CN117025593A - Picea dominance expression promoter and application thereof - Google Patents

Abstract

The application relates to a skin thorn dominant expression promoter and application thereof, belonging to the field of plant genetic engineering. The application discloses a promoter specifically expressed and/or expressed in the skin thorn and/or expressed dominantly, which comprises nucleic acid molecules with sequences shown in SEQ ID NO. 1-SEQ ID NO. 4, and can be used for regulating and controlling plant skin thorn development.

Description

Picea dominance expression promoter and application thereof

Technical Field

The application relates to a skin thorn dominant expression promoter and application thereof, belonging to the field of plant genetic engineering.

Background

The rose plants have high ornamental value, however, many plants of the rose genus, such as roses, roses and the like, have skin thorns on many stems, and bring about a plurality of inconveniences to the field cultivation management of plants, flower picking, transportation and the like. Therefore, the quality of the new variety of the thornless or soft rosa plants can be effectively improved, the production efficiency can be greatly improved, and the production cost can be obviously reduced.

The skin thorns are widely present in plants and are formed by the protrusion of the epidermal cells and subcutaneous tissues on the stems and branches of the plants. Has a certain similarity with the epidermis hair in origin. Furthermore, the stiffening of the skin thorns is closely related to lignin accumulation. In recent years, there have been some studies on the molecular mechanism of plant skin thorn formation, and candidate genes related to skin thorn development have been successively isolated, for example CPC, WER, MYB5 (Yuan Xiaoyu. Research on the excavation and application of rose skin thorn formation related genes [ D ]. University of dulcimer, 2019.), TTG1 (Luan Xiaofang. Analysis on cloning and expression of rose thorn formation related transcription factor RrTTG1 [ D ]. University of dulcimer, 2014 ]), and RcNACs (identified by the genome-wide of "month powder" rose NAC family, screening of related members of skin thorn development [ J ]. Chinese agricultural science, 2022, 55 (24): 17.), etc.

Deep understanding of the molecular mechanism of skin penetration helps to artificially modify the skin penetration properties. However, the use of a promoter specific to the skin thorns is also required to inhibit or soften the specific tissue. Therefore, it is particularly important to dig out some promoters with the property of specific expression of the skin thorns.

In order to solve the problems, 12 different tissue samples of the wild rose are collected, and 5 genes with relatively high expression level in the skin thorns are obtained by means of transcriptome sequencing and sequence screening verification, and verification results show that 3 genes are specifically expressed in the skin thorns and 2 genes are predominantly expressed in the skin thorns. The 5' promoter sequences of these genes were further cloned and analyzed for the expression activity of the promoters and the expression activity of the different truncated fragments. Except that 1 promoter has no expression activity, other promoters and fragments thereof have expression activity, and the promoters can be used for driving target genes to specifically express in the skin thorns and can be used for regulating and controlling the development of the skin thorns.

Disclosure of Invention

It is an object of the present application to provide a promoter for dominant expression in skin thorns.

It is a second object of the present application to provide a gene expression cassette, an expression vector and a host cell comprising the above promoter.

The application also aims to disclose the application of the promoter, the gene expression cassette, the expression vector and the host cell in regulation and control of the development of the skin thorns.

In order to achieve the above purpose, the application adopts the following technical scheme:

the application provides a promoter, which is characterized by comprising any one of the following components:

1) Any one of sequences shown in SEQ ID NO. 1-SEQ ID NO. 4;

2) SEQ ID NO. 1, sequence shown in 1383-1970, or 971-1970, or 571-1970;

3) The sequence shown in 1207-1471 of SEQ ID NO. 2, the sequence shown in 1018-1471, or the sequence shown in 746-1471;

4) SEQ ID NO. 3, sequences represented by positions 1022-1620, or sequences represented by positions 527-1620;

5) SEQ ID NO. 4, sequences 1342-1941, or sequences 842-1941.

The application also provides a gene expression cassette, which is characterized in that the expression cassette contains the promoter.

The application also provides an expression vector which is characterized by comprising the expression cassette.

The application also provides a host cell, which is characterized in that the host cell contains the expression vector.

In some embodiments, the host cell is a prokaryotic cell.

In some embodiments, the host cell is an E.coli or Agrobacterium cell.

The application also provides application of the promoter, the gene expression cassette, the expression vector and the host cell in regulation and control of the development of the skin thorns.

