CN114438082B - A DNA sequence and application for rapid identification of ecotypes related to flowering period and spring and winter habits of Triticum aestivum - Google Patents

Abstract

The invention discloses a DNA sequence and its application for rapid identification of ecotypes related to the flowering period and spring and winter habits of Triticum aestivum. The DNA sequence is a 21bp DNA sequence located in the promoter region of the VRN-A1 gene and has the following characteristics: SEQ ID The nucleotide sequence shown in No. 1. The present invention is the first identification of a 21bp DNA sequence in wheat crops that can be used to detect different ecological types of wheat. This sequence can be used for molecular marker development. According to the presence or absence of this 21bp DNA sequence in the promoter region of the VRN-A1 gene, most of the current wheat families can be divided into (biased) winter and (biased) spring according to flowering period and spring and winter habits, which is beneficial to Rapid identification of ecological types related to the flowering period of different wheat materials and their spring and winter habits. Gene editing technology can also be used to edit different base sites in the 21bp sequence according to needs to create materials of different growth stages.

Description

A method used to quickly identify ecotypes related to the flowering period and spring and winter habits of Triticum aestivum. DNA sequences and applications

Technical field

The invention belongs to the field of plant genetic engineering and discloses a new DNA sequence and its application in rapidly identifying ecotypes related to the flowering period and spring and winter habits of Triticum aestivum.

Background technique

Plant flowering is a very important biological phenomenon and is of great significance to the reproduction of sexually reproducing species. At the same time, the flowering period of crops is comprehensively affected by many factors such as growth temperature, light, nutrition, and moisture, which has a very important impact on crop yields. For a long time, this trait has been widely concerned by crop breeders and geneticists as a breeding target. Current research results show that plant (crop) flowering is comprehensively regulated by multiple factors such as genetics, epigenetics, physiology and biochemistry, and is a very complex biological process. At present, plant flowering is mainly regulated by the classic photoperiodic pathway, vernalization pathway, autonomic pathway, gibberellin (GA) pathway and age pathway. Among them, vernalization refers to the phenomenon that plants need to undergo a long period of low temperature exercise before they can bloom and bear fruit. Wheat is one of the world's major food crops. With the potential threats to crop yields caused by population and global climate change, wheat yield is one of the main factors affecting my country's and global food security production. Therefore, continuously increasing its yield is a modern molecule. One of the main goals of breeding. According to the type of vernalization, wheat can be mainly divided into two categories: spring wheat and winter wheat. Current research results on wheat flowering show that wheat flowering is mainly regulated by three vernalization genes, VRN1, VRN2 and VRN3/FT. At the same time, homologous multiple copies of the VRN1 gene in the wheat genome are also involved in the regulation of wheat flowering. The results of the regulatory network study of the three genes showed that the VRN2 gene mainly inhibits the expression of the gene VRN3/FT that promotes flowering, while the VRN1 gene can inhibit the expression of the VRN2 gene, thus releasing the inhibitory effect of the VRN2 gene on the expression of VRN3/FT and promoting VRN3/FT expression. Transcription of FT ultimately promotes wheat flowering. Therefore, changing the expression of the VRN1 gene in the wheat genome can directly affect wheat flowering time. The VRN1 gene is a type of transcription factors (TFs) belonging to the MADS-box family. It is homologous to the AP1 transcription factor family in the Arabidopsis genome. It mainly controls the transformation of plants from vegetative growth to reproductive growth, and also plays a role in the normal growth and development of plants. It has a certain regulating effect. Preliminary instructions indicate that it is possible to regulate the balance between nutritional and reproductive growth of wheat by regulating the spatiotemporal expression of the VRN1 gene, thereby increasing wheat yield. This provides an important theoretical reference for artificially editing this gene to increase wheat yield. In addition, the expression of the VRN1 gene is also regulated by temperature. Therefore, we can directly divide wheat into two categories: spring wheat and winter wheat based on the dependence of VRN1 gene expression on low temperature in the wheat genome. In this way, the VRN1 gene has the potential to be further developed into a molecular marker, thereby enabling rapid identification of the spring and winter habits of different wheat varieties or strains or germplasm.

Through sequence comparison analysis of the VRN1 gene in the genomes of wheat and barley of different ecological types, it was found that the first intron of the VRN1 gene is very conserved in different varieties and contains some cis-regulatory elements that respond to environmental factors such as temperature and light. . In addition, in addition to the introns of this gene, there are also abundant sequence variations in the promoter region of the VRN1 gene in different ecological wheat genomes, such as point mutations, small fragment insertions or deletions, etc. These results indicate that the coding region of the VRN1 gene is very conserved. The sequence differences in the first intron and promoter region have a very important impact on the VRN1 gene.

