum is 'shenma'.
Further, the process of detecting the levels of DNA and RNA of the positive transformed plants comprises the following steps:
1) and (3) DNA level detection:
taking young leaves of a plant with kanamycin resistance and young leaves of a wild-type plant obtained by root screening, extracting genome DNA, taking a section of sequence of a 35S promoter and a section of sequence of mCIC 2 as detection targets, designing primers at two ends of the 35S promoter and mCIC 2, wherein the length of an amplified section is 552bp, and the primer sequences are as follows:
an upstream primer: 35S-mCMCUC 2-F:
5'-GACGCACAATCCCACTATCC-3′(SEQ ID NO.5)；
a downstream primer: 35S-mCICUC 2-R:
5′-CGGTGCCACTCTTCTTGAAC-3′(SEQ ID NO.6)。
respectively taking DNA of kanamycin-resistant plant tender leaves and wild-type plant tender leaves as templates, taking 35S-mCUC 2-F and 35S-mCUC 2-R as primers, carrying out PCR detection, and carrying out agarose gel electrophoresis detection and analysis on amplification products;
2) RNA level detection:
respectively extracting total RNA of plant leaves with kanamycin resistance and wild plant leaves, performing reverse transcription to form first-strand cDNA, establishing a fluorescent quantitative RT-PCR amplification system, and obtaining the delta C of each sample according to data analysisTCalculating the relative expression condition of each transgenic plant by taking the expression of the untransformed plant as a reference value, wherein the fragment amplified by the specific primer is 106bp, and the sequence of the primer is as follows:
an upstream primer mCMCUC 2-RT-F:
5′-CGGGTGGGACAGTGGTAAA-3′(SEQ ID NO.7)；
the downstream primer mCICUC 2-RT-R:
5′-GAGTCGAGCAATGGGGGTAG-3′(SEQ ID NO.8)。
using the gene fragment amplified by EF1 alpha as an internal reference gene, wherein the fragment length is 151bp, and the primer sequence:
the upstream primer EF1 alpha-F:
5′-TTTTGGTATCTGGTCCTGGAG-3′(SEQ ID NO.9)；
downstream primer EF1 alpha-R:
5′-CCATTCAAGCGACAGACTCA-3′(SEQ ID NO.10)。
the fifth purpose of the invention is to provide the gene CmCUC2, the gene mcuc2, the plant expression vector, or the genetic engineering application of the method for regulating and controlling chrysanthemum flower type and/or leaf shape and/or plant type by expressing the gene mcuc2 in the aspect of improving chrysanthemum flower type and/or leaf shape and/or plant type.
Further, the chrysanthemum flower type is changed into a rolling type, and the chrysanthemum petals are changed into outward turning and tip strip cracking; the shape of the chrysanthemum leaves is changed into the shape of deepened leaf cracks; the plant type of the chrysanthemum is changed into short and small type, and the internode distance is shortened.
Further, the gene engineering application in the aspects of improving the types of the cut chrysanthemum and the chrysanthemum pseudoflower and/or the leaf shape and/or the plant type.
A method for regulating chrysanthemum flower type and/or leaf shape and/or plant type by transferring mCICUC 2 gene specifically comprises the following detailed steps:
1. the chrysanthemum 'shenma' mCMCUC2 is obtained as shown in SEQ ID NO. 2:
artificially synthesizing a CmCUC2 gene sequence (mCMUC 2) with mutation of a binding site of miRNA164 according to sequence information (SEQ ID NO.1) of 'Neuma' CmCUC2, so that the gene sequence cannot be cut by the miRNA164, wherein the mCMUC 2 gene sequence is SEQ ID NO.2, connecting an mCMUC 2 sequence fragment with pMD19-T, transforming DH5 alpha competent cells, identifying a positive strain, and obtaining a positive plasmid pMD 19-T-mCMUC 2.
2. Construction of plant expression vector pBIG-mCICUC 2:
the plant expression vector pBIG-mCICUC 2 can be constructed by the following steps:
designing a specific primer of the mCIC 2 gene according to the full-length gene sequence of the mCIC 2, carrying out PCR reaction by using a high-fidelity enzyme by using a pMD 19-T-mCIC 2 plasmid as a template, and recycling glue to obtain an mCIC 2 gene fragment added with a restriction enzyme cutting site;
carrying out double enzyme digestion on the gene fragment and the plant expression vector pBIG by using restriction endonucleases XbaI and BamHI respectively;
recovering enzyme digestion products, connecting by using Solution I (Takara) DNA ligase, transforming the connection products into DH5 alpha competent cells, selecting single clones, carrying out PCR identification and sequencing to obtain positive strains, and extracting positive clone plasmids to obtain a plant expression vector pBIG-mCMCUC 2;
the specific primer of the mCICUC 2 gene is as follows:
mCmCUC2-XbaI-F：5'-GCTCTAGAATGGCGTATTTTAACCAACATT-3′(SEQ ID NO.3)，
mCmCUC2-BamHI-R：5'-CGGGATCCTCAGAAGCTCCAGATGCAAT-3′(SEQ ID NO.4)。
3. transferring the mCICUC 2 gene plant expression vector constructed in the step 2 into chrysanthemum 'Neuma' by an agrobacterium-mediated transformation method, and culturing, screening and detecting to obtain a positive strain:
transforming the plant expression vector pBIG-mCUC 2 constructed in the step 2 into agrobacterium competent cells (EHA105), identifying to obtain a positive strain, introducing mutated CmCUC2 into chrysanthemum by a leaf disc method, and subculturing on a screening medium added with kanamycin (kanamycin) to obtain a kanamycin-resistant plant. And then, detecting the kanamycin-resistant plants at the level of DNA and RNA, and screening out positive mCUC2 transgenic plants which are inserted with a mutated CmCUC2 sequence in the genome and can be expressed smoothly.