Compared with the prior art, the application has the beneficial effects that: the application obtains a series of promoter nucleic acid molecules, the sequences are not recorded in a public database, and have the characteristics of specific expression and dominant expression of the skin thorns, and the target genes can be driven to specifically express in the skin thorns by utilizing the promoters, so that the promoter can be used for regulating and controlling the development of the skin thorns and cultivating thorn-free or soft thorn plant varieties or thorn-free or soft thorn stem segments.

Drawings

FIG. 1 5 analysis of RNA level expression of genes in different tissues of Rosa multiflora. Gene names are marked on the top of each figure. The vertical axis represents the expression level of the reference gene, and the horizontal axis represents different tissue samples. an apical bundle: a terminal bud; a final band: lateral buds; leaf: a blade; step: stems; root: root; sepal: sepals; petal: petals; an anther: anther; stingma: column head; flow bud: flower buds; pricke: skin thorns.

FIG. 2 results of GUS staining of four wild rose promoters in Nicotiana benthamiana. A: rmEXPB2pro: : GUS staining results, B: rmMAP70pro: : GUS staining results, C: rmGASA1pro: : GUS staining results, D: rmUGTpro:: GUS staining results. CK (CK) ^- : DX2181G-GUS empty vector as negative control, CK ⁺ : caMV 35S GUS is used as positive control, the other is promoter fragment, and the number indicates the promoter length.

FIG. 3 GUS staining of EXPB2 and UGT promoters in China rose 'Samansha'. CK (CK) ^- : DX2181G-GUS empty vector as negative control, CK ⁺ : caMV 35S GUS is used as positive control, the other is promoter fragment, and the number indicates the promoter length.

Detailed Description

The following definitions and methods are provided to better define the present application and to guide those of ordinary skill in the art in the practice of the present application. Unless otherwise indicated, terms are to be construed according to conventional usage by those of ordinary skill in the relevant art. All patent documents, academic papers, industry standards, and other publications cited herein are incorporated by reference in their entirety.

Unless otherwise indicated, nucleic acids are written in the 5 'to 3' direction from left to right; the amino acid sequence is written in the amino to carboxyl direction from left to right. Amino acids may be represented herein by their commonly known three-letter symbols or by the single-letter symbols recommended by the IUPAC-IUB biochemical nomenclature committee. Likewise, nucleotides may be referred to by commonly accepted single letter codes. The numerical range includes the numbers defining the range. As used herein, "nucleic acid" includes reference to deoxyribonucleotide or ribonucleotide polymers in either single-or double-stranded form, and unless otherwise limited, includes known analogs (e.g., peptide nucleic acids) having the basic properties of natural nucleotides that hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides. As used herein, the term "encode" or "encoded" when used in the context of a particular nucleic acid, means that the nucleic acid contains the necessary information to direct translation of the nucleotide sequence into a particular protein. The information encoding the protein is represented using codons. As used herein, reference to a "full-length sequence" of a particular polynucleotide or protein encoded thereby refers to an entire nucleic acid sequence or an entire amino acid sequence having a natural (non-synthetic) endogenous sequence. The full length polynucleotide encodes the full length, catalytically active form of the particular protein. The terms "polypeptide", "polypeptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The term is used for amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acid. The term is also used for naturally occurring amino acid polymers. The terms "residue" or "amino acid" are used interchangeably herein to refer to an amino acid that is incorporated into a protein, polypeptide, or peptide (collectively, "protein"). Amino acids may be naturally occurring amino acids, and unless otherwise limited, may include known analogs of natural amino acids, which analogs may function in a similar manner to naturally occurring amino acids.

"plant" includes references to whole plants, plant organs, plant tissues, seeds and plant cells, and their progeny. Plant cells include, but are not limited to, cells from seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, and microspores. "progeny" includes any subsequent generation of a plant.

In the present application, the terms "comprises," "comprising," or variations thereof, are to be understood to encompass other elements, numbers, or steps in addition to those described. "subject plant" or "subject plant cell" refers to a plant or plant cell in which genetic engineering has been effected, or a progeny cell of a plant or cell so engineered, which progeny cell comprises the engineering. "control" or "control plant cell" provides a reference point for measuring phenotypic changes in a subject plant or plant cell.

Negative or control plants can include, for example: (a) Wild-type plants or cells, i.e., plants or cells having the same genotype as the genetically engineered starting material, which genetic engineering produces the subject plant or cell; (b) A plant or plant cell having the same genotype as the starting material but which has been transformed with an empty construct (i.e., with a construct that has no known effect on the trait of interest, such as a construct comprising a marker gene); (c) A plant or plant cell that is a non-transformed isolate of the subject plant or plant cell; (d) A plant or plant cell genetically identical to the test plant or plant cell but not exposed to conditions or stimuli that induce expression of the gene of interest; or (e) the subject plant or plant cell itself, under conditions in which the gene of interest is not expressed.