In eukaryotic genomes, gene expression mainly relies on the interaction between cis-regulatory elements and response factors to finely regulate the expression of related genes, thereby ensuring normal growth and development of individuals and coping with the influence of internal and external environmental stress factors. Current research results show that mutations in gene coding regions often cause drastic changes in gene expression, most of which are harmful changes. In contrast, DNA sequence polymorphisms in gene cis-regulatory elements can change the expression of related genes in space and time. and expression time, leading to different phenotypes in individuals. Therefore, cis-regulatory elements can be used as target sites for gene editing or artificial selection to cultivate or create individuals with target traits by changing polymorphisms in DNA sequences. At present, some research results have shown that the DNA sequence of the gene promoter plays a very important regulatory role in the expression of the VRN1 gene. However, the specific mechanism of how DNA sequence changes regulate the expression of the VRN1 gene is not very clear. In particular, the VRN1 gene promoter Can the DNA sequence of the sub-region be used to develop an efficient DNA molecular marker for large-scale wheat population screening to quickly identify wheat varieties or strains or germplasm with spring and winter habits to guide agricultural production. In addition, this molecular marker can be used as a target site for gene editing or artificial selection. By changing the polymorphism of the DNA sequence, new wheat varieties or strains or new germplasm with different flowering times can be cultivated or created for large-scale wheat agriculture. production or breeding.

Based on this goal, the present invention identified a 21bp DNA located in the promoter region of the VRN-A1 gene in the wheat genome for the first time by using the independently developed MH-seq technology (Zhao et al. 2020; Patent No.: 201910108157.9) combined with GWAS. sequence, which plays an important regulatory role in the expression of the VRN-A1 gene, thus affecting wheat flowering. It is a key functional element in regulating wheat flowering. This regulatory element can be used for rapid detection of wheat ecological types and breeding applications, greatly shortening the cycle of cultivating or creating agronomic traits related to wheat flowering period, and has important theoretical and practical application prospects and values.

Contents of the invention

The purpose of the present invention is to provide a small fragment DNA (21 bp) regulatory element and its application in rapidly identifying ecotypes related to the flowering period and spring and winter habits of Triticum aestivum. The small fragment DNA (21bp) regulatory elements screened by the present invention can quickly detect wheat ecological types, screen or create wheat varieties with shorter growth cycles or breeding intermediate materials, and be applied to wheat agricultural production.

The object of the present invention can be achieved through the following technical solutions:

A small fragment DNA regulatory element having a nucleotide sequence as shown in SEQ ID No. 1. The regulatory element is a 21bp DNA sequence located in the promoter region of the VRN-A1 gene: TGGAAGAGAGGGGAGGAGAGG.

First, the DNA fragment is specifically amplified by PCR. Secondly, the sequence is used as a marker, and the resequencing data is used to perform population scanning on different wheat varieties or germplasm results, thereby screening out wheat materials with changes in the DNA sequence in natural materials. , for further phenotypic investigation.

Expression cassettes, recombinant vectors, transgenic cell lines or transgenic recombinant bacteria containing the above-mentioned small fragment DNA regulatory elements.

The DNA sequence after gene editing of the above small fragment DNA regulatory element.

The above-mentioned small fragment DNA regulatory elements can be used to identify ecotypes related to the flowering period and spring and winter habits of wheat crops or in molecular breeding of wheat. As a preferred technical solution, specific primers are used to perform PCR amplification in different wheat population materials, and the spring and winter habits and flowering period of the tested materials are judged based on the presence or absence of the amplified fragments. Wheat varieties or strains that lack this fragment are It shows early flowering in spring, while the wheat varieties or strains containing this fragment show late flowering in winter or weak spring. The sequence of the specific primer is: F: GTGGTTGGGTGAGGACGT; R: CCTGCCGGAATCCTCGTT.

The above-mentioned expression cassettes, recombinant vectors, transgenic cell lines or transgenic recombinant bacteria containing small fragments of DNA regulatory elements can be used to identify ecotypes related to the flowering period and spring and winter habits of wheat crops or in molecular breeding of wheat.

The application of the above-mentioned DNA sequences after gene editing of small fragments of DNA regulatory elements in the cultivation (or creation) of new wheat varieties (or new germplasm) with changes in flowering period and spring and winter habits or in the study of molecular regulatory mechanisms. The 21bp DNA sequence can be gene edited through technologies such as CRISP to create or breed new wheat materials related to the flowering period, which can be used for wheat agricultural production or breeding and research on molecular regulatory mechanisms.