Specifically, the process of transferring the mutant sequence of the CmCUC2 gene into chrysanthemum by adopting agrobacterium-mediated transformation in the step 3 comprises the following steps:
using the electrotransfer method, 1. mu.L of pBIG-mCMCUC2 plasmid was added to 80. mu.L of Agrobacterium electrotransfer competent cells (EHA105), mixed well, and added to an electrotransfer cup. And adjusting the voltage of the electric rotating instrument to 2.2Kv to perform electric rotation. Culturing at 28 deg.C and 150r/min for 2 hr, plating, selecting positive clone, and performing PCR identification to obtain positive strain.
Selecting top unfolded leaves of the 'shenma' tissue culture seedlings (4-5 weeks), cutting into leaf discs with the square size of 0.5cm by using an operating knife to serve as transformation receptors, and pre-culturing for 2-3 days.
The obtained pBIG-mCicCUC 2 positive strain was inoculated into YEB liquid medium (containing 50. mu.g/mL rifampicin + 50. mu.g/mL kanamycin), cultured at 200rpm at 28 ℃ to OD 0.6-0.8. Centrifuging, removing supernatant, resuspending the precipitate with an equal volume of MS suspension (pH 5.8), immersing the pre-cultured leaf disc into the agrobacterium liquid for 8-10min, sucking dry the surface bacterial liquid of the leaf disc with filter paper, inoculating the leaf disc onto a co-culture medium for dark culture for 2-3 d, transferring the leaf disc into a decarboxylation culture medium (containing carbenicillin) for decarboxylation culture for one week, and then transferring the leaf disc into a screening culture medium (containing kanamycin) for subculture. And transferring the differentiated resistant buds to a rooting culture medium (containing kanamycin) for culture when the resistant buds grow to 2-3 cm, and primarily screening to obtain resistant plants.
Specifically, the method for improving chrysanthemum flower type, leaf shape and plant type by transforming mCUC2 gene comprises the following steps of (3) detecting the resistant plant preliminarily obtained by transforming mCUC2 gene on DNA and RNA level, screening positive plant, obtaining transgenic chrysanthemum:
(1) DNA level detection
Taking tender leaves of a plant with kanamycin resistance and tender leaves of a wild plant obtained by rooting culture screening, extracting genome DNA, selecting a rear half-segment sequence of a 35S promoter and a front 400bp sequence of mCUC2 as detection targets, wherein the length of an amplified fragment is 552bp, and the primer sequences are as follows:
35S-mCmCUC2-F：5'-GACGCACAATCCCACTATCC-3′(SEQ ID NO.5)；
35S-mCmCUC2-R：5′-CGGTGCCACTCTTCTTGAAC-3′(SEQ ID NO.6)。
respectively taking the resistant strain genome DNA and the wild type plant genome DNA as templates, taking 35S-mCUC 2-F and 35S-mCUC 2-R as upstream and downstream primers for PCR detection, and carrying out agarose gel electrophoresis detection analysis on PCR products; the positive plants should obtain a product with the length of 552bp, and the negative plants have no amplification product.
(2) RNA level detection
Extracting total RNA from kanamycin-resistant plant leaves and wild plant leaves, performing reverse transcription to obtain cDNA, performing real-time fluorescent quantitative RT-PCR detection, taking EF1 alpha as reference gene, and analyzing according to data to obtain delta C of each sampleTAnd (4) calculating the relative expression condition of the CmCUC2 gene in each transgenic strain by taking the expression quantity of the wild plant as a reference value. The CmCUC2 gene specific amplification fragment is 106bp, and the primer sequence is as follows:
mCmCUC2-RT-F：5′-CGGGTGGGACAGTGGTAAA-3′(SEQ ID NO.7)；
mCmCUC2-RT-R：5′-GAGTCGAGCAATGGGGGTAG-3′(SEQ ID NO.8)。
EF1 alpha is used as an internal reference gene, the length of a specific amplification fragment is 151bp, and the primer sequence:
EF1α-F：5'-TTTTGGTATCTGGTCCTGGAG-3'(SEQ ID No.9)；
EF1α-R：5'-CCATTCAAGCGACAGACTCA-3'(SEQ ID No.10)。
specifically, the method for improving chrysanthemum flower type, leaf shape and plant height by transferring the mCICUC 2 gene comprises the following steps of observing the phenotype of obtained transgenic plant progeny:
cutting seedlings of wild chrysanthemum (WT) and transgenic chrysanthemum (OX-mCMCUC2) are planted as a material for phenotype observation, and 20 plants are planted in each strain. In the growth period (50 days for field planting), observing and counting the leaf shape and the plant height of each strain; and in the full-bloom stage, observing and recording the flower type change of each strain.
The technical scheme of the invention has the following advantages:
the method provided by the invention selects and breeds transgenic chrysanthemum materials, and integrates the mCICUC 2 gene into the chrysanthemum genome by adopting a transgenic technology. Through phenotypic observation and analysis, the obtained transgenic chrysanthemum has the following characteristics compared with the wild type: the petals are outward turned, the tips of the petals are cracked, the flower shape is in a rolling shape, the leaf cracks are deepened, and the plant becomes short. Therefore, the mCUC2 gene introduced into the genome of the chrysanthemum by the method can obviously change the flower type, the leaf shape and the plant height of the chrysanthemum at the same time, and can be widely applied to the aspects of cultivation of cut chrysanthemum, chrysanthemum indicum and the like.
