CN111909912A

CN111909912A - MAP3K-19 gene for improving high-temperature tolerance of rice in heading stage, protein obtained by encoding same and application thereof

Info

Publication number: CN111909912A
Application number: CN202010953189.1A
Authority: CN
Inventors: 陈薇兰; 陈非凡; 樊世军; 范文星; 袁华; 涂斌; 马炳田; 王玉平; 钦鹏; 李仕贵
Original assignee: Sichuan Agricultural University
Current assignee: Sichuan Agricultural University
Priority date: 2020-09-11
Filing date: 2020-09-11
Publication date: 2020-11-10
Anticipated expiration: 2040-09-11
Also published as: CN111909912B

Abstract

The invention discloses a MAP3K-19 gene for improving the high-temperature tolerance of rice in the heading stage, and a protein obtained by encoding the gene and application thereof. The nucleotide sequence of the gene is shown as SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown as SEQ ID NO. 2. The invention provides a new high-temperature resistant related gene of the rice panicle stage, and provides a new genetic resource for breeding of rice high-temperature resistant breeding and breeding of a rice temperature-sensitive sterile line.

Description

MAP3K-19 gene for improving high-temperature tolerance of rice in heading stage, protein obtained by encoding same and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a MAP3K-19 gene for improving the high-temperature tolerance of rice in the ear stage, and a protein obtained by encoding the same and application thereof.

Background

In recent years, high temperature heat damage has been more frequent in rice regions around the world, and studies on high temperature have been receiving attention from researchers, but genetic studies on heat resistance have been progressing slowly because heat resistance of crops are complex quantitative traits and identification and evaluation indexes are difficult to unify (Zhao, c., et al, 2016). At present, high temperature resistant mechanism research in rice reports that high temperature related genes mainly relate to a heat shock protein family, transcription factors, various enzymes and the like (Ai-Li Qu and the like, 2013).

Among many signal pathways, the MAPK signal pathway is a very conservative and classical tertiary kinase signal cascade pathway in eukaryotes, and consists of MAP3K-MAP2K-MAPK, which is mainly responsible for helping an organism to transmit a cell surface signal to intracellular downstream response molecules through cascade amplification of sequential phosphorylation when the organism is stressed by the outside, and finally regulating and controlling downstream gene expression to respond to the outside adversity (tympana et al, 2009). The genes belonging to the pathway are many in rice, and most of the genes are reported to participate in adversity stress response, such as OsMPK15(Hong et al, 2019), OsMPK6(Shen et al, 2010) for negatively regulating rice blast and bacterial blight resistance of rice, OsMPK12, OsMPK17 and OsMPK13 for negatively regulating brown planthopper immune response of rice (Hu et al, 2011), and OsMPK14 induced by various adversity stresses such as high salt and low temperature (Liangwei red et al, 2010). To date, there is no clear report that MAPK pathway genes participate in the high temperature stress pathway.

Disclosure of Invention

Aiming at the defects in the prior art, the invention provides the MAP3K-19 gene for improving the high temperature tolerance of the rice at the heading stage, the protein obtained by coding the gene and the application thereof, the biological function of the MAP3K gene MAP3K-19 is analyzed for the first time in the rice from the perspective of reverse genetics, and a transgenic experiment proves that the gene participates in the way of regulating the high temperature tolerance of the rice at the heading stage, so that new genetic resources are provided for the high temperature resistant breeding of the rice and the breeding of the temperature sensitive sterile line of the rice.

In order to achieve the purpose, the technical scheme adopted by the invention for solving the technical problems is as follows:

an application of MAP3K-19 gene in improving the high-temperature tolerance of rice in the ear stage is disclosed, the nucleotide sequence of the gene is shown in SEQ ID NO. 1.

Furthermore, the amino acid sequence of the protein coded by the gene is shown in SEQ ID NO. 2.

The application of the gene in rice germplasm resource improvement.

The application of the gene in culturing thermosensitive sterile rice.

An expression vector containing the gene.

A preparation for improving high-temperature tolerance of rice in heading stage comprises the protein.

A gene chip comprises a specific primer for detecting MAP3K-19 gene, and the nucleotide sequence of the specific primer is shown in SEQ ID No. 3-4.

A kit for screening high-temperature resistant rice in a heading stage comprises specific primers shown as SEQ ID No. 3-4.

