CN116042613A - Application of long-chain non-coding RNA gene LAIR alternative splicing of rice - Google Patents

Abstract

The invention belongs to the technical field of gene breeding, and particularly relates to application of alternative splicing of a long-chain non-coding RNA gene LAIR of rice, wherein an alternative splicing subtype of the long-chain non-coding RNA gene LAIR of the rice or a functional equivalent thereof has the purpose of improving rice yield traits, and finally, the plant height and/or the total grain number of main spikes of positive transgenic rice strains obtained through screening are improved to different degrees.

Description

Application of long-chain non-coding RNA gene LAIR alternative splicing of rice

Technical Field

The invention belongs to the technical field of gene breeding, and particularly relates to application of long-chain non-coding RNA gene LAIR alternative splicing of rice.

Background

Rice is one of the most important food crops in the world, and more than 30 hundred million people worldwide depend on rice as main ration. In view of the problems of environmental climate change, population expansion and the like, it is estimated that the rice needs to be increased by 40% to meet the demands in 2030 year, and the yield-increasing property of the rice is always a key field of crop genetic breeding. With the development of molecular genetics and genomics, more and more biological macromolecules are identified, the forefront new discovery is used for rice molecular genetic breeding, genetic resources are excavated for yield increase of crops, and planting reserves are provided for future grain safety.

In recent years, a significant finding of genomics research has been that the higher biological genome has a large amount of non-coding RNA (non-codingRNA, ncRNA). Long non-coding RNAs (longnoncodingRNA, lncRNA), defined as a class of large transcripts greater than 200nt in length that perform biological functions in a non-coding form. With the aid of high-throughput transcriptome sequencing, lncRNA is found to be widely distributed in lower organisms to higher plants, and can participate in various biological processes by cis-regulation, trans-action and other modes.

And most of the annotated lncRNA is transcribed by class II RNA polymerase, it is speculated that they may cap, tail, and produce alternative splicing as mRNA. Alternative splicing, an important process for generating product diversity by monogenic mRNA, plays a key role in multi-cellular eukaryotic tissue differentiation, species pattern difference and transcript diversity regulation.

Based on mRNA related studies, alternative splicing is believed to greatly increase the diversity of genomic information. The research of the alternative splicing of the lncRNA is related, only a report of individual phenomena exists at present, the deep research on the function mechanism of the lncRNA is very rare, and the production and application values of the lncRNA are more freshly researched.

In rice, there is no report on the application of lncRNA gene alternative splicing to improve rice yield traits. The lncRNA gene alternative splicing is used as a novel breeding idea, so that gene resources for crop breeding are greatly enriched, and the development of fine breeding of phenotype polymorphism is promoted.

Disclosure of Invention

Aiming at the defects existing in the prior art, the application provides an application of the LAIR alternative splicing of the lncRNA gene of rice in improving the yield traits of the rice.

The application of the rice lncRNA gene LAIR alternative splicing in improving the yield traits of rice adopts the following technical scheme:

the application of the alternative splicing of the long-chain non-coding RNA gene LAIR of the rice, and the alternative splicing subtype of the long-chain non-coding RNA gene LAIR of the rice or the functional equivalent thereof have the purpose of improving the yield traits of the rice.

Preferably, the sequence of the alternative splicing subtype is shown in SEQ.ID NO. 1-9;

including one of LAIR-a, LAIR-b, LAIR-c, LAIR-d, LAIR-e, LAIR-f, LAIR-g, LAIR-h, LAIR-i;

the functional equivalents of the alternative splice subtypes have a degree of 99% homology with the sequences indicated by SEQ. ID No.1-9 and are all derived from the cDNA of the rice transcriptome.

Preferably, overexpression of said alternatively spliced subtype in a rice line increases the plant height and/or total grain number of the main ear of the transgenic rice.

Preferably, the application method of the LAIR alternative splicing of the rice long-chain non-coding RNA gene is as follows:

the method comprises the steps of firstly, obtaining an alternative splicing subtype from cDNA of a rice transcriptome through PCR amplification, then inserting the alternative splicing subtype into the downstream of a constitutive promoter of a vector, constructing an expression vector, transforming receptor rice by using the expression vector, and finally, identifying and screening positive transgenic rice strains through PCR.