Drawings
FIG. 1 shows the identification of chrysanthemum transformed with CmCUC2 gene in example 4
FIG. 1A electrophoresis diagram for detecting specific primers
M：DL 2000Marker；
WT: a wild-type plant;
OX-mCICUC 2-8#, OX-mCICUC 2-9 #: the strain is the strain transformed with mCMCUC 2.
FIG. 1B relative expression levels of CmCUC2 gene in transgenic and non-transgenic Chrysanthemum plants
WT: a wild-type plant;
OX-mCICUC 2-8#, OX-mCICUC 2-9 #: the strain transformed with mCICUC 2.
FIG. 2 phenotypic observations and statistics of transgenic Chrysanthemum plant leaf shapes
WT: a wild-type plant;
OX-mCICUC 2-8#, OX-mCICUC 2-9 #: a strain transformed with mCICUC 2;
FIG. 2A growth period (50 days for permanent planting), OX-mCMCUC2 strain leaf shape observation;
in the growth period (50 days of permanent planting) of FIG. 2B, statistics are given on the depth of the lowest first stage crack of the OX-mCICUC 2 leaf blades.
FIG. 3 phenotypic observations and statistics of plant height of wild-type and transgenic chrysanthemum plants in example 5.
WT: a wild-type plant;
OX-mCICUC 2-8#, OX-mCICUC 2-9 #: a strain transformed with mCICUC 2;
FIG. 3A shows the growth period (50 days for permanent planting) and the plant height;
FIG. 3B growth period (50 days for permanent planting), plant height statistics;
FIG. 3C growth period (50 days of colonization), internode length statistics.
FIG. 4 observation of flower and petal type of transgenic chrysanthemum plant
WT: a wild-type plant;
OX-mCICUC 2-8#, OX-mCICUC 2-9 #: the strain transformed with mCICUC 2.
The specific implementation mode is as follows:
the following describes in detail specific working examples of the invention: the embodiment is effectively implemented on the premise of the technical research scheme of the invention, a detailed implementation teaching mode and a specific operation process are provided, and the specific implementation management mode method comprises the following steps:
example 1 Synthesis of mCicUC 2, construction of Positive plasmid pMD 19-T-mCicUC 2
Artificially synthesizing a mutant CmCUC2 gene sequence (mCMCUC2) according to sequence information (SEQ ID NO.1) of 'Neuma' CmCUC2, under the premise that an amino acid sequence is not changed, enabling the mutant CmCUC2 gene sequence not to be cut by miRNA164, obtaining a target gene sequence of SEQ ID NO.2, connecting an obtained product with PMD19-T, transforming DH5 alpha competent cells, identifying to obtain a positive strain, and extracting a positive plasmid pMD19-T-mCMCUC2 by using a plasmid extraction kit (GeneJET plasmid minikit, Thermo, the detailed operation of which is described in kit instructions).
Example 2 construction of plant expression vector pBIG-mCICUC 2
Designing mCMUC 2 gene specific primers according to the full-length gene sequence of mMCUC 2, respectively introducing enzyme cutting sites XbaI and BamHI at the upstream and downstream of a target gene mMCUC 2, and carrying out PCR reaction, wherein the mMCUC 2 gene specific primers have the following sequences:
mCmCUC2-XbaI-F：5′-GCTCTAGAATGGCGTATTTTAACCAACATT-3′(SEQ ID NO.3)；
mCmCUC2-BamHI-R：5′-CGGGATCCTCAGAAGCTCCAGATGCAAT-3′(SEQ ID NO.4)。
pMD 19-T-mCICUC 2 was used as a template, and high fidelity enzyme (Phusion) was usedTMHigh-Fidelity DNA Polymerase, Thermo) was performed in a reaction system of 50. mu.L: 5 XPisuion HF PCR buffer 10u L, mCMCUC2-XbaI-F, mCmCUC2-BamHI-R primers (10u mol. L-1) each 1.0 u L, dNTP mix 1 u L (10 mmol. L-1), PhusionTM0.5 mu L of High-Fidelity DNA Polymerase, 3 mu L of plasmid template, 1.5 mu L of DMSO, and 29 mu L of ddH2O 29; the reaction was carried out as follows: pre-denaturation at 98 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 1min, reaction for 35 cycles, and extension at 72 ℃ for 10 min; and (4) performing agarose gel electrophoresis detection, cutting a target band, and recovering the target band by using a gel recovery kit (GeneJET gel recovery kit, Thermo, see kit specification for details of operation).
The recovered PCR product and the plant overexpression vector pBIG were digested simultaneously with restriction enzymes XbaI and BamHI, and the reaction system was 50. mu.L: quickcutTM XbaI(10U/μL，TaKaRa)2.5μL，QuickCutTMBamHI (10U/. mu.L, TaKaRa) 2.5. mu.L, 10 XFastdigest Buffer 5. mu.L, PCR product/pBIG vector 20. mu.L, ddH2O 20. mu.L; performing enzyme digestion reaction for 90min at 37 ℃ in a metal bath, detecting by agarose gel electrophoresis, and recovering the enzyme digestion product.
Fully connecting the recovered products by using Solution I (Takara) DNA ligase at 16 ℃ for 6 hours in a metal bath, transforming DH5 alpha competent cells, selecting a monoclonal strain, carrying out PCR identification to obtain a positive strain, extracting a plasmid, and successfully constructing a plant expression vector pBIG-mCICUC 2.