Those skilled in the art will readily recognize that advances in molecular biology, such as site-specific and random mutagenesis, polymerase chain reaction methods, and protein engineering techniques, provide a wide range of suitable tools and procedures for engineering or engineering amino acid sequences and potentially genetic sequences of proteins of agricultural interest.

In some embodiments, the nucleotide sequences of the present application may be altered to make conservative amino acid substitutions. The principles and examples of conservative amino acid substitutions are described further below. In certain embodiments, the nucleotide sequence of the present application may be subjected to substitutions in accordance with the disclosed monocot codon preferences that do not alter the amino acid sequence, e.g., codons encoding the same amino acid sequence may be replaced with monocot-preferred codons without altering the amino acid sequence encoded by the nucleotide sequence. In some embodiments, a portion of the nucleotide sequence in the present application is replaced with a different codon encoding the same amino acid sequence, such that the amino acid sequence encoded thereby is not changed while the nucleotide sequence is changed. Conservative variants include those sequences that encode the amino acid sequence of one of the proteins of an embodiment due to the degeneracy of the genetic code. In some embodiments, a portion of the nucleotide sequences of the present application are substituted according to monocot preference codons. Those skilled in the art will recognize that amino acid additions and/or substitutions are generally based on the relative similarity of amino acid side chain substituents, e.g., hydrophobicity, charge, size, etc., of the substituents. Exemplary amino acid substituents having various of the aforementioned contemplated properties are well known to those skilled in the art and include arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine. Guidelines for suitable amino acid substitutions that do not affect the biological activity of the protein of interest can be found in the model of Dayhoff et al (1978) Atlas of Protein Sequence and Structure (protein sequence and structure atlas) (Natl. Biomed. Res. Foundation, washington, D.C.), incorporated herein by reference. Conservative substitutions, such as substitution of one amino acid for another with similar properties, may be made. Identification of sequence identity includes hybridization techniques. For example, all or part of a known nucleotide sequence is used as a probe for selective hybridization with other corresponding nucleotide sequences present in a cloned genomic DNA fragment or population of cDNA fragments (i.e., a genomic library or cDNA library) from a selected organism. The hybridization probes may be genomic DNA fragments, cDNA fragments, RNA fragments, or other oligonucleotides, and may be labeled with a detectable group such as 32P or other detectable marker. Thus, for example, hybridization probes can be prepared by labeling synthetic oligonucleotides based on the sequences of the embodiments. Methods for preparing hybridization probes and constructing cDNA and genomic libraries are generally known in the art. Hybridization of the sequences may be performed under stringent conditions. As used herein, the term "stringent conditions" or "stringent hybridization conditions" refers to conditions under which a probe will hybridize to its target sequence to a detectably greater extent (e.g., at least 2-fold, 5-fold, or 10-fold over background) relative to hybridization to other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the hybridization stringency and/or controlling the washing conditions, target sequences 100% complementary to the probes can be identified (homologous probe method). Alternatively, stringent conditions can be adjusted to allow for some sequence mismatches in order to detect lower similarity (heterologous probe method). Typically, the probe is less than about 1000 or 500 nucleotides in length. Typically, stringent conditions are those in which the salt concentration is less than about 1.5M Na ion, typically about 0.01M to 1.0M Na ion concentration (or other salt) at a pH of 7.0 to 8.3, and the temperature conditions are: when used with short probes (e.g., 10 to 50 nucleotides), at least about 30 ℃; when used with long probes (e.g., greater than 50 nucleotides), at least about 60 ℃. Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization at 37 ℃ with 30% to 35% formamide buffer, 1M NaCl, 1% sds (sodium dodecyl sulfate), washing in 1 x to 2 x SSC (20 x SSC = 3.0M NaCl/0.3M trisodium citrate) at 50 ℃ to 55 ℃. Exemplary moderately stringent conditions include hybridization in 40% to 45% formamide, 1.0M NaCl, 1% SDS at 37℃and washing in 0.5 XSSC to 1 XSSC at 55℃to 60 ℃. Exemplary high stringency conditions include hybridization in 50% formamide, 1M NaCl, 1% sds at 37 ℃ and a final wash in 0.1 x SSC at 60 ℃ to 65 ℃ for at least about 20 minutes. Optionally, the wash buffer may comprise about 0.1% to about 1% sds. The duration of hybridization is typically less than about 24 hours, typically from about 4 hours to about 12 hours. Specificity generally depends on post-hybridization washing, the key factors being the ionic strength and temperature of the final wash solution. The Tm (thermodynamic melting point) of DNA-DNA hybrids can be approximated from the formula Meinkoth and Wahl (1984) Anal. Biochem. 138:267-284: tm=81.5 ℃ +16.6 (log) +0.41 (% GC) -0.61 (% formamide) -500/L; where M is the molar concentration of monovalent cations,% GC is the percentage of guanosine and cytosine nucleotides in the DNA,% formamide is the percentage of formamide in the hybridization solution, and L is the base pair length of the hybrid. Tm is the temperature (at a defined ionic strength and pH) at which 50% of the complementary target sequence hybridizes to a perfectly matched probe. Washing is typically performed at least until equilibrium is reached and a low hybridization background level is reached, such as 2 hours, 1 hour, or 30 minutes. Each 1% mismatch corresponds to a decrease in Tm of about 1 ℃; thus, tm, hybridization, and/or wash conditions can be adjusted to hybridize to sequences of desired identity. For example, if sequences with ≡90% identity are desired, the Tm can be reduced by 10 ℃. Typically, stringent conditions are selected to be about 5 ℃ lower than the Tm for the specific sequence and its complement at a defined ionic strength and pH. However, under very stringent conditions, hybridization and/or washing may be performed at 4℃below the Tm; hybridization and/or washing may be performed at 6 ℃ below the Tm under moderately stringent conditions; hybridization and/or washing can be performed at 11℃below the Tm under low stringency conditions.