Preferably, the vector is a pCAMBIA1304 vector, and the constitutive promoter is a CaMV 35s constitutive promoter.

Preferably, the construction of the expression vector comprises the following specific steps:

a) Firstly, amplifying cDNA of a rice transcriptome by adopting a PCR method to obtain an alternative splicing subtype;

b) Then synthesizing and inserting enzyme cutting sites to obtain PCR purified products containing enzyme cutting sites, wherein the enzyme cutting sites are SpeI (5 'end) and BstEII (3' end);

c) Then inserting the alternative splicing subtype into the downstream of the 35S constitutive promoter of the pCAMBIA1304 vector to obtain the pCAMBIA1304 expression vector of the alternative splicing subtype;

d) Finally, the pCAMBIA1304 expression vector connection product of the alternative splicing subtype is added into DH5 alpha competent cells, and activation recovery and PCR identification are carried out to determine whether the connection is successful.

Preferably, the expression vector is transformed into a rice receptor as follows:

firstly, removing shells of mature rice seeds, sterilizing, inoculating the mature rice seeds on a dedifferentiated plant tissue culture medium to induce callus cells, and then introducing the purified expression vector into the callus cells by adopting an agrobacterium transformation method to finish the transformation from the expression vector to a rice receptor.

Preferably, the primers used for PCR identification are as follows:

the primer sequence of LAIR-a is as follows, the amplified fragment length is 127Bp;

Fa：AGGACGCATACCTTTTGATACT；Ra：GCAGCCAGTCGTGCTATGT；

the primer sequence of LAIR-b is as follows, the amplified fragment length is 136Bp;

Fb：AGGACGCATACCTTTTGATACT；Rb：GCCCAATCACCCACCAGTC；

the primer sequence of LAIR-c is as follows, and the amplified fragment length is 138Bp;

Fc：ACGCATACCTTTTGATACTACATGC；Rc：TCAAGCACCAATCACCCACC

the primer sequence of LAIR-d is as follows, and the amplified fragment length is 136Bp;

Fd：ACGCATACCTTTTGATACTACATGC；Rd：AACAACCAATCACCCACCAGT；

the primer sequence of LAIR-e is as follows, and the length of the amplified fragment is 242Bp;

Fe：AGGACGCATACCTTTTGATACT；Re：CGTGTGGAGCAAATAAGCCG；

the primer sequence of LAIR-f is as follows, and the length of the amplified fragment is 192Bp;

Ff：TGGTAAGGAGCAAAAGACTCGT；Rf：GCCCAATCACCCACCAGTC；

the primer sequence of LAIR-g is as follows, and the amplified fragment length is 197Bp;

Fg：TGGTAAGGAGCAAAAGACTCGT；Rg：TCAAGCACCAATCACCCACC；

the primer sequence of LAIR-h is as follows, and the amplified fragment length is 195Bp;

Fh：TGGTAAGGAGCAAAAGACTCGT；Rh：AACAACCAATCACCCACCAGT；

the primer sequence of LAIR-i is as follows, and the amplified fragment length is 299Bp;

Fi：TGGTAAGGAGCAAAAGACTCGT；Ri：CGTGTGGAGCAAATAAGCCG；

the primer sequences of the vector resistance marker Hygromycin gene are as follows:

fr: ACGGTGTCGTCCATCACAGTTTGCC; rr: TTCCGGAAGTGCTTGACATTGGGGA amplified fragment length 289Bp.

In a second aspect, the present application provides an expression vector comprising said alternatively spliced subtype or a functional equivalent thereof.

In a third aspect, the present application provides an agrobacterium transformed with an expression vector comprising said alternative splicing subtype or a functional equivalent thereof.