Example 3 transformation of Chrysanthemum by Agrobacterium EHA105 mediated leaf disc method
The plasmid pBIG-mCICUC 2 was transformed into Agrobacterium-infected competent cells (EHA105) by electroporation. Washing the electric rotary cup (0.1cm or 0.2cm) with bottle for 3 times before use, soaking in 70% ethanol for 3-5min, and drying with superclean bench. In a clean bench, 1 uL of pBIG-mCICUC 2 plasmid (the concentration of the plasmid is more than 100 ng/uL, only 0.5 uL) +80 uL of competence is needed to be added, and the mixture is gently stirred and homogenized. Add the ready electric rotor. The electric transfer instrument carries out electric transfer: the voltage was adjusted to 2.20 kv. The time is between 4ms and 6ms, the electric rotating cup is quickly placed in a super clean bench, 600 mu L YEB is added, the electric rotating cup is slightly sucked and beaten, the liquid in the electric rotating cup is transferred into a 1.5ml centrifuge tube, the centrifuge tube is placed in a shaking table at the temperature of 28 ℃ and at the speed of 150r/min, and 50 mu L of coating plate is taken after 2 hours. Selecting monoclonal strains, detecting, and selecting positive strains for converting chrysanthemum.
Cut chrysanthemum 'shenma' leaves are used as explants, and the CmCUC2 gene is overexpressed in chrysanthemum by an agrobacterium-mediated method. The leaves are unfolded from the top of the chrysanthemum 'shenma' tissue culture seedling, and the chrysanthemum 'shenma' tissue culture seedling is cut into a leaf disc with the square size of 0.5cm by a scalpel to be used as a transformation receptor and is pre-cultured in a pre-culture medium for 3 d. The above-mentioned positive strain (pBIG-mCICUC 2 transformed) was inoculated into YEB liquid medium (containing 50. mu.g/mL rifampicin + 50. mu.g/mL kanamycin), cultured at 200rpm at 28 ℃ until OD value was 0.6-0.8.
Centrifuging the agrobacterium liquid at 5000rpm and 28 deg.c for 20 min. The pellet was resuspended with an equal volume of MS suspension (sterile, pH 5.8). Immersing the pre-cultured leaf disc into the prepared agrobacterium liquid for soaking for 8-10min, sucking the liquid dry by using filter paper, inoculating the liquid dry to a co-culture medium for dark culture for 3d, then transferring to a decarboxylation culture medium, performing decarboxylation culture for one week, transferring to a screening culture medium, transferring to a rooting culture medium for culture when the differentiated resistant bud grows to 2-3 cm, and rooting about one week of positive seedlings to obtain resistant plants preliminarily.
The culture medium for genetic transformation of chrysanthemum is based on MS culture medium, and is sterilized for 30 minutes at the temperature of 100Kpa and 116 ℃ with the pH value of 5.8; pre-culture medium: MS + 6-benzylaminopurine (6-BA)1mg/L + naphthylacetic acid (NAA)0.5 mg/L; co-culture medium: MS + 6-benzylaminopurine (6-BA)1mg/L + naphthylacetic acid (NAA)0.5 mg/L; decarboxylation medium: MS + 6-benzylaminopurine (6-BA)1mg/L + naphthylacetic acid (NAA)0.5mg/L + carbenicillin (Carb)500 mg/L; screening a culture medium: MS + kanamycin (Kan)10mg/L + carbenicillin (Carb)350mg/L + 6-benzylaminopurine (6-BA)1mg/L + naphthylacetic acid (NAA)0.1 mg/L; rooting culture medium: MS + kanamycin (Kan)8 mg/L.
Example 4 detection of DNA and RNA levels in kanamycin-resistant plants obtained CmCUC2 over-expression positive lines, named OX-mCUC2-n
1) DNA level detection
Taking kanamycin-resistant plant tender leaves and untransformed plant tender leaves obtained by rooting screening, extracting genome DNA (plant genome DNA rapid extraction reagent, Shanghai Pudi biotechnology), selecting a later half segment sequence of a 35S promoter and a former 400bp sequence of mCIC 2 as detection targets, wherein the length of an amplified fragment is 552bp, and the primer sequence is as follows:
35S-mCmCUC2-F：5'-GACGCACAATCCCACTATCC-3′(SEQ ID NO.5)；
35S-mCmCUC2-R：5′-CGGTGCCACTCTTCTTGAAC-3′(SEQ ID NO.6)。
respectively taking a kanamycin-resistant plant as a template, taking a positive plasmid as a positive control, taking an untransformed plant as a negative control, and taking 35S-mCUC 2-F and 35S-mCUC 2-R as primers, and carrying out PCR detection, wherein the reaction system is 25 mu L: DNA template 1. mu.L, 10 XPCR Buffer 5. mu.L, dNTP (2.5Mm) 2. mu.L, 1.5. mu.L MgCl2(2.5 mmol. mu.L-1), 0.2. mu.L of Taq enzyme (5U. mu.L-1), 1. mu.L of 35S-mCUC 2-F and 35S-mCUC 2-R (10. mu. mol. mu.L-1) respectively, and sterilized deionized water to make up the volume to 25. mu.L.
The amplification conditions were: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 45s, extension at 72 ℃ for 1min, and 35 cycles; extension at 72 ℃ for 10 min. The amplified products were analyzed by agarose gel electrophoresis (FIG. 1A). As can be seen in fig. 1A, the CmCUC2 transgenic plants all amplified a specific band of the same length as the positive control using pBIG-mccuc 2 plasmid as template, while the wild type plants did not.