The invention has the beneficial effects that:

1. the invention obtains possible function-conservative new genes by a protein sequence homology comparison mode in rice, knocks out the genes by using a CRISPR/Cas9 system under the background of japonica rice, and identifies the phenotype by combining a new high-temperature identification system, finally provides new high-temperature-resistant related genes, and provides a good research basis for high-temperature-resistant research of rice.

2. The gene belongs to a new ear period high temperature resistance related gene in rice, and provides a new genetic resource for high temperature resistance breeding of rice.

3. The invention establishes a mature spike-stage high-temperature-resistant identification program and method, and provides a scientific research method for the high-temperature-resistant identification of rice.

Drawings

FIG. 1 is a tree analysis of the MAP3K family protein in rice according to a first embodiment of the present invention;

FIG. 2 is the spatiotemporal expression pattern of MAP3K-19 gene in the first embodiment of the present invention;

FIG. 3 is a diagram showing a MAP3K-19 gene editing vector in example II of the present invention;

FIG. 4 is a diagram showing a target site for the knockout of MAP3K-19 according to a second embodiment of the present invention;

FIG. 5 is a schematic view of high temperature processing conditions in the third embodiment of the present invention;

FIG. 6 shows the high temperature treatment setting percentage change after the MAP3K-19 gene knockout in the round-grained rice background in the third embodiment of the present invention.

Detailed Description

The following description of the embodiments of the present invention is provided to facilitate the understanding of the present invention by those skilled in the art, but it should be understood that the present invention is not limited to the scope of the embodiments, and it will be apparent to those skilled in the art that various changes may be made without departing from the spirit and scope of the invention as defined and defined in the appended claims, and all matters produced by the invention using the inventive concept are protected.

The first embodiment is as follows: MAP3K family protein sequence homology alignment analysis

1. Homologous Gene sequence acquisition

Protein sequence Rice was derived from Rice Genome Annotation Project (http:// Rice. plant biology. msu. edu). In the rice, 23 total, ID number and name are as follows, LOC Os04g35700| MAP3K.16, LOC Os02g35010| MAP3K.9, LOC Os11g10100.2| MAP3K.3, LOC Os04g47240| MAP3K.17, LOC Os02g44642| MAP3K.10, LOC Os07g MAP 07 | MAP3K.20, LOC Os03g55560.2| MAP3K.15, LOC Os04g56530| MAP3K.1, LOC Os02g53040| MAP3K.11, LOC Os03g 640| MAP.14, LOC Os03g 70| MAP3K.12, LOC 03g18170| MAP K.13, LOC Os 21700 g | MAP3 | 8, MAP | 10| MAP 3g 4970 | MAP3K.12, MAP 181g 01 | MAP3K | 1, MAP 01 | 1 | MAP3K | 1, MAP3K | 1 | 10g, MAP3K | 1, MAP3K | 1 | 3K | 11, MAP | 10g | 1 | mP 3K | 1, MAP | 3K | 1 | 3g | 1, MAP | 3K | 3g | 3K | 3, MAP 3g | 3, MAP | 3g | 3, MAP 3g | 3K | 3, MAP 3g | 3.

2. Evolution tree making

The homologous protein sequences were aligned using Clustal Omega (https:// www.ebi.ac.uk/Tools/msa/clustalo /) and a phylogenetic tree was created using MEGA 5.1. The sequence analysis result is shown in figure 1, the number of MAP3K genes in rice is 23, the MAP3K-19 is selected to be researched, and whether the genes have specific biological functions is firstly verified through designing a knockout experiment.

3. Expression profiling

Using designed qPCR primers:

U800:GCAATGGACGAGGGTGCGGA；(SEQ ID NO.3)

U801:TGCGGCGAGCTCAGCCCGG；(SEQ ID NO.4)

after materials are taken from different parts of rice in different periods of development, the expression level of the MAP3K-19 gene is respectively detected, the result is shown in figure 2, the gene is expressed in the whole growth period, particularly in leaves and ears of a booting period, the expression is stronger, and therefore the gene is suggested to possibly play a certain function in the development process of the ear period.

Example two: construction of MAP3K-19 Gene editing vector

1. Gene editing site design

According to the existing CRISPR/Cas9 construction method in the laboratory, a GTGCGCGAGGTGGGCGGATTCGG sequence containing CGG as a recognition site is selected on the first exon of MAP3K-19 to be used as a knockout target site of MAP3K-19 (figure 2), and a loss-of-function transgenic plant is expected to be obtained to clarify the gene function of MAP 3K-19.