The alternative splicing subtype of the rice lncRNA gene LAIR has the following beneficial effects after being constructed by an expression vector, transformed by receptor rice and over-expressed in a rice strain:

1) The plant height and/or total grain number of main ears of the transgenic rice can be obviously increased, and the growth conditions are as follows:

the average growth rate of the plant height of the strain line taking indica rice MH63 as a receptor is 2.5-13.9%, and the average growth rate of the total grain number of main spikes is 10.7-25.0%;

the average growth rate of the plant height of the strain line taking japonica rice Jap variety as a receptor is 5.3-10.4%, and the average growth rate of the total grain number of the main spike is 11.0-21.1%;

2) The novel breeding thought and application are provided, the gene resources of crop breeding are greatly enriched, and the fine breeding development of phenotype polymorphism is promoted.

Drawings

FIG. 1 shows the alternative splicing structure of the LAIR gene of rice;

FIG. 2 is a block diagram showing the T-DNA insertion region of LAIR-a/h/i-pCAMBIA1306 expression vector;

FIG. 3 is a PCR verification chart of stable transformation positive lines of LAIR-a, LAIR-h and LAIR-i genes of rice;

FIG. 4 is a phenotype map of rice over-expressed by LAIR-a, LAIR-h and LAIR-i genes;

FIG. 5 is a histogram of rice line yield trait data over-expressed by LAIR-a, LAIR-h and LAIR-i genes.

Detailed Description

The following is a further explanation of the present application by way of specific examples and with reference to the accompanying drawings, but without limiting the present application, the various media compositions used in the present application are shown in the following table:

note that: * The culture medium contains 30g/L sucrose+2.5g/L plant agar;

the experimental methods used in the specific examples of the present application are conventional methods unless otherwise specified, and materials, reagents, etc. used, unless otherwise specified, are commercially available.

Rice lncRNA LAIR is an antisense strand transcript located at the 5' end of an LRK gene cluster, the coding gene LRK1 is located in the first intron of LAIR, the LAIR alternative splicing region only occurs in part of exons in the middle of the sequence, and the genomic position and alternative splicing composition structure are shown in figure 1.

It should be noted that, in Minghui 63, a indica variety of rice, LAIR exists in alternative splicing subtypes, although only 9 alternative splicing forms are currently confirmed to be found, other subtypes are still under investigation;

LAIR-a, LAIR-b, LAIR-c, LAIR-d, LAIR-e, LAIR-f, LAIR-g, LAIR-h, LAIR-i in this application, information of which can be seen in NCBI database Gene ID: JX512719-JX512727;

wherein the shortest subtype is LAIR-a, and the total length of the sequence is 1585bp; the main subtype with higher transcription abundance is LAIR-h, and the total length of the sequence is 1797bp; the longest subtype is LAIR-i, and the total length of the sequence is 1912bp; therefore, the embodiments of the present application take the above three examples as priority.

It is furthermore emphasized that functional equivalents thereof, i.e.sequences which, after substitution, addition or deletion of partial base pairs, have a degree of homology of 99% with the sequences indicated in SEQ ID No.1 to 9, still have similar properties and efficacy.

Example 1

The application of the long-chain non-coding RNA gene LAIR of the rice comprises the following steps:

s1, constructing expression vectors of rice LncRNA genes LAIR-a, LAIR-h and LAIR-i:

the construction steps are as follows:

a) PCR method is first used to amplify and obtain the full length sequences of LAIR-a, LAIR-h and LAIR-i gene transcription from the Minghui 63 transcriptome cDNA of indica rice variety.

b) Then synthesizing and inserting enzyme cutting sites to obtain PCR purified products containing enzyme cutting sites, wherein the enzyme cutting sites are SpeI (5 'end) and BstEII (3' end);

(1) an enzyme digestion system is prepared, and the compositions and contents of the raw materials are shown in the following table (total volume is 20 mu L):

reagent(s)	Usage amount
		Restriction enzyme	0.5μl
10×NEBuffer	2.0μl
		10×BSA	2.0μl
DNA fragment/vector	≤500ng
		Sterile ddH 2 O	Upto20μl

Firstly, preparing a SpeI restriction enzyme reaction system, carrying out enzyme digestion for 1h at the enzyme digestion temperature of 37 ℃, separating by gel electrophoresis, and recovering a SpeI enzyme digestion target fragment product by gel.

