CN111620935B - Application of ZmCEP1 gene in regulation and control of corn kernel development - Google Patents

Abstract

The invention discloses application of ZmCEP1 gene in regulating and controlling corn kernel development. The invention provides an application of any one of the following 1) -3) in regulating and controlling plant seed development; 1) Protein ZmCEP1; 2) A DNA molecule encoding the protein ZmCEP1; 3) Recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing a DNA molecule encoding the protein ZmCEP 1. The invention uses CRISPR-Cas9 method to mutate ZmCEP1 gene, which can obviously increase the grain width and hundred grain weight of corn grains.

Description

Application of ZmCEP1 gene in regulation and control of corn kernel development

Technical Field

The invention belongs to the technical field of biology, and particularly relates to application of ZmCEP1 gene in regulation and control of corn kernel development.

Background

Corn is the first main grain crop with the yield and sowing area in China, is an important grain and feed source, is an important industrial raw material, and plays a very important role in the whole national economy. As the population continues to increase and the cultivated area continues to decrease, and as the living standard of people continues to increase, the demand for corn will continue to increase, and how to increase the yield per unit area of corn quickly remains an important issue. The traditional crop breeding mode can not meet the increasing demand of grains nowadays, related genes involved in regulating and controlling the crop yield traits are searched by utilizing molecular biological means, the functions of the genes are explored, and the genes are utilized by means of genetic engineering, so that the method becomes a main mode for improving the crop yield.

The seed of higher plants consists of embryo, endosperm and seed coat 3 parts (Dong Qingkun and Liu Huili 2015), the seed size is a complex agronomic trait, subject to such things as: genetic level, hormone concentration, and environmental factors. At the genetic level, seed size is typically regulated by a series of genes or Quantitative Trait Loci (QTL) that are involved in regulating the development of embryo, endosperm and seed coat, regulating the proliferation period and elongation of embryo cells, endosperm cells and integument cells, affecting plant seed size and crop yield (Fatihi et al 2013).

Rice is a model plant for research of gramineous crops, and therefore has important significance for research of the size and yield of rice kernels. In rice, the size of the seeds is mainly controlled by factors such as the length, width, thickness, compactness and the like of the seeds, and the size of the seeds is an important agronomic property for determining the yield. Genes affecting grain size have been identified and cloned in rice at present, including GS3, GW2, GW5, GIF1, GS5, GW8, qSW5, qGL3, TGW6, WTG1 and GGC2, etc. (Xing and Zhang 2010,Huang et al.2017,Liu et al.2017,Sun et al.2018).

The corn yield constituting factors mainly comprise three elements of effective spike number, spike grain number and hundred grain weight per mu (Qin et al 2015). Wherein, hundred grain weight has higher genetic ability and is an important selection character in the corn breeding process. The hundred grain weight is affected by the secondary properties of three grains, namely grain length, grain width and grain thickness. In maize, several genes involved in controlling grain development, including CNR (Cell Number Regulator), dek, UBL1, zmPLA1 and DA1 (Xie et al 2017) and the like (Guo et al 2010, chen et al 2017, li et al 2017, sun et al 2017) were identified using strategies such as mutant analysis and homologous gene cloning

The size of the seeds is also affected by the phytohormones. The traditional plant hormone mainly refers to auxin, cytokinin, gibberellin, abscisic acid, ethylene, brassinolide and the like, and has extremely important effects on plant growth, development, aging, dormancy and stress resistance. Recent studies have found that plant polypeptide hormones are also involved in the regulation of various aspects of plant growth and development (Butenko et al 2009). Plant polypeptide hormone is a mature polypeptide with special functions after being sheared, and the length of the plant polypeptide hormone is generally about 20 amino acids, and the length of the plant polypeptide hormone is less than about 120 amino acids. Plant polypeptide hormones play an important role in cell-to-cell information transfer. Since 1991, PEARCE et al discovered a plant polypeptide hormone in tomato, and research on plant polypeptide hormone has made a continuous breakthrough, and new polypeptide hormone has been continuously discovered. However, there are few reports on the study of polypeptide hormones in maize (Sui et al 2016).