In some embodiments, fragments of the nucleotide sequence and the amino acid sequence encoded thereby are also included. As used herein, the term "fragment" refers to a portion of the nucleotide sequence of a polynucleotide or a portion of the amino acid sequence of a polypeptide of an embodiment. Fragments of a nucleotide sequence may encode protein fragments that retain the biological activity of the native or corresponding full-length protein and thus have protein activity. Mutant proteins include biologically active fragments of a native protein that comprise consecutive amino acid residues that retain the biological activity of the native protein. Some embodiments also include a transformed plant cell or transgenic plant comprising the nucleotide sequence of at least one embodiment. In some embodiments, the plant is transformed with an expression vector comprising the nucleotide sequence of at least one embodiment and operably linked thereto a promoter that drives expression in a plant cell. Transformed plant cells and transgenic plants refer to plant cells or plants comprising a heterologous polynucleotide within the genome. In general, the heterologous polynucleotide is stably integrated within the genome of the transformed plant cell or transgenic plant, such that the polynucleotide is delivered to the offspring. The heterologous polynucleotide may be integrated into the genome, either alone or as part of an expression vector. In some embodiments, the plants to which the present application relates include plant cells, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and plant cells, which are whole plants or parts of plants, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, nuts, ears, cobs, hulls, stalks, roots, root tips, anthers, and the like. The application also includes plant cells, protoplasts, tissues, calli, embryos and flowers, stems, fruits, leaves and roots derived from the transgenic plants of the application or progeny thereof, and thus comprising at least in part the nucleotide sequences of the application.

The term "amplification" in the context of nucleic acid amplification is any process in which additional copies of a selected nucleic acid (or transcribed form thereof) are produced. Typical amplification methods include replication methods based on a variety of polymerases, including Polymerase Chain Reaction (PCR), ligase mediated methods such as Ligase Chain Reaction (LCR), and RNA polymerase based amplification (e.g., by transcription) methods.

The following examples are illustrative of the application and are not intended to limit the scope of the application. Modifications and substitutions to methods, procedures, or conditions of the present application without departing from the spirit and nature of the application are intended to be within the scope of the present application. Examples follow conventional experimental conditions, such as the molecular cloning laboratory manual of Sambrook et al (Sambrook J & Russell D W, molecular cloning: a laboratory manual, 2001), or conditions recommended by the manufacturer's instructions, unless otherwise indicated. Unless otherwise indicated, all chemical reagents used in the examples were conventional commercial reagents, and the technical means used in the examples were conventional means well known to those skilled in the art.