2) RNA level detection
Selecting leaf blades with the same parts of kanamycin resistant plants and wild plants with similar growth vigor, extracting total RNA (rapid universal plant RNA extraction kit, Hua-Yuanyang), and performing reverse transcription to obtain cDNA (PrimeScript)TMRT reagent Kit with gDNA Eraser Kit, Takara), using EF1 alpha gene as reference gene, detecting the expression level of CmCUC2 gene of different strains by fluorescent quantitative RT-PCR. The CmCUC2 gene specific amplification fragment is 106bp, and the primer sequence is as follows:
mCmCUC2-RT-F：5′-CGGGTGGGACAGTGGTAAA-3′(SEQ ID NO.7)；
mCmCUC2-RT-R：5′-GAGTCGAGCAATGGGGGTAG-3′(SEQ ID NO.8)。
using the gene fragment amplified by EF1 alpha as an internal standard, wherein the fragment length is 151bp, and the primer sequence is as follows:
EF1α-F：5'-TTTTGGTATCTGGTCCTGGAG-3'(SEQ ID No.9)；
EF1α-R：5'-CCATTCAAGCGACAGACTCA-3'(SEQ ID No.10)。
according to the fluorescent quantitation kit (TB)
Premix Ex TaqTMII, TaKaRa) instructions to set up the reaction system: TB
Premix Ex TaqTMII 10. mu.L, cDNA 0.5. mu.L, mCUC2-RT-F and mCUC2-RT-R (2. mu. mol. L-1), each 2. mu.L, ddH2O 5.5.5. mu.L. Amplification conditions: pre-denaturation: 30s at 95 ℃; PCR reaction (40 Cycles): 5s at 95 ℃ and 30s at 60 ℃; dissolution curve analysis: 95 ℃ for 10s, 60 ℃ for 5s and 95 ℃ for 5 s. Setting 3 biological repetitions for each sample, setting 3 technical repetitions for each biological repetition, and calculating to obtain Δ C of each sampleTAnd (3) calculating the relative expression condition of the CmCUC2 gene in each transgenic plant by taking the expression level of the wild plant as a reference value.
Compared with the wild type, according to the RT-PCR detection result (figure 1B), the CmCUC2 gene expression level in the transgenic strains OX-mCUC 2-8# and OX-mCUC 2-9# is obviously increased. It was confirmed that the CmCUC2 gene had been introduced into the cut chrysanthemum genomic DNA and successfully expressed.
Example 5 phenotypic Observation of progeny of transgenic plants
Wild chrysanthemum (WT) and transgenic chrysanthemum (OX-mCMCUC2) are subjected to cuttage and planting in a greenhouse and used as materials for phenotype observation. And (5) observing and counting the leaf shape and the plant height of the transgenic plant line in the growth period (50 days for permanent planting). In the bud stage, other side buds except the top buds are removed by wiping. And in the full-bloom stage, observing the change of the transgenic chrysanthemum strain in the flower type.
Leaf shape aspect: plants in the growth period (50 days of permanent planting) were selected as observation targets, and compared with Wild Type (WT), the transgenic lines OX-mCMUC 2-8#, OX-mCMUC 2-9# have deeper leaf edge inward rolling and leaf splitting (FIG. 2A). Furthermore, leaf crack degree is counted, the ten-fold expanded leaf from the top leaf of each 12 wild chrysanthemum (WT) and transgenic lines is taken as a statistical object, the lowest level first crack depth is selected as a statistical index, and the leaf crack depth is reflected by measuring the horizontal length from the lowest level first crack to the main leaf. The smaller the measurement result is, the deeper the crack is; the larger the measurement, the shallower the crack and the conclusion is drawn: the average value of the horizontal length from the lowest level of a wild type plant (WT) to a main vein is 1.09 cm; the average horizontal lengths of the main veins from the lowest first stage crack of OX-mCMUC 2-8# and OX-mCMUC 2-9# are respectively 0.47cm and 0.50cm, which are all below 0.5 times of that of the wild type strain (figure 2B). Independent sample T test is carried out by using SPSS software to find that the wild type and the transgenic strain have extremely significant difference in the leaf crack degree.
Plant type aspect: selecting plants in the growth period (50 days for planting) as observation objects, wherein the plants in the transgenic lines OX-mCMCUC2-8# and OX-mCMCUC2-9# are shorter and smaller compared with Wild Type (WT) (figure 3A); furthermore, the plant heights of 12 strains of wild chrysanthemum (WT) and transgenic lines were measured and counted, and the average plant height of 61.73cm for wild chrysanthemum and 21.27cm and 19.55cm for transgenic lines OX-mCUC 2-8# and 9# respectively were found (FIG. 3B). Independent sample T test is carried out by using SPSS software to find that wild type and transgenic lines have very significant difference in plant height. Furthermore, 12 wild chrysanthemum (WT) and transgenic strains are selected, the internode distance is measured and counted, compared with the wild chrysanthemum (WT), the internode distance of the transgenic strains OX-mCUC 2-8# and OX-mCUC 2-9# is shortened, and the average internode distance of the transgenic strains OX-mCUC 2-8# and OX-mCUC 2-9# is 0.78cm, and 0.79cm is obviously lower than 1.54cm of the wild chrysanthemum (figure 3C).
And (3) in the aspect of pattern: the dominant-flowering transgenic plant is selected as an observation object, the wild chrysanthemum (WT) inflorescence is in a lotus-base shape as a whole, and the transgenic strains OX-mCMUC 2-8# and OX-mCMUC 2-9# inflorescence are in a rolling shape as a whole. Compared with the Wild Type (WT) petal flat and introversion, the transgenic strains OX-mCMUC 2-8#, OX-mCMUC 2-9# petal flat, straight or everted and the tip is cracked like a crack (figure 4).