Disclosure of Invention

It is an object of the present invention to provide the use of any of the following 1) -3).

The invention provides an application of any one of the following substances 1) -3) in regulating and controlling plant seed development:

1) Protein ZmCEP1;

2) A DNA molecule encoding the protein ZmCEP1;

3) Recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing a DNA molecule encoding the protein ZmCEP1;

the protein ZmCEP1 is (1) or (2) as follows:

(1) A protein consisting of an amino acid sequence shown as a sequence 2 in a sequence table;

(2) And (3) the protein which is derived from the (1) and has the same function and is obtained by substituting and/or deleting and/or adding one or more amino acid residues for the amino acid sequence shown in the sequence 2 in the sequence table.

The plant seed development is regulated and controlled to inhibit the plant seed development.

The use of substances which inhibit the expression or activity of ZmCEP1 proteins for promoting plant kernel development is also within the scope of the present invention;

or inhibiting the expression or activity of ZmCEP1 protein coding gene, is also the scope of the present invention.

In the above application, the promotion of plant grain development is to increase grain hundred weight and/or increase grain width.

In the above application, the plant is a monocotyledonous plant or a dicotyledonous plant.

In the above application, the monocot is maize.

In the above application, the substance that inhibits the expression or activity of the ZmCEP1 gene is a substance that mutates the ZmCEP1 gene.

In the application, the substance of the mutant ZmCEP1 gene is a CRISPR/Cas9 system, and/or the CRISPR/Cas9 system is a recombinant vector for expressing gRNA and Cas 9;

and/or the target sequence of the gRNA is a sequence 3 in a sequence table;

and/or the gRNA is RNA coded by a sequence 3 in a sequence table.

It is another object of the present invention to provide a method for obtaining transgenic plants with improved grain development status.

The method provided by the invention comprises the following steps: inhibiting the expression or activity of ZmCEP1 protein in the target plant to obtain transgenic plant;

or inhibiting the expression or activity of the ZmCEP1 protein coding gene in the target plant to obtain a transgenic plant;

the grain development state of the transgenic plant is better than that of the target plant.

In the method, the inhibition of the expression or activity of the ZmCEP1 protein in the target plant or the inhibition of the expression or activity of the ZmCEP1 gene in the target plant is the mutation of the ZmCEP1 gene in the target plant;

and/or, the ZmCEP1 gene in the mutant plant of interest is performed by a CRISPR/Cas9 system;

and/or, the CRISPR/Cas9 system is a recombinant vector expressing a gRNA and Cas 9;

and/or the target sequence of the gRNA is a sequence 3 in a sequence table;

and/or the gRNA is RNA coded by a sequence 3 in a sequence table.

In the above method, the transgenic plant has better grain development state than the target plant is 1) and/or 2):

1) The grain hundred of the transgenic plant is bigger than the target plant;

2) The grain width of the transgenic plant is larger than that of the target plant;

and/or, the plant is a monocot or dicot;

and/or, the monocot is maize.

Experiments prove that the ZmCEP1 gene is mutated by using a CRISPR-Cas9 method, and the mutant can be found to obviously increase the grain width and the hundred grain weight of corn grains.

Drawings

FIG. 1 is a sequence alignment.

FIG. 2 is a representation of T2-transformed ZmCEP1-gRNA maize kernel phenotypes.

FIG. 3 is a representation of T3 generation ZmCEP1-gRNA maize kernel phenotyping.

Detailed Description

The experimental methods used in the following examples are conventional methods unless otherwise specified.

Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

The nucleotide sequence of the ZmCEP1 gene is sequence 1, and the amino acid sequence of the coded protein ZmCEP1 is sequence 2.

Example 1 application of ZmCEP1 Gene in regulating corn grain development

1. Construction of maize CRISPR/Cas9 System vector

1. Design of ZmCEP1 Gene gRNA

Firstly, a coding sequence of gRNA is designed near a structural domain region of a ZmCEP1 gene by using a website http:// www.e-CRISP. Org/E-CRISP/index. Html: CGAGCACTGAGCAGGTCGTCGG (SEQ ID NO: 3).