EXAMPLE 1 wild rose transcriptome sequencing

Wild rose (Rosa multiflora) is a fallen leaf bush, diploid, and the stems and petioles of rose are populated with skin thorns, which is one of the main parents of modern China rose. The wild rose used in the application is a common seed planted in the agricultural university of China, and is planted in other places, so that the wild rose can be obtained by the public.

The application collects 12 samples of different tissues such as wild rose axillary buds, large buds, leaves, medium buds, petals, skin thorns, receptacles, roots, calyx, small buds, stamens, young stems and the like, 2 biological repetitions are arranged for each sample, and transcriptome sequencing is carried out by utilizing an illumina platform to obtain double-end sequencing data.

The expression level information of 44841 genes in total was obtained by comparison with the wild rose genome database (http:// rosa. Kazusa. Or. Jp /). Among these, 422 genes were expressed in the skin-prick tissue relatively highest, while those expressed in other tissues were relatively low. The genes are ordered in a numerical mode from large to small based on the FPKM value of each gene in the skin thorns. The genes at the first 10 positions of the sequence are selected, and then 5 candidate genes are obtained according to the screening standard that the FPKM value of each gene in other tissues is less than or equal to 1/100 of the FPKM value in the skin thorns.

Further, the qRT-PCR technology is utilized to verify the time-space expression mode, and the result shows that RmEXPB2, rmSA9D6 and RmUGT are specifically expressed in the skin thorns, and RmMAP70 and RmGASA1 are predominantly expressed in the skin thorns (the result is shown in figure 1).

Wherein, the qRT-PCR reference gene is selected from wild rose UBC, and the detection primer is UBC-F: GCCAGAGATTGCCCATATGTA, UBC-R: TCACAGAGTCCTAGCAGCACA. The detection primers for the remaining target genes were as follows:

RmEXPB2-F：GATTCCAAATGGGTGGCAAC，RmEXPB2-R：CGCACTGCTTAAATCCTTCC；RmMAP70-F：

GATGGTGCCAATGAAGCCTC，RmMAP70-R：

ACTCTTTTTGACTTCACAATGCCTC；RmGASA1-F：

ACAACTGGAAGACCCAAGAAGG，RmGASA1-R：

R-AATTAATGGCAGAAATGGAAGCA；RmUGT-F：

TGGGTTGCAGTTTGAGAATGGA，RmUGT-R：

TTTGACCAAGCTATCCAAGCA；RmSA9D6-F：

AAGCCTCATGGCGTCAAGTT，RmSA9D6-R：

AACATACCATTCCATCTGACTTCT。

the details of the genes can be queried in the wild rose genome database (http:// rosa. Kazusa. Or. Jp/index. Html), the gene numbers are RmEXPB2 as follows: rmu _sc0002022.1_g000002.1/fd, rmsa9D6: rmu _co8451205.1_g000001.1/fd, rmUGT: rmu _ssc0000167.1_g000011.1/fd, rmMAP70:

Rmu_sc0011992.1_g000012.1/fd、RmGASA1：Rmu_co8296059.1_g000001.1/fd。

EXAMPLE 2 cloning of Gene promoters

The expression pattern of the genes is mainly influenced by the promoters, and the promoters of the genes are cloned to regulate the specific expression of target genes because the 5 genes show the characteristics of the specific expression and the dominant expression of the picothorns.

Since the genome sequence in the wild rose database is incomplete and a promoter with sufficient length cannot be obtained, the genome database of the Chinese Old rose "month powder" (R.chinensis 'Old blue') is referred to

(https:// lipm-browsers. Inula. Fra. Fr/pub/RchiOBHm-V2/. These sequences were found by analysis to be not exactly identical in the database and to belong to the new promoters.

TABLE 1 primer information used in cloning promoters

Example 3 detection of promoter fragment Activity

The promoter sequence obtained above is longer (1.5-2 Kb), and the shorter promoter is helpful for genetic engineering operations. The application truncates the 5 promoters in turn, and transforms the truncated promoter fragments into tobacco and China rose by using GUS reporter genes to test the promoter activity. The promoter test vector was DX2181G-GUS vector (vector information may be referred to as Fan Shihang, lijun, hua Wei. Analysis of brassica napus embryo specific promoter pBnaA09G21960D [ J ]. Chinese oil crop journal, 2017, 39 (6): 721-728).

The promoter-GUS recombinant expression vector is injected into the leaf of Nicotiana benthamiana by using an agrobacterium-mediated transient transformation method. 3-5 biological replicates were set, one tobacco as one biological replicate, and 1-3 leaves per tobacco as technical replicates.