It will be understood that the above-described embodiments are merely illustrative of the principles of the invention, which is not limited thereto, and that various modifications and changes can be made by those skilled in the art without departing from the spirit of the invention, which also falls within the scope of the invention.
Sequence listing
<110> Nanjing university of agriculture
<120> method for regulating and controlling chrysanthemum flower type and/or leaf shape and/or plant type and application
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1014
<212> DNA
<213> Chrysanthemum 'Neuma' (Chrysanthemum x morifolia 'jinba')
<400> 1
atggcgtatt ttaaccaaca ttttgataac aatgaagctt gtttgccacc agggtttagg 60
tttcatccca ctgatgaaga gcttattact tgttaccttt taaggaaagt gcttgatggt 120
agcttcactg gtcgagcttt tgctgatgtg gatcttaaca aatgtgaacc atgggagctt 180
cctcaaaggg caaagatggg ggagaaagaa tggtactttt tcagtctccg tgaccgaaag 240
tacccgactg ggttacgaac taaccgcgca accgaggcag ggtactggaa ggccacggga 300
aaagaccgag aaatctatag ctcaaagaca tcggctttag tggggatgaa gaaaacccta 360
gttttctacc gtgggagagc accaaaagga gaaaagacaa attgggttat gcatgaatat 420
cgtcttgaag gaaaatttgc ttaccatttt ttatccaaaa gctcaaagga cgaatgggtg 480
atctcacgtg tgttcaagaa gagtggcacc ggagccgcgg gtgggacagt ggtaaaaaaa 540
tggctcacgg gtggcacagg ccacactaaa gaagtgagct gctcatcggg agtatcggga 600
tcgctacccc cattgctcga ctcatcgctc tatgcttcgg ccacatccgc ctacaccgcg 660
gagcgtgaaa gcttctccta cgacagcaac acggtttcaa aagagcacgt gccctgtttc 720
tccacagcct caaccaccaa ctttggtcat ccaaaccttt tcgacttccc gccaccagaa 780
cctttaacaa ctacatcttt tgaaacaaag aacatttgtg tttcggcatt tcctagtttg 840
aggacactac aagagaatct ccagatgcct ttcttttact cctccgtggt tccggtgccc 900
aatgcaggca gcaacaacgg aggagaaaca agcaactacg tgggttccag ttcgactagt 960
gagaactacc agaaaccggg acccacggag cttgattgca tctggagctt ctga 1014
<210> 2
<211> 1014
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
atggcgtatt ttaaccaaca ttttgataac aatgaagctt gtttgccacc agggtttagg 60
tttcatccca ctgatgaaga gcttattact tgttaccttt taaggaaagt gcttgatggt 120
agcttcactg gtcgagcttt tgctgatgtg gatcttaaca aatgtgaacc atgggagctt 180
cctcaaaggg caaagatggg ggagaaagaa tggtactttt tcagtctccg tgaccgaaag 240
tacccgactg ggttacgaac taaccgcgca accgaggcag ggtactggaa ggccacggga 300
aaagaccgag aaatctatag ctcaaagaca tcggctttag tggggatgaa gaaaacccta 360
gttttctacc gtgggagagc accaaaagga gaaaagacaa attgggttat gcatgaatat 420
cgtcttgaag gaaaatttgc ttaccatttt ttatccaaaa gctcaaagga cgaatgggtg 480
atctcacgtg tgttcaagaa gagtggcacc ggagccgcgg gtgggacagt ggtaaaaaaa 540
tggctcacgg gtggcacagg ccacactaaa gaagtgagct gctcatcggg agtatcggga 600
tcgctacccc cattgctcga ctcatcgctc tatgcttcgg ccacatccgc ctacaccgcg 660
gagcgtgaaa gcttctccta cgacagcaac acggtttcaa aagagcatgt accatgtttt 720
agtacagcct caaccaccaa ctttggtcat ccaaaccttt tcgacttccc gccaccagaa 780
cctttaacaa ctacatcttt tgaaacaaag aacatttgtg tttcggcatt tcctagtttg 840
aggacactac aagagaatct ccagatgcct ttcttttact cctccgtggt tccggtgccc 900
aatgcaggca gcaacaacgg aggagaaaca agcaactacg tgggttccag ttcgactagt 960
gagaactacc agaaaccggg acccacggag cttgattgca tctggagctt ctga 1014
<210> 3
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gctctagaat ggcgtatttt aaccaacatt 30
<210> 4
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
cgggatcctc agaagctcca gatgcaat 28
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gacgcacaat cccactatcc 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
cggtgccact cttcttgaac 20
<210> 7
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
cgggtgggac agtggtaaa 19
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
gagtcgagca atgggggtag 20
<210> 9
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
ttttggtatc tggtcctgga g 21
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
ccattcaagc gacagactca 20
Claims (13)
1. Gene related to chrysanthemum flower type and/or leaf shape and/or plant typeCmCUC2Characterized in that the geneCmCUC2The nucleotide sequence of (A) is shown in SEQ ID NO. 1.
2. Gene related to chrysanthemum flower type and/or leaf shape and/or plant typemCmCUC2Characterized in that the genemCmCUC2The nucleotide sequence of (A) is shown in SEQ ID NO. 2.