Submitting the sequence to a corn functional genome platform of China agricultural university for preliminary detection, wherein the detection result shows that: the gRNA can be used as a carrier of a CRISPR/Cas9 system of a ZmCEP1 gene.

2. gRNA sequence amplification

1) Primers containing a linker (Cas 9-1b-F and Cas9-1 b-R) were designed from the gRNA sequence:

Cas9-1b-F：GGCGGCGCCTTCTTGCCGCACGC

Cas9-1b-R：AAACGCGTGCGGCAAGAAGGCGC

2) The reaction system of phosphorylation and primer annealing is as follows:

after gentle mixing, the reaction was performed: 30min at 37 ℃; cooling from 95 ℃ to 25 ℃ at a speed of 5 ℃/min after 5min at 95 ℃ to obtain an annealing product.

3. Construction of recombinant vectors

1) The vector of interest pBUN411 (Hui-Li Xing et al, A CRISPR/Cas9 toolkit for multiplex genome editing in plants [ J ], BMC Plant Biology 2014,14:327; the vector expresses cas9 protein) is subjected to single enzyme digestion, and the system is as follows:

the enzyme was heat inactivated at 37℃for 1h and then at 65℃for 20 min.

2) The resulting digested product was subjected to electrophoresis on a 1% agarose gel, and a large fragment of vector pBUN411 was recovered.

3) Ligation and E.coli transformation

The annealed product of the above 2 was ligated to the above vector pBUN411 large fragment to obtain a recombinant vector.

The recombinant vector is obtained by inserting the annealing product of the above 2 into BsaI sites of the pBUN411 vector, and is named as pBUN411-ZmCEP1-gRNA, the vector expresses gRNA encoded by the sequence 3, and the vector is CRISPR/Cas9 vector.

2. Transgenic corn obtained by transferring CRISPR/Cas9 system vector into corn

1. Preparation of recombinant Agrobacterium

The CRISPR/Cas9 vector pBUN411-ZmCEP1-gRNA prepared in the above way is introduced into agrobacterium EHA105 to obtain recombinant agrobacterium EHA105/pBUN411-ZmCEP1-gRNA.

2. Construction of ZmCEP 1-gRNA-transformed maize

1) ZmCEP 1-gRNA-transformed corn

The recombinant agrobacterium EHA105/pBUN411-ZmCEP1-gRNA was transferred into wild maize B73 (The U6 Biogenesis-Like 1Plays an Important Role in Maize Kernel and Seedling Development by Affecting The 3'End Processing of U6snRNA[J, mol Plant) to obtain T0 generation ZmCEP1-gRNA transformed maize.

2) PCR detection of ZmCEP 1-gRNA-transformed corn positive seedlings

According to the gene position of gRNA, primers are designed at about 300bp upstream and downstream respectively, and the sequences of the primers are as follows:

Cas9-test-F:ATGGCGGCCAGTTCCAAGGT

Cas9-test-R:CTAGTTGTTGATCTTCCCTT

the CTAB method is used for extracting the corn leaf DNA of the T0 generation to ZmCEP1-gRNA in a trace way as a template, and Cas9-test-F and Cas9-test-R are used as primers for PCR amplification to obtain 309bp PCR amplification products. Wild type maize B73 was used as a control.

The 309bp PCR amplified product of the T0 generation ZmCEP1-gRNA corn and the 309bp PCR amplified product of the wild corn are sequenced and the sequences are aligned.

The result is shown in FIG. 1A, FIG. 1A shows the comparison result of the nucleotide sequences of the wild type and the mutant of the ZmCEP1 gene, and the red frame is the mutation site; it can be seen that there are two mutant forms of T0 transgenic plants obtained together by CRISPR-CAS 9.

PCR amplification is carried out on the transgenic plant and the wild corn target segment, then sequencing is carried out for sequence comparison, and if the transgenic plant and the wild corn target segment are different from each other, the transgenic plant and the wild corn target segment are positive plants.

The results showed that 3 positive T0-generation ZmCEP1-gRNA corn were obtained in total.