Then, taking a SpeI enzyme digestion target fragment product as a sample, preparing a BstEII restriction enzyme reaction system, carrying out enzyme digestion for 1h at the enzyme digestion temperature of 60 ℃, and carrying out gel electrophoresis separation and gel recovery to obtain the SpeI+BstEII enzyme digestion target fragment product;

(2) preparing a connection system, and the raw materials are shown in the following table

Reagent(s)	Dosage/10. Mu.l
		DNA fragment	4.0μl
Carrier body	1.0μl
		SolutionI	5.0μl

The ligation system was configured using SpeI+BstEII cleavage of the desired fragment product from the DNA fragment and vector.

c) Ligating the full length sequences of LAIR-a, LAIR-h and LAIR-i at 16deg.C for 30min, inserting into the pCAMBIA1304 vector downstream of the 35S constitutive promoter;

thus, LAIR-a/h/i-pCAMBIA1304 expression vector was obtained, whose plant transformation T-DNA insertion region is shown in FIG. 2.

d) Finally, the LAIR-a/h/i-pCAMBIA1304 expression vector ligation product is added into DH5 alpha competent cells, activation recovery is carried out, and whether ligation is successful or not is identified by PCR.

S2, LAIR-a/h/i-pCAMBIA1304 expression vector for transforming rice receptor

The rice material is indica rice variety Minghui 63 (MH 63) and japonica rice variety Nippon sunny (Jap), the transformation acceptor material is callus induced by mature embryo of the variety, and the plant culture medium used in the transformation process is MS basic culture medium.

The transformation method is an agrobacterium transformation method, wherein the agrobacterium strain is agrobacterium tumefaciens (Agrobacterium tumefaciens) LBA4404, a microbial culture medium used for culturing the agrobacterium in the transformation process is a YEP culture medium, and the specific transformation method is as follows:

a) Rice callus induction

(1) Mature rice indica rice variety MH63 or japonica rice variety Jap seeds are glume removed;

(2) under aseptic condition, soaking and washing with 70% ethanol for 5min, and washing with sterile water for 3 times;

(3) soaking in 0.1% mercuric chloride for 20min, and cleaning with sterile water for 5 times;

(4) removing water, and inoculating the seeds to an induction and subculture medium;

(5) and (3) culturing in dark at 26 ℃ for 20 days, separating the induced callus, and culturing in a secondary mode to obtain the callus for later use.

b) Transformation of Agrobacterium with vector plasmid

(1) Firstly taking 200 mu l of agrobacterium competent cells, adding 1 mu g of carrier plasmid, uniformly mixing, and standing on ice for 5min to obtain a mixed solution;

(2) freezing the mixed solution in liquid nitrogen for 5min, and then water-bathing at 37 ℃ for 5min;

(3) adding liquid YEP culture medium into the mixed solution obtained after the medium-speed freezing water bath in the step (2), diluting to 1ml, and then culturing for 4 hours at 28 ℃ in a shaking way to obtain bacterial liquid;

(4) concentrating the bacterial liquid obtained in step (3) by centrifugation at 5000rpm for 2min, removing 900 μl of supernatant, re-suspending the bacterial liquid and coating on a YEP solid plate containing rifampicin and kanamycin, and culturing at 28deg.C for 3 days to obtain transformant monoclonal;

(5) and (3) selecting a monoclonal colony for shaking, identifying positive transformation clones, adding 20% glycerol, and quickly freezing with liquid nitrogen and storing at-80 ℃.

c. Obtaining transformed rice strain by agrobacterium transformation method

(1) Firstly, 500 mu L of agrobacterium is inoculated into 50ml of YEP liquid culture medium, and is cultivated by shaking at 28 ℃ and 200rpm until the OD600 is 0.6-0.8, and then 40 mu L of AS (acetosyringone) is added into each 40ml of bacterial liquid, thus obtaining the agrobacterium bacterial liquid.

(2) Soaking the callus particles in the prepared agrobacterium tumefaciens bacteria solution in step (1) for 30min, and manually shaking for 5 times every 5min to uniformly distribute the bacteria solution and the callus to obtain the infected callus.