The method comprises the following specific steps:

1. adding the agrobacterium tumefaciens liquid preserved at-80 ℃ into LB (containing 100mg/L Kan and 50mg/L Rif) liquid culture medium for primary activation, and culturing at 28 ℃ for 200r/min overnight;

2. taking the bacterial liquid activated at one time according to the following ratio of 1: adding LB into the mixture according to the volume ratio of 100 to perform secondary activation, and culturing the mixture overnight at 28 ℃ and 200 r/min;

3. measuring the OD value of the bacterial liquid and adjusting the OD ₆₀₀ Centrifuging at about 0.6 r/min for 10min, discarding supernatant, resuspending thallus with 10ml of resuspension buffer (1 mol/L MES (pH 5.6), 2mol/L MgCl2, 100mmol/L As), standing at room temperature for 2-3h;

4. injecting to the back of leaf of Nicotiana benthamiana growing for 4 weeks, culturing in dark for 24 hr, and culturing in normal light for 16 hr/dark for 8 hr for 24-48 hr.

The conversion method of China rose 'Samansa' is as follows: preparation of 30-40mL of Agrobacterium heavy suspension, OD ₆₀₀ 1, each of the separation tubes is placed into 7-10 Chinese rose 'Samansha' tissue culture seedlings to be immersed below the liquid level of the heavy suspension, and vacuum permeation is carried out for 10min at-0.1 Kpa, and the process is repeated once. Taking out the tissue culture seedlings, washing the tissue culture seedlings with distilled water once, inserting an MS culture medium for dark culture for 24 hours, and performing GUS staining after light culture for 24 hours.

Preparing GUS staining solution. The observed plant material is placed into a 10ml centrifuge tube, GUS staining solution is added until the plant material is soaked on the surface of the material, vacuum permeation is carried out for 10min at-0.09 Kpa, the plant material is repeated once, and the plant material is wrapped by tin paper and then placed into a 37 ℃ incubator for staining for about 12 h. After staining, the leaves were observed and photographed with 95% ethanol until the negative control was white and the blue substrate appeared no longer faded.

Experimental results show that the RmSA9D6 full-length promoter is not active, the other 4 promoters RmEXPB2, rmMAP70, rmGASA1 and RmUGT are all active, and fragments after the 4 promoters are truncated are also active. See in particular Table 2 (FIG. 2 shows the GUS staining results of all promoter fragments in tobacco, and FIG. 3 shows the GUS staining results of promoter fragments in China rose, taking RmEXPB2 and RmUGT as examples).

TABLE 2 results of promoter Activity test

The results show that the promoter and the molecules of the truncated fragments with different lengths have the function of driving the target genes to specifically and dominantly express in the spines, so that the promoter is used for constructing a gene expression cassette or related expression vectors or host cells containing the vectors to transform thorn-containing or thorn-free varieties of rose, rose and the like by combining with the target genes related to the spines development, and the spines development of the species can be accurately regulated and controlled without affecting the normal development of other tissues. When the gene expression cassette is formed by connecting the promoter with the skin thorn development inhibition gene or the inhibition fragment, the expression cassette can be used for specifically inhibiting the growth of skin thorn, cultivating a thorn-free or soft thorn plant variety or preparing a thorn-free or soft thorn stem section.

While the application has been described in detail in the foregoing general description and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the application and are intended to be within the scope of the application as claimed.

Claims (7)

1. A promoter, characterized in that the promoter comprises any one of the following:

1) Any one of sequences shown in SEQ ID NO. 1-SEQ ID NO. 4;

2) SEQ ID NO. 1, sequence shown in 1383-1970, or 971-1970, or 571-1970;

3) The sequence shown in 1207-1471 of SEQ ID NO. 2, the sequence shown in 1018-1471, or the sequence shown in 746-1471;

4) SEQ ID NO. 3, sequences represented by positions 1022-1620, or sequences represented by positions 527-1620;

5) SEQ ID NO. 4, sequences 1342-1941, or sequences 842-1941.

2. A gene expression cassette comprising the promoter of claim 1.

3. An expression vector comprising the expression cassette of claim 2.

4. A host cell comprising the expression vector of claim 3.

5. The host cell of claim 4, wherein the host cell is a prokaryotic cell.

6. The host cell of claim 5, wherein the host cell is an E.coli or Agrobacterium cell.

7. The use of the promoter of claim 1, the gene expression cassette of claim 2, the expression vector of claim 3, the host cell of any one of claims 4-6 for regulating the development of a dermatome.