A method for identifying ecotypes related to the flowering period and spring and winter habits of wheat crops or molecular breeding of wheat. The method is any one of (1) to (4):

(1) By developing molecular markers or probes, the above-mentioned small fragment DNA regulatory elements are applied to the identification or screening of ecotypes related to important agronomic traits such as the flowering period of wheat crops and their spring and winter habits, so as to accelerate the process of wheat molecular breeding;

(2) Use the above-mentioned small fragment DNA regulatory elements as target sites for gene editing, and change or create new wheat germplasm or varieties with changes in flowering period and spring and winter habits through editing (base insertion, substitution and deletion, etc.) ;

(3) Use the above-mentioned small fragment DNA regulatory elements or edited DNA sequences to cultivate new wheat germplasm or varieties with changes in flowering period and spring and winter habits through genetic transformation methods (transgenic or transient expression, etc.);

(4) Cross and breed the selected natural wheat materials with changes in the above-mentioned small fragment DNA regulatory elements with other wheat varieties of different ecological types, thereby creating or cultivating new wheat materials related to the flowering period in a relatively short period of time. , used in wheat agricultural production or breeding.

Beneficial effects of the invention

The present invention is the first identification of a 21bp DNA sequence in wheat crops that can be used to detect different ecological types of wheat. At the same time, this sequence can be used for molecular marker development. The VRN-A1 transgenic vector that does not contain this 21bp DNA fragment is transferred into ordinary wheat to express the flowering gene in advance, resulting in early flowering of the transgenic material, thereby creating wheat varieties or strains with a shortened growth period. Gene editing technology can also be used to edit different base sites in the 21bp sequence according to needs to create materials of different growth stages. Therefore, it has very important production value and greatly promotes agricultural production.

Description of the drawings

Figure 1 shows the agarose gel electrophoresis results of the PCR amplification products of the VRN-A1 specific primer pair C22 and the Chinese Spring VRN-A1 promoter region.

Figure 2 shows the flowering period comparison results between wheat variety C22 containing a natural 21 bp sequence deletion and common Chinese spring (CS) wheat varieties.

Figure 3 shows the partial resequencing results of other wheat varieties or lines.

Detailed ways

The following examples facilitate a better understanding of the present invention, but do not limit the present invention. The experimental methods in the following examples are all conventional methods unless otherwise specified. The test materials used in the following examples were all purchased from conventional biochemical reagent stores unless otherwise specified.

Example 1 Designing specific primers to amplify the DNA sequence of the VRN-A1 promoter region in the wheat genome

Wheat is a monocotyledonous crop and its genome sequence has been assembled. The 21bp DNA sequence of the VRN-A1 gene promoter region was analyzed by the inventor based on the combination of MH-seq (Zhao et al. 2020) technology and GWAS. The sequence is: TGGAAGAGAGGGGAGGAGAGG.

This DNA fragment was cloned from the wheat genome into pMD19-T, sequenced and compared. The DNA fragment-specific primers (GTGGTTGGGTGAGGACGT) and R (CCTGCCGGAATCCTCGTT) were then used to perform PCR amplification in different wheat population materials, and the flowering habits and approximate flowering time of the tested materials were judged based on the presence or absence of amplified fragments.

The 21 bp sequence was amplified with VRN-A1 specific PCR primers to detect the polymorphism of the DNA sequence in the promoter region of the VRN-A1 gene between C22 wheat varieties and Chinese spring (CS) wheat varieties, as shown in Figure 1.

Example 2

Using this 21bp DNA sequence, combined with the resequencing results, we scanned different wheat populations and screened out wheat materials with changes in the sequence in the natural wheat population for flowering phenotype inspection. The main steps are as follows:

1) Obtain different types of wheat resequencing data from NCBI/EBI/GSA and other databases;

2) After the obtained resequencing data is processed for quality control such as removing adapters, use BWA comparison software to compare the resequencing data to the Chinese Spring reference genome V1.0;

3) Filter out resequencing results with alignment quality MAPQ<20;

4) Use GATK to perform indel calculation on high-quality alignment files and filter out low-confidence indel sites;

5) Select the 20 bp upstream and downstream of the indel site and the deletion point coordinate (chr5A:587423376) for correlation analysis. Based on the presence or absence of this 21 bp DNA sequence, combined with flowering phenotype observations, we can accurately determine the flowering habit of the tested wheat material. and flowering time. The wheat variety C22 was screened through resequencing data, and this 21bp sequence was deleted in the promoter region of its VRN-A1 gene. By comparing the flowering period of C22 with Chinese Spring (CS) wheat, it was found that C22 flowered 40 days earlier than CS wheat. Left, as shown in Figure 2. At the same time, we also compared the partial resequencing results of other wheat varieties or lines and found that there is indeed a strong correlation between the deletion of this fragment and early flowering, as shown in Figure 3.