The 309bp PCR amplified products of 3 positive T0 generation ZmCEP1-gRNA corn and wild corn are translated into polypeptide and amino acid sequences are aligned.

The results are shown in FIG. 1B, FIG. 1B shows the comparison of the wild type and mutant amino acid sequences of ZmCEP1 gene, and the red frame shows the polypeptide domain.

3) Maize genetic transformation and offspring identification of ZmCEP1 Gene

Seeds harvested from positive T0 generation ZmCEP1-gRNA corn single plants are planted into T1 generation ZmCEP1-gRNA corn plant lines, and PCR amplification is carried out by using Cas9-test-F and Cas9-test-R specific primer pairs.

Sequencing the obtained PCR products, and finding that the ZmCEP1 gene sequence of each T1 generation ZmCEP 1-gRNA-transformed corn is mutated in the same way as that of the T0 generation ZmCEP 1-gRNA-transformed corn.

By Bar primer pair: and (3) carrying out PCR amplification on the T1 generation ZmCEP1-gRNA maize plants with the WS-Bar-F TGCACCATCGTCAACCACTA and WS-Bar-RCTCGGTGACGGGCAGGAC mutation, and detecting the PCR products by running gel, wherein if the corn plants do not contain a band with the size of about 500bp, the corn plants are mutants of ZmCEP1 genes without vectors, namely positive T1 generation ZmCEP1-gRNA maize.

Seeds harvested from positive T1 generation ZmCEP1-gRNA corn single plants are planted into T2 generation ZmCEP1-gRNA corn plant lines, 2 lines are planted in each plant line, and 11 plants are planted in each line.

DNA molecules are detected by using primers Cas9-test-F and Cas9-test-R, and the ZmCEP1 gene sequencing of the T2 generation ZmCEP 1-gRNA-transformed corn discovers that the sequences are mutated in a mutation mode or a T0 generation mutation mode. It was demonstrated that these transgenic plants were already inbred.

Sowing the T2 generation ZmCEP 1-gRNA-transformed corn to obtain the T3 generation ZmCEP 1-gRNA-transformed corn.

3. Phenotypic identification of ZmCEP 1-gRNA-transformed maize

T2-to-ZmCEP 1-gRNA corn and T3-to-ZmCEP 1-gRNA corn are respectively planted in a Beijing Chinese agricultural university village test station and a south-to-third-China agricultural university south-to-be-bred base, the row length is 3m, the plant spacing is 0.25m, the row spacing is 0.5m, and normal field management is performed.

Each corn ear is self-pollinated. Harvesting corn ears one by one in a bagging manner by taking the corn ears as a unit after the corn ears are mature, insolating the corn ears in the sun for about 1 week until the corn ears are completely dried, threshing seeds uniformly and orderly growing in the middle of the corn ears manually, randomly selecting 100-300 seed kernels, and inspecting the properties such as the hundred-grain weight (HKW), the grain length (KL), the grain width (Lee et al) of the seed kernels by using a ten-thousand-seed appearance quality detection molecular system (Hangzhou ten-thousand-deep detection technology Co., ltd.).

1. T2-transformed ZmCEP1-gRNA corn kernel phenotypic analysis

The length, width and hundred grain weights of harvested T2 transformed ZmCEP1-gRNA corn cep1#1, #2 mature corn kernels were measured and compared. Wild type corn was used as a control.

As shown in fig. 2 and table 1, it can be seen that the T2-transformed ZmCEP1-gRNA maize lines (cep1#1, # 2) had grain widths increased by 2.52% and 2.56% respectively compared to wild-type maize, grain weights increased by 9.49% and 7.03% respectively compared to wild-type maize, and there was no significant difference in grain length compared to wild-type.

TABLE 1 measurement of hundred grain weight, grain width and grain length of corn grains transformed from T2 to ZmCEP1-gRNA

2. T3-transformed ZmCEP1-gRNA maize phenotyping

The length, width and hundred grain weight of the harvested T3 transformed ZmCEP1-gRNA corn mature corn grains were measured and compared. Wild type corn was used as a control.