(3) Taking out the infected callus in the step (2), sucking the excessive bacterial liquid on sterile filter paper, transferring to a co-culture medium, and culturing in dark at 26 ℃ for 6 days, wherein a layer of sterile filter paper is paved on the surface of the co-culture medium, and the callus blocks are not in direct contact with the culture medium on the filter paper; and (3) the infected callus blocks are provided with bacterial films at the contact parts with the YEP liquid culture medium, so that the callus infected by the agrobacterium LBA4404 can be obtained.

(4) Taking out the callus infected by the agrobacterium tumefaciens LBA4404 in the step (3), washing for 5 times by using sterile water containing rifampicin (50 mg/L) and kanamycin (50 mg/L) resistance, and sucking excessive water by using sterile filter paper to obtain dried callus;

(5) transferring the dried callus to a primary screening culture medium, performing dark culture at 26 ℃ for 15 days, obtaining a callus infected by agrobacterium tumefaciens LBA4404 with weak Hygromycin resistance, and drying by using sterile filter paper;

and transferring the dried Hygromycin weak-resistant callus infected by the agrobacterium LBA4404 to a secondary culture medium, performing dark culture at 26 ℃, and performing secondary screening for 20 days to obtain the Hygromycin strong-resistant callus infected by the agrobacterium LBA 4404.

(6) The callus infected by Agrobacterium LBA4404 with strong hygromycin resistance in (5) is transferred to a primary differentiation medium, cultured for 15 days at 26 ℃ under 16h light/day, then transferred to a secondary differentiation medium, and cultured for 15 days at 26 ℃ under 16h light/day until green buds of 1-5cm are grown.

(7) After green seedlings are differentiated, firstly removing redundant calluses around, cutting off roots (0.5 cm can be reserved), and then transferring the cut roots into a rooting and seedling strengthening culture medium for rooting culture to obtain differentiated seedlings.

(8) After the differentiated seedlings grow to 10-15cm high and root systems grow vigorously, uncovering and training the seedlings for about 7 days, removing the seedlings from the rooting culture medium, cleaning the residual culture medium, and transplanting the seedlings to a greenhouse or a field.

(9) Detecting candidate transformed plants by PCR amplification method to obtain positive T containing LAIR-a/h/i transformation fragment ₀ And (5) plant generation, and seed reproduction in the field.

Obtaining LAIR-a, LAIR-h and LAIR-i genes transformed homozygous lines, and performing experimental verification by using a PCR method, wherein the verification objects comprise exogenous LAIR-a, LAIR-h and LAIR-i genes and a vector resistance marker Hygromycin gene, specific primers are shown in the following table, and the PCR identification results of positive transformed lines are shown in FIG. 3.

Table: PCR verification specific primers for LAIR-a/h/i gene rice stable transformant strain

Wherein the PCR reaction system is shown in the following table:

reagent (mother liquor concentration)	Dosage/25. Mu.l
		DNA polymerase	0.2μl
10×PCRBuffer	2.5μl
		dNTPMixture(2.5mM)	2.0μl
PCRForwardPrimer(10μM)	1.0μl
		PCRReversePrimer(10μM)	1.0μl
Template	2.0μl
		Sterile ddH 2 O	16.3μl

PCR reaction procedure:

95℃5min

[95 ℃ 40sec60 ℃, 40sec72 ℃ 40sec ]. Times.30 cycles

10min at 72 ℃.

S3, investigation and statistics of yield traits of LAIR-a/h/i gene over-expression rice strain

Seeds and receptor groups (serving as wild type controls) of the above LAIR-a/h/i gene over-expression rice positive strain are sown in an experimental field of Shanghai (31 DEG 11'N,121 DEG 29' E) in summer until the rice wax maturing period, and phenotype and yield trait copy analysis is carried out on the wild type and the transformant strain.

The rice lines in which LAIR-a, LAIR-h and LAIR-i genes are overexpressed show the yield-promoting character of increasing the plant height and the number of main spikes compared with the wild rice plants, and the rice phenotype of the overexpressed lines is shown in figure 4.