There are currently a large number of wheat genomics databases, such as: Wheat Multi-omics Center and China Agricultural University SNP hubportal, which already contain prepared DNA sequence polymorphism information files. Therefore, through comparative analysis, VRNs in different wheat sequencing materials can be quickly obtained. -A1 gene promoter DNA sequence polymorphism information. By correlating with the flowering period of the corresponding material, it will provide effective target sites for artificial editing of the 21bp DNA sequence (base insertion, substitution and deletion, etc.) to create or breed new wheat varieties with different growth stages.

The present invention screens a brand-new DNA sequence and uses it to rapidly identify ecotypes related to important agronomic traits such as the flowering period of Triticum aestivum and its spring and winter habits, so as to provide suitable new wheat varieties and new germplasm for different wheat ecological planting areas. Material. This sequence is found in hexaploid wheat, but it is also abundant in tetraploid wheat and is common. Therefore, this DNA sequence can be used to develop a stable molecular marker with the following application prospects: (1) Depending on the presence or absence of the 21bp DNA sequence in the promoter region of the VRN-A1 gene, most current wheat According to the flowering period and their spring and winter habits, the family is divided into two types: (biased) winter and (biased) spring, which is conducive to the rapid identification of ecological types related to the flowering periods and spring and winter habits of different wheat materials. (2) The 21bp DNA sequence in the promoter region of the VRN-A1 gene mainly affects flowering by inhibiting the expression of the gene. Therefore, the sequence is manually edited (base insertion, substitution and deletion, etc.) through gene editing methods. Transformation is expected to create or breed new wheat varieties at different growth stages or new materials for intermediate wheat breeding, as well as research on molecular regulatory mechanisms.

references:

Zhao HN, Zhang WL, Zhang T, Lin Y, Hu YD, Fang C, Jiang JM. 2020. Genome-wideMNase hypersensitivity assay unveils distinct classes of open chromatinassociated with

H3K27me3 and DNA methylation in Arabidopsis thaliana. Genome Biology21:24.

sequence list

<110> Nanjing Agricultural University

<120> A DNA sequence and application for rapid identification of ecotypes related to flowering period and spring and winter habits of Triticum aestivum

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 1

tggaagagaggggaggagag g 21

<210> 2

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 2

gtggttgggt gaggacgt 18

<210> 3

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 3

cctgccggaa tcctcgtt 18

Claims (3)

1. The application of the specific primer for detecting the small fragment DNA regulatory element in identifying the flowering phase and the spring and winter habit related ecology of wheat crops is characterized in that the nucleotide sequence of the small fragment DNA regulatory element is shown as SEQ ID No. 1.

2. The use according to claim 1, characterized in that: carrying out PCR amplification in different wheat colony materials by utilizing specific primers, judging the spring and winter habits and flowering periods of the detected materials according to the existence of SEQ ID No.1 in the amplified fragment, wherein the lack of the fragment shows early flowering spring, and the presence of the fragment shows late flowering winter or weak spring; the sequence of the specific primer is as follows: f: GTGGTTGGGTGAGGACGT; r: CCTGCCGGAATCCTCGTT.

3. A method for identifying ecology related to flowering phase and spring and winter habit of wheat crops, which is characterized by comprising the following steps: the method comprises the following steps:

the small fragment DNA regulatory element with the nucleotide sequence shown as SEQ ID No.1 is applied to identification or screening of the flowering period and the spring and winter habit related ecology of wheat crops by developing molecular markers or probes, so that the breeding process of wheat molecules is accelerated;

carrying out PCR amplification in different wheat colony materials by utilizing specific primers, judging the spring and winter habits and flowering periods of the detected materials according to the existence of SEQ ID No.1 in the amplified fragment, wherein the lack of the fragment shows early flowering spring, and the presence of the fragment shows late flowering winter or weak spring; the sequence of the specific primer is as follows: f: GTGGTTGGGTGAGGACGT; r: CCTGCCGGAATCCTCGTT.