3. A plant expression vector, whichCharacterized in that the plant expression vector comprises the gene of claim 2mCmCUC2。
4. The plant expression vector of claim 3, wherein the plant expression vector is the vector of claim 2mCmCUC2And connecting to an overexpression vector.
5. The plant expression vector of claim 4, wherein the base vector of the over-expression vector is a pBIG over-expression vector.
6. By expressionmCmCUC2A method for gene regulation of chrysanthemum flower type and/or leaf shape and/or plant type, which is characterized by comprising the following steps: (1) obtaining the gene shown in SEQ ID NO.2mCmCUC2Construction of the positive plasmid pMD19-T-mCmCUC2；
(2) Construction of the plant expression vector pBIG-mCmCUC2: the plant expression vector pBIG-mCmCUC2The basic vector is a pBIG over-expression vector, and the plant expression vector is pBIG-mCmCUC2Comprises a nucleotide sequence shown as SEQ ID NO.2mCmCUC2A gene sequence;
(3) adopting an agrobacterium-mediated method to express the plant expression vector pBIG-mCmCUC2Transferring into chrysanthemum, culturing and detecting to obtain positive strain.
7. The method for regulating chrysanthemum flower type and/or leaf shape and/or plant type according to claim 6, wherein the step (1)
The gene shown as SEQ ID NO.2mCmCUC2The obtaining method comprises the following steps: ' Shenma ' according to SEQ ID NO.1 'CmCUC2Sequence information, mutation of the binding site of miRNA164, and artificial synthesis of the amino acid sequence shown in SEQ ID NO.2mCmCUC2Gene sequence, connecting the obtained product with pMD19-T, transforming DH5 alpha competent cell, identifying positive strain, obtaining positive plasmid pMD19-T-mCmCUC2。
8. According to claim 6The method for regulating and controlling chrysanthemum flower type and/or leaf shape and/or plant type is characterized in that the plant expression vector pBIG-mCmCUC2 was constructed by the following steps:
according tomCmCUC2Full Length Gene sequence designmCmCUC2Gene specific primers, pMD19-T-mCmCUC2Using high-fidelity enzyme to carry out PCR reaction as a template, and recycling glue to obtain the product added with enzyme cutting sitesmCmCUC2A gene fragment;
the restriction enzymes XbaI and BamHI added with the cleavage sites were used respectivelymCmCUC2Carrying out double enzyme digestion on the gene fragment and a plant expression vector pBIG;
recovering the enzyme digestion product, using ligase to connect, transforming DH5 alpha competent cells, identifying to obtain a positive strain, extracting a positive clone plasmid, and obtaining a plant expression vector pBIG-mCmCUC2；
The above-mentionedmCmCUC2The gene specific primers are as follows:
an upstream primer:mCmCUC2-XbaI-F：5'-GCTCTAGAATGGCGTATTTTAACCAACATT-3′（SEQ ID NO.3）；
a downstream primer:mCmCUC2-BamHI-R：5'-CGGGATCCTCAGAAGCTCCAGATGCAAT-3′（SEQ ID NO.4）。
9. the method for regulating chrysanthemum flower type and/or leaf shape and/or plant type according to claim 6, wherein the step (3) comprises the following steps: the plant expression vector pBIG-mCmCUC2Transforming agrobacterium EHA105 competent cell, identifying to obtain positive strain, and culturing by agrobacterium-mediated leaf disc methodmCmCUC2Introducing chrysanthemum, transferring the chrysanthemum to a screening culture medium added with kanamycin for subculture to obtain kanamycin-resistant plants; DNA and RNA level detection is carried out on kanamycin-resistant plants, and genome insertion is screened outmCmCUC2Positive transcription capable of being expressed smoothlymCmCUC2And (4) gene plants.
10. The method for regulating chrysanthemum flower shape and/or leaf shape and/or plant type according to claim 9, wherein the chrysanthemum variety is 'shenma'.
11. The method for regulating chrysanthemum flower shape and/or leaf shape and/or plant type according to claim 9, wherein the DNA and RNA level detection process for kanamycin-resistant plants comprises the following steps:
1) and (3) DNA level detection: taking tender leaf of plant with kanamycin resistance and wild plant tender leaf obtained by root screening, extracting genome DNA, adding a segment of sequence of 35S promoter andmCmCUC2a sequence of (5) as a detection target, in the 35S promoter andmCmCUC2primers are designed at two ends, the length of the amplified fragment is 552bp, and the sequence of the primers is as follows:
an upstream primer: 35S-mCmCUC2-F：5'-GACGCACAATCCCACTATCC-3′（SEQ ID NO.5）；
A downstream primer: 35S-mCmCUC2-R：5′-CGGTGCCACTCTTCTTGAAC-3′（SEQ ID NO.6）；
Respectively taking DNA of the young leaf of the kanamycin-resistant plant and the young leaf of the wild-type plant as templates and taking 35S-mCmCUC2-F and 35S-mCmCUC2the-R is a primer, PCR detection is carried out, and an amplification product is subjected to agarose gel electrophoresis detection analysis;
2) RNA level detection:
respectively extracting total RNA of plant leaves with kanamycin resistance and wild plant leaves, performing reverse transcription to form first-strand cDNA, establishing a fluorescent quantitative RT-PCR amplification system, and obtaining the delta C of each sample according to data analysisTCalculating the relative expression condition of each transgenic plant by taking the expression of the untransformed plant as a reference value, wherein the fragment amplified by the specific primer is 106bp, and the sequence of the primer is as follows:
upstream primermCmCUC2-RT-F：5′-CGGGTGGGACAGTGGTAAA-3′（SEQ ID NO.7）；
Downstream primermCmCUC2-RT-R：5′- GAGTCGAGCAATGGGGGTAG -3′（SEQ ID NO.8）；
To be provided withEF1αThe amplified gene fragment is an internal reference gene, the fragment length is 151bp, and the primer sequence:
upstream primerEF1α-F：5′-TTTTGGTATCTGGTCCTGGAG-3′（SEQ ID NO. 9）；
Downstream primerEF1α-R：5′-CCATTCAAGCGACAGACTCA-3′（SEQ ID NO. 10）。
12. The gene according to claim 1CmCUC2Or the gene of claim 2mCmCUC2，Or the plant expression vector of claim 3, or the expression vector of claim 6mCmCUC2The gene regulation method of chrysanthemum flower shape and/or leaf shape and/or plant type is applied in improving chrysanthemum flower shape and/or leaf shape and/or plant type.