And counting the correlation property data, and calculating average values, wherein bar graphs of the average values are respectively shown in fig. 5, and the statistical results are shown in the following table:

strains of plants	Height of plant (cm)	Total grain number of main spike
			LAIR-a-M1	93.2±4.38	177.8±19.99
LAIR-a-M2	94.5±2.01	178.6±21.19
			LAIR-h-M1	103.5±7.32	198.5±30.23
LAIR-h-M2	100.5±7.71	190.8±30.83
			LAIR-i-M1	94.0±2.90	175.8±15.88
LAIR-i-M2	91.5±7.42	185.9±26.78
			MH63-CK control group	90.9±9.98	158.8±18.15
LAIR-a-J1	66.8±2.09	64.2±4.87
			LAIR-a-J2	67.6±3.47	66.8±8.11
LAIR-h-J1	67.5±3.29	62.5±10.47
			LAIR-h-J2	66.7±4.08	65.6±8.58
LAIR-i-J1	68.2±2.52	68.2±12.52
			LAIR-i-J2	65.1±3.67	64.9±6.88
Jap-CK control group	61.8±2.79	56.3±9.60

Note that: in the table, LAIR-a/h/i- (letter+number) is the transformant line number, where letter M represents the transformant receptor MH63 and letter J represents the transformant receptor Jap.

As can be seen from the table, compared with the control group, the strain heights of the LAIR-a/h/i gene over-expression rice lines are increased, and in the indica rice MH63 variety receptor, the LAIR-h gene lines are increased remarkably; the LAIR-a/h/i gene strain is increased obviously in the acceptor of japonica rice Jap variety, and the characteristics show that the phenotype is different in different varieties of indica rice with different alternative splicing subtypes.

Further analysis of the above table also shows that, relative to the control group, the total grain number of the main spike of the LAIR-a/h/i gene over-expressed rice strain is obviously increased in all different varieties of receptors, and the characteristics indicate that different alternative splicing subtypes have consistent promoting capability in different varieties of indica rice stems.

Therefore, the LAIR alternative splicing subtype of the lncRNA gene can promote the yield-increasing property of the rice plant height and the total grain number of main ears, and shows slight phenotype difference among different varieties of indica type stems, so that the LAIR alternative splicing subtype can be applied to the fine breeding of phenotype polymorphism.

What should be stated here in particular is: alternatively spliced subtypes of LAIR, such as LAIR-b, LAIR-c, LAIR-d, LAIR-e, LAIR-f, LAIR-g gene-overexpressed rice lines, are still in the field, and corresponding test results are expected after 22 years and 10 months.

The present embodiment is merely illustrative of the present application and is not intended to be limiting, and those skilled in the art, after having read the present specification, may make modifications to the present embodiment without creative contribution as required, but is protected by patent laws within the scope of the claims of the present application.

Claims (10)

1. The application of the alternative splicing of the long-chain non-coding RNA gene LAIR of the rice is characterized in that the alternative splicing subtype of the long-chain non-coding RNA gene LAIR of the rice or the functional equivalent thereof has the application of improving the yield traits of the rice.

2. The use of the alternative splicing of long-chain non-coding RNA gene LAIR of rice according to claim 1 wherein the sequence of said alternative splicing subtype is shown in SEQ ID NO. 1-9;

including one of LAIR-a, LAIR-b, LAIR-c, LAIR-d, LAIR-e, LAIR-f, LAIR-g, LAIR-h, LAIR-i;

the functional equivalents of the alternative splice subtypes have a degree of 99% homology with the sequences indicated by SEQ. ID No.1-9 and are all derived from the cDNA of the rice transcriptome.

3. The use of the long-chain non-coding RNA gene LAIR alternative splicing of rice according to claim 2, wherein said alternative splicing subtype is overexpressed in rice lines to increase the plant height and/or total grain number of main ears of transgenic rice.

4. The application of the long-chain non-coding RNA gene LAIR of rice according to claim 1, wherein the application method of the long-chain non-coding RNA gene LAIR of rice is as follows:

the method comprises the steps of firstly, obtaining an alternative splicing subtype from cDNA of a rice transcriptome through PCR amplification, then inserting the alternative splicing subtype into the downstream of a constitutive promoter of a vector, constructing an expression vector, transforming receptor rice by using the expression vector, and finally, identifying and screening positive transgenic rice strains through PCR.