As a result, as shown in FIG. 3 (A: hundred grain weight comparison analysis; B: grain width comparison analysis; C: grain length comparison analysis; D: corn grain phenotype) and Table 2, it was found that the grain widths of the T3-transformed ZmCEP1-gRNA corn lines (cep1#1, # 2) were increased by 3.95 and 2.97% respectively, the hundred grain weights were increased by 11.09% and 10.49% respectively, and the grain lengths were not significantly different from those of the wild type.

TABLE 2 measurement of hundred grain weight, grain width and grain Length of T3-transformed ZmCEP1-gRNA corn seeds

SEQUENCE LISTING

<110> Chinese university of agriculture

<120> application of ZmCEP1 gene in regulating and controlling corn kernel development

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 309

<212> DNA

<213> Artificial sequence

<400> 1

atggcggcca gttccaaggt cgtgtgcgca tgcattctca tcgttctcgt catctcaagc 60

cacgccgacg cgaggcggct ggtggcggcg acgtgcaacg gaacggaagg cggagcatgc 120

aagggtggca tcttcgtcca aggatatgca ggcctcagtg caaggcagaa aatggcggcc 180

actgcaacga gcactgagca ggtcgtcggc ggcggcggcg aaggcatgcc ggcgaccacc 240

acggactccc ggcctacggc tcccggcaac agccccggta ttggcaacaa agggaagatc 300

aacaactag 309

<210> 2

<211> 102

<212> PRT

<213> Artificial sequence

<400> 2

Met Ala Ala Ser Ser Lys Val Val Cys Ala Cys Ile Leu Ile Val Leu

1 5 10 15

Val Ile Ser Ser His Ala Asp Ala Arg Arg Leu Val Ala Ala Thr Cys

20 25 30

Asn Gly Thr Glu Gly Gly Ala Cys Lys Gly Gly Ile Phe Val Gln Gly

35 40 45

Tyr Ala Gly Leu Ser Ala Arg Gln Lys Met Ala Ala Thr Ala Thr Ser

50 55 60

Thr Glu Gln Val Val Gly Gly Gly Gly Glu Gly Met Pro Ala Thr Thr

65 70 75 80

Thr Asp Ser Arg Pro Thr Ala Pro Gly Asn Ser Pro Gly Ile Gly Asn

85 90 95

Lys Gly Lys Ile Asn Asn

100

<210> 3

<211> 22

<212> DNA

<213> Artificial sequence

<400> 3

cgagcactga gcaggtcgtc gg 22

Claims (2)

1. Application of a substance for inhibiting ZmCEP1 protein expression or activity in improving corn kernel width;

or inhibiting expression or activity of ZmCEP1 protein coding gene in improving corn kernel width;

the amino acid sequence of the protein ZmCEP1 is a sequence 2 in a sequence table;

the substance inhibiting the expression or activity of the ZmCEP1 gene is a substance mutating the ZmCEP1 gene;

the mutant ZmCEP1 gene is prepared by CRISPR/Cas9 system,

and/or, the CRISPR/Cas9 system is a recombinant vector expressing a gRNA and Cas 9;

and/or the target sequence of the gRNA is a sequence 3 in a sequence table;

and/or the gRNA is RNA coded by a sequence 3 in a sequence table.

2. A method of obtaining transgenic corn with increased grain width comprising the steps of: inhibiting the expression or activity of ZmCEP1 protein in the target corn to obtain transgenic corn;

or inhibiting the expression or activity of ZmCEP1 protein coding gene in the target corn to obtain transgenic corn;

the grain width of the transgenic corn is larger than that of the target corn;

the expression or activity of ZmCEP1 protein in the target corn is inhibited, or the expression or activity of ZmCEP1 gene in the target corn is inhibited, namely the ZmCEP1 gene in the target corn is mutated;

and/or, the ZmCEP1 gene in the mutant target corn is performed by a CRISPR/Cas9 system;

and/or, the CRISPR/Cas9 system is a recombinant vector expressing a gRNA and Cas 9;

and/or the target sequence of the gRNA is a sequence 3 in a sequence table;

and/or the gRNA is RNA coded by a sequence 3 in a sequence table.