CRISPR/Cas9 vector construction

Mixing 5 mul of primers before and after a10 mu M target site, annealing at 99 ℃ for 5min to obtain a sequence containing a double-stranded knockout site, connecting the sequence of the target site to an intermediate vector pYLsgRNA-OsU6a by using Bas1(NEB company) while enzyme digestion (37 ℃), then combining universal amplification primers CTCCGTTTTACCTGTGGAATCG(UF) and CGGAGGAAAATTCCATCCAC (gR) with a rear primer and a front primer of the target site respectively, obtaining a large fragment and a small fragment containing the target site from the intermediate vector pYLsgRNA-OsU6a through PCR amplification, then fusing the two fragments through once overlapping, and finally connecting the fused fragment to a final vector pyLCrispr/Cas9P35S-N (15011bp) by using Bas1(NEB company) while enzyme digestion (37 ℃) for 3 hours, wherein the constructed final vector is shown in FIG. 3.

3. Transformation of E.coli

Taking out Escherichia coli T1 competent (whole gold) from-80 ℃, then placing on ice for thawing, quickly adding the ligation product in the previous step after the cell is dissolved, gently mixing by using a pipette, standing on ice for 30 minutes, then thermally shocking at 42 ℃ for 30 seconds, standing on ice again for 2 minutes, then adding 10 times of LB non-resistant culture solution into the transformation product, culturing at 37 ℃ for 50 minutes at 200rpm, taking out, centrifuging at 4000rpm, removing most of supernatant, re-suspending the thallus by using residual liquid (about 100 mu L), plating (LB + kanamycin resistance), standing and culturing at 37 ℃ overnight, picking out a single colony for expanding and culturing for 3mL (LB + kanamycin resistance), and sequencing by using a universal primer (SP-L1: GCGGTGTCATCTATGTTACTA) to verify a target site sequence to obtain a positive clone.

4. Agrobacterium transformation

Agrobacterium EHA105 cell competence (prepared by a chemometrics method) is taken out from-80 ℃, placed on ice for unfreezing, added with 2 microliter of positive clone plasmid, placed on ice for 30 minutes after being gently mixed, frozen in liquid nitrogen for 2 minutes, quickly taken out and placed in a metal bath at 37 ℃ for cell lysis for 2 minutes, then 10 times of LB non-resistant culture solution is added into a transformation product, cultured for 2-3 hours at 28 ℃ and 250rpm, taken out, centrifuged at 5000rpm, most of supernatant is removed, the thallus is resuspended in residual liquid (about 100 microliter), plated (LB + rifampicin + kanamycin), a single clone colony is picked after overnight standing culture at 28 ℃, detected by G418 primer to obtain positive clone, and 3mL of amplified culture (LB + rifampicin + kanamycin) is used for standby.

5. Genetic transformation of rice

Taking about 500 Japanese nitrile seeds, sequentially cleaning sterile water and 50% sodium hypochlorite, then sucking water from filter paper, and inducing callus generation by using an NMB culture medium; then, carrying out enlarged culture on the standby agrobacterium tumefaciens bacterial liquid by 50mL, collecting the thallus at 5000rpm, then, resuspending the thallus by using an AAM liquid culture medium added with AS (acetosyringone), then, infiltrating the selected callus in the environment of the resuspended thallus for about 30 minutes, then, sucking out the thallus, and continuously culturing the callus on the culture medium for 2 days; respectively cleaning the cultured callus sterile water and the sterile water containing the cefamycin, and then placing the cleaned callus sterile water and the sterile water on a selective culture medium for about three weeks; and finally, continuously inducing the callus to take root by using a differentiation culture medium respectively, and hardening the seedling indoors when the height of the seedling is about 10cm to prepare subsequent detection and transplantation.

Example three: MAP3K-19 gene edition under japonica rice Nipponbare background

1. Transgenic seedling detection

Agrobacterium infection transformation to obtain 15 seedlings, detecting vector transformation condition by using G418, amplifying sequences in all positive single transformed plants by using amplification primers U524(GGACGTGGCCAGGGGGCTCG) + U525(CATGTCGCTCCACGGC) crossing target sites, and then sending the amplified sequences to a sequencing company of department of pronoun for sequencing, wherein the results are shown in figure 4, and the obtained sequences are compared and analyzed to obtain 1 knock-out plant with protein translation termination in advance.

2. Phenotypic survey

In the planting of T1 generation, the transgenic plant is planted in 3 times of field experiments repeatedly, each time 2 rows are planted repeatedly, and the stable mutation of the target site is confirmed by sequencing detection. When the agronomic characters are inspected, the boundary lines and the mixed plants are repeatedly removed, 5-10 stable lines are selected, the agronomic characters of the single plants are inspected, and statistical analysis is carried out. The result shows that the agronomic characters of the knock-out descendants of the stable strains have almost no obvious change.

3. High temperature treatment in ear stage

Considering that the gene may be largely associated with plant adversity stress response, and an expression profile experiment shows that the gene is highly expressed in the process of spike development, a spike-stage high-temperature treatment experiment is firstly designed (the treatment conditions are shown in FIG. 5). After the high-temperature treatment of 2 days in the flowering period, the statistical result of the single spike seed setting rate of the offspring shows (as shown in figure 6), and the seed setting of the knockout strain is greatly reduced compared with that of the wild type. Therefore, the MAP3K-19 gene is probably a new spike-stage high-temperature resistant gene.

Sequence listing

<110> Sichuan university of agriculture

<120> MAP3K-19 gene for improving high-temperature tolerance of rice in heading stage, protein obtained by encoding same and application thereof

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1326

<212> DNA

<213> Rice (Oryza sativa)

<400> 1

atggcggtgg cggtggcggc ggcggcggcg gtgagcaggc aatggacgag ggtgcggacg 60

ctggggcgcg gggcgtccgg ggcggaggtg ttcctggcgg cggacgacgc gtcgggggag 120

ctgttcgccg tcaagtccgt gggcgcggcg ggcgcggcgg cgctgaggcg ggagcagggg 180

gtgatggccg ggctgagctc gccgcacgtc gtcccctgca tcggcggacg cgtggggcgc 240

gacgggtcgt accagatgtt cctcgagttc gcccccggcg ggtcgctcgc cgacgtggcg 300

gcgaggtgcg gcgggcggat ggaggagtgc gccgtcgggg agtacgcggt ggacgtggcc 360

agggggctcg cgtacctcca cgggatgggg ctggtgcacg gggacgtcaa ggcgaggaat 420

gtcgtgatcg gcggcgacgg ccgggcgaag ctcgcggact tcgggtgcgc gaggtgggcg 480

gattcgggcc ggccgatcgg cggcacgccg gcgttcatgg cgcccgaggt cgcgcgcggg 540

gaggagcaga gcccagccgc cgacgtctgg gcgctcggct gcacggtcat cgagatggcc 600

accggccgcg cgccgtggag cgacatggac gacgtgctcg cggcggtgca ccggattggc 660

tacacggagg ccgtccccga ggtccccggt tggctgtccg ccgacgcgaa ggacttcttg 720

gccaggtgct tgcaacggcg ccccattgac cggagcacgg cggcgcagct gctagaacac 780

ccgttcgtcg cctccgccgc cggcgacggc aagccggagg ccgcgaagtc caaatgggtg 840

tcccccaaga gcaccctgga cgccgcattg tgggagtccg acaccgacga ggaggaagac 900

gacgagctgt cgcagagcac ggccgagagg atcggttcac tggcctgcgc cgcctcgtcg 960

ctgccggatt gggactccga cgacggctgg atcgatgtga tctccacccc taccgaagaa 1020

tcctgcgaga ccaccacctc gccggccgac gaggagacga cgactgacct caacggcgac 1080

atcagaaccg cagaattcga gcttccccac attgacgtgg acagcggcaa tggcaacacc 1140

acccacaatg tgggagaagc caatgctcag cacattattt ccccttcgaa tttagttttc 1200

gatcaagtac tatgtaaaac accattttgt aacaaacaca ttgcaattga attcatacca 1260

tgttttctcc tcacaaatgt ttttctcccc ctttcgctgc tctgttcata cgctcctcac 1320

ccttag 1326

<210> 2

<211> 441

<212> PRT

<213> Rice (Oryza sativa)

<400> 2

Met Ala Val Ala Val Ala Ala Ala Ala Ala Val Ser Arg Gln Trp Thr

1 5 10 15

Arg Val Arg Thr Leu Gly Arg Gly Ala Ser Gly Ala Glu Val Phe Leu

20 25 30

Ala Ala Asp Asp Ala Ser Gly Glu Leu Phe Ala Val Lys Ser Val Gly

35 40 45

Ala Ala Gly Ala Ala Ala Leu Arg Arg Glu Gln Gly Val Met Ala Gly

50 55 60

Leu Ser Ser Pro His Val Val Pro Cys Ile Gly Gly Arg Val Gly Arg

65 70 75 80

Asp Gly Ser Tyr Gln Met Phe Leu Glu Phe Ala Pro Gly Gly Ser Leu

85 90 95

Ala Asp Val Ala Ala Arg Cys Gly Gly Arg Met Glu Glu Cys Ala Val

100 105 110

Gly Glu Tyr Ala Val Asp Val Ala Arg Gly Leu Ala Tyr Leu His Gly

115 120 125

Met Gly Leu Val His Gly Asp Val Lys Ala Arg Asn Val Val Ile Gly

130 135 140

Gly Asp Gly Arg Ala Lys Leu Ala Asp Phe Gly Cys Ala Arg Trp Ala

145 150 155 160

Asp Ser Gly Arg Pro Ile Gly Gly Thr Pro Ala Phe Met Ala Pro Glu

165 170 175

Val Ala Arg Gly Glu Glu Gln Ser Pro Ala Ala Asp Val Trp Ala Leu

180 185 190

Gly Cys Thr Val Ile Glu Met Ala Thr Gly Arg Ala Pro Trp Ser Asp

195 200 205

Met Asp Asp Val Leu Ala Ala Val His Arg Ile Gly Tyr Thr Glu Ala

210 215 220

Val Pro Glu Val Pro Gly Trp Leu Ser Ala Asp Ala Lys Asp Phe Leu

225 230 235 240

Ala Arg Cys Leu Gln Arg Arg Pro Ile Asp Arg Ser Thr Ala Ala Gln

245 250 255

Leu Leu Glu His Pro Phe Val Ala Ser Ala Ala Gly Asp Gly Lys Pro

260 265 270

Glu Ala Ala Lys Ser Lys Trp Val Ser Pro Lys Ser Thr Leu Asp Ala

275 280 285

Ala Leu Trp Glu Ser Asp Thr Asp Glu Glu Glu Asp Asp Glu Leu Ser

290 295 300

Gln Ser Thr Ala Glu Arg Ile Gly Ser Leu Ala Cys Ala Ala Ser Ser

305 310 315 320

Leu Pro Asp Trp Asp Ser Asp Asp Gly Trp Ile Asp Val Ile Ser Thr

325 330 335

Pro Thr Glu Glu Ser Cys Glu Thr Thr Thr Ser Pro Ala Asp Glu Glu

340 345 350

Thr Thr Thr Asp Leu Asn Gly Asp Ile Arg Thr Ala Glu Phe Glu Leu

355 360 365

Pro His Ile Asp Val Asp Ser Gly Asn Gly Asn Thr Thr His Asn Val

370 375 380

Gly Glu Ala Asn Ala Gln His Ile Ile Ser Pro Ser Asn Leu Val Phe

385 390 395 400

Asp Gln Val Leu Cys Lys Thr Pro Phe Cys Asn Lys His Ile Ala Ile

405 410 415

Glu Phe Ile Pro Cys Phe Leu Leu Thr Asn Val Phe Leu Pro Leu Ser

420 425 430

Leu Leu Cys Ser Tyr Ala Pro His Pro

435 440

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gcaatggacg agggtgcgga 20

<210> 4

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tgcggcgagc tcagcccgg 19

Claims

The application of the MAP3K-19 gene in improving the high temperature tolerance of rice in the ear stage is characterized in that the nucleotide sequence of the gene is shown as SEQ ID NO. 1.
2. The use of claim 1, wherein the amino acid sequence of the protein encoded by the gene is as shown in SEQ ID No. 2.
3. The application of the gene of claim 1 in rice germplasm resource improvement.
4. The application of the gene of claim 1 in cultivating temperature-sensitive sterile rice.
5. An expression vector comprising the gene of claim 1.
6. An agent for improving high temperature tolerance at heading stage of rice, comprising the protein of claim 2.
7. A gene chip is characterized by comprising a specific primer for detecting a MAP3K-19 gene, wherein the nucleotide sequence of the specific primer is shown as SEQ ID No. 3-4.
8. A kit for screening high-temperature resistant rice in a heading stage is characterized by comprising specific primers shown as SEQ ID No. 3-4.