5. The application of the LAIR alternative splicing of long-chain non-coding RNA gene of paddy rice according to claim 4, wherein the vector is pCAMBIA1304 vector, and the constitutive promoter is CaMV 35s constitutive promoter.

6. The application of the LAIR alternative splicing of long-chain non-coding RNA gene of paddy rice according to claim 5, wherein the construction of said expression vector comprises the following specific steps:

a) Firstly, amplifying cDNA of a rice transcriptome by adopting a PCR method to obtain an alternative splicing subtype;

b) Then synthesizing and inserting enzyme cutting sites to obtain PCR purified product containing enzyme cutting sites, wherein the enzyme cutting sites areSpeI(5' -terminal) andBstEII(3' end);

c) Then inserting the alternative splicing subtype into the downstream of the 35S constitutive promoter of the pCAMBIA1304 vector to obtain the pCAMBIA1304 expression vector of the alternative splicing subtype;

d) Finally, the pCAMBIA1304 expression vector connection product of the alternative splicing subtype is added into DH5 alpha competent cells, and activation recovery and PCR identification are carried out to determine whether the connection is successful.

7. The use of the long non-coding RNA gene LAIR alternative splicing according to claim 5, wherein the step of transforming the expression vector into a rice receptor is as follows:

firstly, removing shells of mature rice seeds, sterilizing, inoculating the mature rice seeds on a dedifferentiated plant tissue culture medium to induce callus cells, and then introducing the purified expression vector into the callus cells by adopting an agrobacterium transformation method to finish the transformation from the expression vector to a rice receptor.

8. The use of the long non-coding RNA gene LAIR alternative splicing according to claim 5, characterized in that the primers used for the PCR identification are as follows:

the primer sequence of LAIR-a is as follows, the amplified fragment length is 127Bp;

Fa：AGGACGCATACCTTTTGATACT；Ra：GCAGCCAGTCGTGCTATGT；

the primer sequence of LAIR-b is as follows, the amplified fragment length is 136Bp;

Fb：AGGACGCATACCTTTTGATACT；Rb：GCCCAATCACCCACCAGTC；

the primer sequence of LAIR-c is as follows, and the amplified fragment length is 138Bp;

Fc：ACGCATACCTTTTGATACTACATGC；Rc：TCAAGCACCAATCACCCACC

the primer sequence of LAIR-d is as follows, and the amplified fragment length is 136Bp;

Fd：ACGCATACCTTTTGATACTACATGC；Rd：AACAACCAATCACCCACCAGT；

the primer sequence of LAIR-e is as follows, and the length of the amplified fragment is 242Bp;

Fe：AGGACGCATACCTTTTGATACT；Re：CGTGTGGAGCAAATAAGCCG；

the primer sequence of LAIR-f is as follows, and the length of the amplified fragment is 192Bp;

Ff：TGGTAAGGAGCAAAAGACTCGT；Rf：GCCCAATCACCCACCAGTC；

the primer sequence of LAIR-g is as follows, and the amplified fragment length is 197Bp;

Fg：TGGTAAGGAGCAAAAGACTCGT；Rg：TCAAGCACCAATCACCCACC；

the primer sequence of LAIR-h is as follows, and the amplified fragment length is 195Bp;

Fh：TGGTAAGGAGCAAAAGACTCGT；Rh：AACAACCAATCACCCACCAGT；

the primer sequence of LAIR-i is as follows, and the amplified fragment length is 299Bp;

Fi：TGGTAAGGAGCAAAAGACTCGT；Ri：CGTGTGGAGCAAATAAGCCG；

the primer sequences of the vector resistance marker Hygromycin gene are as follows:

fr: ACGGTGTCGTCCATCACAGTTTGCC; rr: TTCCGGAAGTGCTTGACATTGGGGA amplified fragment length 289Bp.

9. An expression vector comprising the alternatively spliced subtype of claim 1 or a functional equivalent thereof.

10. An agrobacterium transformed with an expression vector according to claim 9.

Images