13. The use of claim 12, wherein the chrysanthemum flower type is changed to a rolled type, the chrysanthemum petals are changed to everted, tip-striped; the shape of the chrysanthemum leaves is changed into the shape of deepened leaf cracks; the plant type of the chrysanthemum is changed into short and small type, and the internode distance is shortened.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010912874.XA CN111961677B (en) | 2020-09-02 | 2020-09-02 | Method for regulating and controlling chrysanthemum flower type and/or leaf shape and/or plant type and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010912874.XA CN111961677B (en) | 2020-09-02 | 2020-09-02 | Method for regulating and controlling chrysanthemum flower type and/or leaf shape and/or plant type and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111961677A CN111961677A (en) | 2020-11-20 |
| CN111961677B true CN111961677B (en) | 2022-03-25 |
Family
ID=73393486
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010912874.XA Active CN111961677B (en) | 2020-09-02 | 2020-09-02 | Method for regulating and controlling chrysanthemum flower type and/or leaf shape and/or plant type and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111961677B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114875039B (en) * | 2022-05-09 | 2023-05-02 | 南京农业大学 | Method for creating chrysanthemum with sweet osmanthus flower |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105671056A (en) * | 2016-03-09 | 2016-06-15 | 南京农业大学 | Method for regulating and controlling growth of chrysanthemum petals through conversion of CmTCP20 gene |
| CN111197049A (en) * | 2020-01-13 | 2020-05-26 | 南京农业大学 | Method for creating dwarf plant type chrysanthemum |
-
2020
- 2020-09-02 CN CN202010912874.XA patent/CN111961677B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105671056A (en) * | 2016-03-09 | 2016-06-15 | 南京农业大学 | Method for regulating and controlling growth of chrysanthemum petals through conversion of CmTCP20 gene |
| CN111197049A (en) * | 2020-01-13 | 2020-05-26 | 南京农业大学 | Method for creating dwarf plant type chrysanthemum |
Non-Patent Citations (1)
| Title |
|---|
| MicroRNA and Putative Target Discoveries in Chrysanthemum Polyploidy Breeding;Fengjiao Zhang等;《International Journal of Genomics》;20171213;第2017卷;Article ID 6790478 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111961677A (en) | 2020-11-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2006029076A2 (en) | Plant-specific genetic elements and transfer cassettes for plant transformation | |
| US20130254932A1 (en) | Plant gene expression modulatory sequences from maize | |
| CN110964743B (en) | Method for editing and creating rice amylose content variation by using promoter | |
| CN110903368B (en) | Gene for controlling female character of corn, kit for creating female sterile line of corn, mutant genotype and method | |
| CN111961677B (en) | Method for regulating and controlling chrysanthemum flower type and/or leaf shape and/or plant type and application | |
| CN112500463B (en) | Gene ZmCOL14 for controlling plant height and ear position height of corn and application thereof | |
| CN109112227A (en) | Rape bloom key gene as the rape ecotype improvement and Mature breeding molecular labeling and application | |
| CN110204600B (en) | BnSPL14 gene, protein and application thereof in controlling cabbage type rape plant type | |
| CN108165578B (en) | Efficient preparation method for mutant aiming at multiple members of same gene family of cabbage mustard simultaneously | |
| CN110878302A (en) | Method for knocking out Brassica napus Bna. TT8 gene by using CRISPR/Cas9 system and application | |
| CN105695479B (en) | Chrysanthemum symmetry gene CmCYC2c and application thereof | |
| JP2001161373A (en) | New promoter sequence and its use | |
| CN112646015B (en) | Gene and method for changing flowering period of corn | |
| JP3782013B2 (en) | Improved promoter and use thereof | |
| CN114958866B (en) | Gene for regulating soybean branch number and application thereof | |
| CN111575286B (en) | Corn pollen specific promoter and application thereof | |
| CN110229801B (en) | Gene for controlling rice leaf senescence and protein coded by same | |
| CN113136388B (en) | Application of rice OsMAPKKK5 gene in aspect of improving plant height and grain type of rice | |
| CN112194713B (en) | Protein FSE5 related to rice endosperm starch granule development and encoding gene and application thereof | |
| CN117025593A (en) | Picea dominance expression promoter and application thereof | |
| CA2274871C (en) | Plant promoter | |
| CN116813734A (en) | OsEF1A protein, encoding gene and application thereof in promoting rice tillering | |
| CN114875039A (en) | Method for creating sweet osmanthus flower-shaped chrysanthemum | |
| CN115927278A (en) | Protein related to sweet potato gamma-aminobutyric acid metabolism and coding gene and application thereof | |
| CN116042613A (en) | Application of long-chain non-coding RNA gene LAIR alternative splicing of rice |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |