CN111690625A

CN111690625A - Acetolactate synthase mutant protein with herbicide resistance and application thereof

Info

Publication number: CN111690625A
Application number: CN202010671852.9A
Authority: CN
Inventors: 胡茂龙; 浦惠明; 龙卫华; 高建芹; 张洁夫; 陈松; 彭琦; 陈锋; 付三雄; 周晓婴; 张维; 王晓东
Original assignee: Jiangsu Academy of Agricultural Sciences
Current assignee: Jiangsu Academy of Agricultural Sciences
Priority date: 2017-07-13
Filing date: 2017-07-13
Publication date: 2020-09-22
Anticipated expiration: 2037-07-13
Also published as: CN111690625B; CN107245480B; CN107245480A

Abstract

The invention discloses an ALS mutant protein, and an ALS1 amino acid sequence of the ALS mutant protein is shown as SEQ ID NO: 2, the ALS3 amino acid sequence is shown as SEQ ID No: 4, respectively. The invention also discloses nucleic acid for coding the mutant protein, an expression cassette, a recombinant vector or a cell containing the nucleic acid. The invention also discloses application of the mutant protein, the nucleic acid, the expression cassette, the recombinant vector or the cell in herbicide resistance of plants. The invention also discloses a method for obtaining the herbicide-resistant plant and a method for identifying the herbicide-resistant plant. The invention relates to an ALS inhibitor herbicide acetolactate synthase mutant with double genes and double mutation sites, which is found for the first time in rape in China; the results of experiments of spraying ALS inhibitor herbicides tribenuron-methyl and mesosulfuron in fields show that after 16 times of weed control recommended use concentration is applied to the rape DS3 containing the ALS mutant protein in the 3-4 leaf stage, plants still grow normally and fructify.

Description

Acetolactate synthase mutant protein with herbicide resistance and application thereof

Technical Field

The invention relates to the field of herbicide resistance of plants and molecular breeding, in particular to acetolactate synthase mutant protein with herbicide resistance and application thereof. More particularly, relates to a method for separating acetolactate synthase coding gene of cabbage type rape high herbicide resistance, constructing a vector and cultivating a plant with high herbicide resistance.

Background

Rape (Brassica napus L.) is one of the first major oil crops in China, and provides an edible oil source for more than half of the population in China. In recent years, with the development of rape planting mode in China from traditional labor-intensive to large-scale and mechanized production, the effective weed control becomes an important link for the whole-course mechanized production and the simplified cultivation of rape. Chemical weeding is an economic and effective means for controlling farmland weeds. Unfortunately, due to the lack of commercial herbicide-resistant rape varieties, the rape production and removal area in China is very limited. Developed countries in north america, europe and the like have long conducted chemical weeding by planting herbicide-resistant oilseed rape. The types of herbicide resistant varieties are mainly glyphosate resistant rape of Monsanto, phosphinothricin resistant rape of Bayer and imidazolinone resistant rape of Bassfu. The resistance genes are protected by international intellectual property rights, expensive special fees are paid for the commercial planting in China, the production cost of the rape is greatly improved, and the original purpose of planting herbicide-resistant crops is violated. Meanwhile, the glyphosate-resistant rape and the glufosinate-resistant rape are transgenic varieties, and are not approved for commercial planting in China and cannot be applied to production. The imidazolinone herbicide has long residue period in soil, can be used only in one-cropping areas, and cannot be registered and issued in Yangtze river basin multi-cropping areas of the main rape production area in China. Therefore, the creation of new herbicide-resistant rape germplasm which has independent intellectual property rights and is suitable for the production requirements of China and the excavation of the resistance genes have very important practical significance for the seed selection of the herbicide-resistant rape varieties.

Acetolactate synthase (ALS), also known as Acetohydroxyacid synthase (AHAS), is a key enzyme in the biosynthesis of 3 branched-chain amino Acids in plants and microorganisms (McCoort JA, Duggleby RG. amino Acids, 2006, 31: 173-210). If the activity of the enzyme is inhibited or lost, the synthesis of valine, leucine and isoleucine of plants is hindered, the synthesis of protein is influenced, and finally the growth of the plants is hindered until the plants die, so that various types of high-efficiency herbicides such as Sulfonylureas (SU), imidazolinones (IMI) and the like are developed by taking ALS as an action target. The herbicides are commonly called ALS inhibitor herbicides or ALS herbicides, have the advantages of strong selectivity, wide weed control spectrum, low use dose, low toxicity to mammals and the like, are widely applied in production, and become the 2 nd class herbicides after glyphosate. However, the commercialized ALS herbicides have a strong growth inhibitory effect on dicotyledonous crop rape, so that they can be applied only to monocotyledonous crops such as rice, wheat, corn and the like. Therefore, the method can be used for cultivating resistant rape varieties, widening the application range of the prior ALS herbicides and effectively solving the problem. However, no commercial resistant rape varieties have been developed up to now in China due to the lack of production of resistant germplasm or genes with production and application values.

Mutations at amino acid positions of the target ALS protein of ALS herbicides can result in resistant plants, where the amino acid positions involved are Gly 95, Ala 96, Ala 122, Pro 171, Pro 196, Pro 197, Ala 205, Asp 376, Trp537, Trp548, Trp 552, Trp 557, Trp 563, Trp 574, Ser 621, Ser 627, Ser 638, Ser 653, Gly 654, Val 669, etc. (calculated as ALS amino acid positions in the model plant arabidopsis), which are reported in various crops (including rice, maize, wheat, sunflower, etc.), model plant arabidopsis thaliana and weeds (Tan et al, 2005, pesstmaagci, 61: 246-. It was found that the resistance effect of resistant plants depends on the position of the amino acid mutation on ALS, the kind of amino acid after mutation and the number of mutated amino acids (Yu et al, 2010, J Exp Botany, 61: 3925-. Meanwhile, the herbicide resistance effects generated by amino acid variation at the same position in different genetic backgrounds can also have significant difference, which is probably because different micro-effect genes in plants in different genetic backgrounds participate in the synergistic action of the herbicide resistance. Therefore, for crops with complex genetic background (such as rape), mutants with high herbicide resistance and substances (such as proteins, genes and the like) which really can play a decisive role are not designed in a targeted way by theory at present, and can only be obtained by relying on hard practice of researchers, particularly long-term screening and identification, and by means of luck. For the heterotetraploid crop rape, the situation is more complicated, and people can hardly predict whether the mutation of the ALS protein amino acid site can generate herbicide resistance in advance, whether the resistance level of the resistance mutation site has breeding utilization value, and whether the resistance germplasm or gene can be suitable for production practical value.

Disclosure of Invention

The purpose of the invention is as follows: the technical problem to be solved by the invention is to provide an acetolactate synthase mutant with herbicide resistance.

The technical problem to be solved by the invention is to provide nucleic acid for encoding the protein, an expression cassette, a vector, a cell and the like.

The technical problem to be solved by the present invention is to provide a method and use for obtaining plants with herbicide resistance.

The invention also aims to solve the technical problem of providing an identification method for judging whether plants are obtained by adopting the method.

The inventor finds a high-herbicide-resistance germplasm in a mutant library of rape N131 through two rounds of EMS mutagenesis by occasionally using tribenuron-methyl by luck through long-term and hard research practice, the acetolactate synthase mutant carried by the germplasm belongs to two-gene two-site mutation, and the encoded protein has high resistance to the herbicide, so that the rape is endowed with high resistance to the herbicide. Until the present patent application, no public reports on this type of rape mutant have been found at home and abroad.

Compared with other wild acetolactate synthase, the acetolactate synthase mutant provided by the invention has double-gene double-site mutation, and the gene coding the mutant enzyme is transferred or transformed into plants, so that the plants such as rape and arabidopsis have the characteristic of high resistance to ALS inhibitor herbicides.

The technical scheme is as follows: in order to solve the technical problems, the technical scheme adopted by the invention is as follows: the present invention provides an ALS mutein conferring herbicide resistance to plants, which changes the amino acid at position 182 of the ALS1 amino acid sequence from proline to leucine and the amino acid at position 556 of ALS3 from tryptophan to leucine. There has been no report showing that the above-mentioned double-gene double mutation in the genome derived from Brassica napus results in rape having a high resistance to ALS inhibitor herbicides.

Preferably, the ALS1 protein of the first aspect of the present invention has a Pro182Leu mutation, and the ALS3 protein has a Trp556Leu mutation, and in addition to the mutant plant screening or amplification method described in the embodiments of the present invention, it is within the ability of those skilled in the art to prepare a protein having an amino acid residue substituted, added or deleted by changing the gene sequence encoding a known protein and introducing it into a vector, in the case where the protein sequence is known, and these methods are all conventional methods. In a particular embodiment of the invention, the ALS protein with herbicide resistance, whose ALS1 amino acid sequence is as set forth in SEQ ID NO: 2, the ALS3 amino acid sequence is shown as SEQ ID NO: 4, respectively. The protein was demonstrated to be an acetolactate synthase insensitive to the SU class herbicides tribenuron-methyl (2- [ N- (4-methoxy-6-methyl-1, 3, 5-triazin-2-yl) -N-methylcarbamoylsulfamoyl ] benzoic acid methyl ester) and methyldisulfuron (methyl-2 [3- (4, 6-methoxypyrimidin-2-yl) monoureidosulfonyl l-4-methanesulfonylamino benzoate).

In a second aspect, the invention provides a nucleic acid encoding a protein according to the first aspect of the invention. In the present invention, the nucleic acid may be DNA or RNA, and among them, DNA is preferable. It is within the ability of those skilled in the art to obtain and optimize nucleic acids encoding the proteins of the first aspect of the invention by PCR, DNA recombination or artificial synthesis using conventional codon usage and host expression frequency, given knowledge of the encoded protein or nucleic acid sequence. Once the nucleic acid is obtained, it can be cloned into a vector, transformed or transfected into the corresponding cell, and then propagated through a conventional host cell, from which a large amount of the nucleic acid is isolated. Preferably the nucleic acid of the second aspect of the invention, which ALS1 nucleotide sequence is as set forth in SEQ ID NO: 1, the ALS3 nucleotide sequence is shown as SEQ ID NO: 3, respectively. Specifically, the ALS1 nucleotide sequence of the DNA sequence of the invention has point mutation from C to T at the +545 th position, and the ALS3 nucleotide has point mutation from G to T at the +1667 th position.

In addition, the wild type brassica napus before mutation of the present invention is the wild type brassica napus line N131, and 3 functional ALS genes (Genebank accession numbers Z11524, Z11525, Z11526) coexist in the brassica napus genome.

The third aspect of the invention includes an expression cassette, recombinant vector or cell comprising the nucleic acid of the second aspect described above.

The fourth aspect of the present invention also includes the use of an ALS protein, nucleic acid, expression cassette, recombinant vector or cell with herbicide resistance as described above for plants resistant to herbicides.

Wherein the plant is rape or Arabidopsis thaliana.

The fifth aspect of the present invention also includes a method of obtaining a herbicide resistant plant, comprising the steps of:

1) allowing a plant to comprise a nucleic acid according to the invention; or

2) Allowing the plant to express said protein.

The method comprises the steps of transgenosis, hybridization, backcross or asexual propagation and the like.

The sixth aspect of the present invention includes a method for identifying a plant, wherein the plant is a plant comprising said nucleic acid, a plant expressing said protein or a plant obtained by said method, comprising the steps of:

1) determining whether said plant comprises said nucleic acid; or the like, or, alternatively,

2) determining whether said plant expresses said protein.

The invention also comprises the steps of specifically transferring the gene coding acetolactate synthase into wild rape through hybridization, spraying ALS inhibitor herbicide in the seedling stage of the transferred rape and the wild rape, treating for 3 weeks, leading the wild rape plant to die, and leading the transferred rape plant containing the mutant gene coding acetolactate synthase to survive; the gene coding acetolactate synthase is transformed into arabidopsis, ALS inhibitor herbicides are sprayed at the seedling stage of the transgenic arabidopsis and the wild arabidopsis, after 3 weeks of treatment, all wild arabidopsis plants die, and all transgenic arabidopsis plants survive. Therefore, plants containing the gene encoding acetolactate synthase according to the present invention have resistance to ALS inhibitor herbicides.

Has the advantages that: compared with the prior art, the invention has the following advantages and effects:

1) the invention is a cabbage type rape high resistance ALS inhibitor herbicide acetolactate synthase mutant with double genes and double mutation sites which is found for the first time in rape in China, and the nucleotide sequence of the coding gene of the acetolactate synthase mutant can obviously improve the tolerance of other plants which have no resistance to ALS inhibitor herbicides to the ALS inhibitor herbicides;

2) the experimental result of spraying ALS inhibitor herbicide tribenuron-methyl-disulfuron in the field indicates that 16 times of weed control recommended use concentration (tribenuron-methyl is 360 ga.i.ha.) is applied to 3-4 leaf stage of rape DS3 containing ALS mutant protein of the invention^-1And the content of mesosulfuron-methyl is 180g a.i.ha^-1) After that, the plants still grew normally and were fruitful, while wild type rape was applied at 1-fold the recommended concentration for weed control at the 3-4 leaf stage (tribenuron-methyl 22.5g a.i.ha)^-1And 11.25g of mesosulfuron-methyl (a.i.ha)^-1) Death of the whole plant was observed after 3 weeks.

Drawings

FIG. 1 shows that the ALS inhibitor herbicide resistant mutant rape plant DS3 of the present invention is found in a rape field;

FIG. 2 in vitro inhibition of ALS enzyme activity in wild type and mutant by tribenuron-methyl at different concentrations;

FIG. 3 in vitro inhibition of ALS enzyme activity of wild type and mutant by methyldisulfuron at various concentrations;

FIG. 4PCR amplification of the oilseed rape ALS1 gene; lane 1, DNA molecular weight standard, fragments from small to large 500bp, 800bp, 1200bp, 2000bp, 3000bp, 4500 bp; lanes 2 to 4 are DNA of N131, lanes 5 to 7 are DNA of EM28, lanes 8 to 10 are DNA of DS3, 3 replicates per sample; lane 11 is control water.

FIG. 5PCR amplification of the oilseed rape ALS2 gene; lane 1, DNA molecular weight standard, fragments from small to large as in figure 4; lanes 2 to 4 are DNA of N131, lanes 5 to 7 are DNA of EM28, lanes 8 to 10 are DNA of DS3, 3 replicates per sample; lane 11 is control water;

FIG. 6PCR amplification of the ALS3 gene from Brassica napus; lane 1, DNA molecular weight standard, fragments from small to large as in figure 4; lanes 2 to 4 are DNA of N131, lanes 5 to 7 are DNA of EM28, lanes 8 to 10 are DNA of DS3, 3 replicates per sample; lane 11 is control water.

Detailed Description

Embodiments of the present invention will be described in detail below with reference to examples, but those skilled in the art will appreciate that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

Example 1: creation process of cabbage type rape acetolactate synthase mutant with high herbicide resistance

Before rape sowing, wild rape strain N131 (publicly known and commonly used, see Puhuiming et al, Jiangsu agricultural science, 2010, 26 (6): 1432-1434) is subjected to Ethyl Methane Sulfonate (EMS) mutagenesis treatment, and the specific treatment process comprises the steps of 1 day before sowing, putting 0.5kg of N131 seeds into a nylon mesh bag, soaking in a container filled with clear water for 12 hours, hanging the nylon mesh bag at a high position until water is basically drained, treating in 0.4% EMS solution (v/v) for 8 hours, washing the treated seeds for 4 hours with running water, hanging the nylon mesh bag at the high position again, draining the water, immediately scattering the seeds (Mo) into a 6 × 50M isolation greenhouse with isolation conditions, in the current year, isolating and preserving the purity of the rape with a nylon mesh after flowering, and harvesting M which is mature at the bottom of 5 months₁And (4) seeds. At the beginning of 10 months, adopting a group mixing method to mix M₁Sowing seeds in 6 × 50M isolation greenhouse with isolation condition, isolating and keeping pure with nylon net cover after spring rape blooms in the next year, and harvesting M in summer₂And (5) seed generation. Autumn sowing M₂When the vegetable seedlings grow to 3-4 leavesIn the period, the sulfonylurea herbicide tribenuron-methyl (2 times of the recommended use concentration for weed control) is sprayed to screen the herbicide-resistant mutant. After 3 weeks of treatment, more than 20 seedlings were found to survive in the field, and the rest rapes died. After the survival vegetable seedlings grow to 5-6 leaves, the survival vegetable seedlings are moved to a rape breeding field, and are bagged for self-recovery to obtain M₃And (4) seeds. In a light culture room, for M₃And (3) performing resistance effect identification in the seedling stage of the seeds, and finding that the strain with the number of EM28 (preservation number: CGMCC No.14299) has stable resistance and other characters are similar to wild type N131. The seeds of the EM28 plant are preserved in China general microbiological culture Collection center (CGMCC) in 2017 at 19.06.7, and the address is as follows: west road No.1, north chen, chaoyang district, beijing, zip code: 100101, the preservation number is CGMCC No.14299, the classification name of the strain is: brassica napus (Brassica napus). Genetic studies found that the resistance trait of EM28 is an incompletely dominant trait controlled by 1 nuclear gene, and when the resistance gene in EM28 is homozygous, its resistance effect is 3-4 times higher than the recommended use concentration for tribenuron-methyl herbicide weed control, because EM28 leaves show growth inhibition symptoms after 4 times of the recommended use concentration for weed control (table 1). Subsequent research in hybrid rape variety breeding finds that when the resistance character of EM28 is introduced into CMS restoring line by conventional breeding means, the CMS restoring line is matched with sterile line, and the bred resistant hybrid combination F₁The resistance genotype is expressed as a heterozygote type, the resistance effect of the heterozygote type is 1.5 to 2 times of the recommended concentration of herbicide for weed control, which causes a great risk in the popularization and application of the bred herbicide-resistant hybrid rape varieties in production, because when farmers use the herbicide for field weed control, if the herbicide is not used properly or is sprayed unevenly, the actually used herbicide concentration is easily caused to exceed the hybrid F₁The resistance effect range of (A) causes the rape to generate herbicide phytotoxicity symptoms. Therefore, the application of the resistance trait of EM28 in the seed selection of herbicide-resistant rape varieties has certain limitation.

Therefore, herbicide-resistant rape germplasm or resources with higher resistance effect are expected to meet the requirement of herbicide-resistant rape variety breeding. The EM28 seeds are propagated, EMS mutagenesis is carried out on the resistant material EM28 seeds again, high-concentration herbicide screening is combined, 8 times of tribenuron-methyl weed control recommended use concentration is sprayed on the field herbicide, and the specific EMS mutagenesis flow, screening and identification processes are the same as the above. We have fortunately found that after 3 weeks of treatment with high concentrations of tribenuron-methyl herbicide, the seedlings of DS3 grew well in the field (FIG. 1), and were harvested and stored after the seeds of the plants had matured. So far, we obtained a brassica napus acetolactate synthase mutant DS3 with high herbicide resistance, and deposited the brassica napus acetolactate synthase mutant DS3 in 2017 on 19.06 months in the common microorganism center of the china committee for culture collection of microorganisms (CGMCC), address: west road No.1, north chen, chaoyang district, beijing, zip code: 100101, the preservation number is CGMCC No.14298, the classification name of the strain is: brassica napus (Brassica napus).

Example 2: herbicide resistance identification

The resistance identification test adopts two methods of field identification and greenhouse pot experiment to identify and evaluate the resistance effect of the resistance mutants EM28 and DS 3. The rape field identification test is carried out in a rape isolated breeding area of agricultural academy of sciences of Jiangsu province, and the greenhouse pot culture test is carried out in a constant temperature culture room. Wild type N131 (publicly known and used in Puhuiming, etc., Jiangsu agricultural science, 2010, 26 (6): 1432-1434), EM28 and DS3 of the invention are sown, seedlings grow to 3-4 leaf seedlings, SU herbicides tribenuron-methyl (2- [ N- (4-methoxy-6-methyl-1, 3, 5-triazine-2-yl) -N-methylcarbamoylamino sulfonyl ] methyl benzoate) methyl disulfuron (methyl-2 [3- (4, 6-methoxy pyrimidine-2-yl) ureidosulfonyl l-4-methylsulfonylaminobenzoate) with different concentrations are respectively sprayed on the control materials to be treated. After 3 weeks of spraying, the resistance effect of the seedlings at different application concentrations was determined according to their growth performance, and the results are shown in Table 1. As can be seen from table 1, the resistant material DS3 is most resistant to the SU herbicides tribenuron-methyl and mesosulfuron, with the concentration of the resistant effect being between 12 and 16 times the recommended use concentration for herbicide weed control, much more than the resistant effect of EM28 on the above two herbicides, and the concentration of the EM28 resistant effect being between 3 and 4 times the recommended use concentration for herbicide weed control. Therefore, the high-resistance material DS3 is considered to be more valuable than EM28 in rape breeding.

TABLE 1 resistance Performance after 3 rape treatments with different concentrations of herbicide

And (4) surface note: 1X represents a recommended use concentration of 1-fold for herbicide weed control, and so on, wherein the recommended use concentration of 1-fold for tribenuron-methyl herbicide weed control is 22.5g a.i.ha^-11-fold recommended concentration for mesosulfuron-methyl herbicide weed control is 11.25g a.i.ha^-1(ii) a R represents that the rape plants treated by the herbicide grow well and have no phytotoxicity; r^-The growth of the rape plants is inhibited to a certain extent after the herbicide treatment, but the plants can not die and can be normally fruited; s represents that the growth of the rape plants is severely inhibited after the herbicide treatment, the phytotoxicity is obvious, and finally the plants die (the same below).

Example 3: ALS enzyme Activity in vitro assay

DS3 was phenotypically highly resistant to SU herbicides, so this class of herbicide was selected for in vitro enzymatic in vitro assays to compare differences in resistance to herbicides between DS3, EM28 and the original wild-type N131. The assay was performed according to the method of Singh et al (Singh BK, et al., Analytical Biochemistry, 1988, 171: 173-. Specifically, 0.2g of each leaf sample was ground and pulverized in a mortar with liquid nitrogen, and the ground sample was added to an initial enzyme extract [100mM K ] containing 4.5ml₂HPO₄、0.5mM MgCl₂0.5mM thiamine pyrophosphate (TPP), 10. mu.M Flavin Adenine Dinucleotide (FAD), 10mM sodium pyruvate, 10% (v/v) glycerol, 1mM dithiothreitol, 1mM phenylmethylsulfonyl fluoride (PMSF), 0.5% (w/v) polyvinylpyrrolidone]In (b), the mixture was centrifuged at 12000rpm for 20min at 4 ℃. Collecting supernatant, adding equal volume of saturated (NH)₄)₂SO₄Standing on ice for 30min, centrifuging at 12000rpm at 4 deg.C for 20min, discarding supernatant, adding 1mL of primary enzyme extractive solution, and shaking to dissolveALS enzyme solution for each sample. To 200. mu.L of the extracted ALS enzyme solution were added 360. mu.L of 50mM hepes-NaOH (pH 7.5) enzyme reaction buffer, 80. mu.L of 20mM TPP, 80. mu.L of 200. mu.MFAD, and 80. mu.L of 2M sodium pyruvate +200mM MgCl₂Mixing with tribenuron-methyl and mesosulfuron-methyl herbicides of different concentrations, reacting at 37 deg.C for 1 hr, adding 160 μ L of 3M H₂SO₄The reaction was stopped, decarboxylated at 60 ℃ for 15min, then 780 μ L of 5.5% α -naphthol solution and 780 μ L of 0.55% creatine were added, developed for 15min at 65 ℃, colorimetric at 530nm, absorbance read, and enzyme activity calculated according to standard curve ALS enzyme activity without added herbicide control was recorded as 100%, respectively, and the effect of tribenuron and mesotrione herbicides on ALS enzyme activity of DS3, EM28, and the original wild type N131 was calculated.

As shown in fig. 2 and 3, when SU-class herbicides tribenuron-methyl and mesosulfuron-methyl were added to the enzymatic reaction, the ALS enzymes of DS3 and EM28 both exhibited resistance to the herbicide as compared to wild-type N131, but there was a significant difference in their resistance to the herbicide, as shown by the different trends of the two decreases with increasing herbicide concentration. For example, when the concentration of tribenuron-methyl herbicide is 10 mu mol L^-1When the ALS enzyme activity in DS3 was about 83% of the control (not treated with herbicide), the ALS enzyme activity in EM28 was about 51% of the control; when the concentration of the tribenuron-methyl herbicide is 20 mu mol L^-1In this case, the ALS enzyme activity in DS3 was about 80% of the control, while the ALS enzyme activity in EM28 was only about 46% of the control; when the concentration of the mesosulfuron-methyl herbicide reaches 10 mu molL^-1In this case, the ALS enzyme activity of DS3 was about 72% of that of the control, and in this case, the ALS enzyme activity of EM28 was reduced to about 44%. The above results indicate that the ALS enzyme in mutant DS3 is significantly less sensitive to herbicides than the ALS enzyme in EM28, thereby conferring higher herbicide resistance to DS3 than EM 28.

Example 4: cloning of ALS Gene

3 functional ALS genes (Genebank accession numbers Z11524, Z11525 and Z11526) coexist in the Brassica napus genome, and 3 PCR primers were designed based on the 3 ALS gene sequences. ALS1 primer 1: GTGGATCTAACTGTTCTTGA and primer 2: AGAGATGAAGCTGGTGATC are provided. ALS2 primer 1: GAGTGTTGCGAGAAATTGCTT and primer 2: TTGATTATTCTATGCTCTCTTCTG are provided. ALS3 primer 1: ATGGTTAGATGAGAGAGAGAGAG and primer 2: GGTCGCACTAAGTACTGAGAG are provided. The CTAB method is adopted to extract the genomic DNA of leaves (Chilenolone, etc., Chinese oil plant science, 2011, 33 (4): 331-337), and the wild type and mutant ALS1, ALS2 and ALS3 genes are cloned by PCR. A50. mu.L PCR reaction system was prepared according to the instructions of the kit KOD-Plus for high-fidelity DNA polymerase from Hippocampus Biotech Ltd. Performing amplification on an MJ Research PTC-200 PCR instrument, wherein the reaction program is pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 2.5min for 35 cycles. The product was subjected to blunt-end addition of A, subjected to 1.2% (V/W) agarose gel electrophoresis separation (FIGS. 4, 5, and 6), purified and recovered using an agarose gel DNA recovery kit (catalog No. DP209) manufactured by Beijing Tiangen, ligated to a cloning vector pEASY-T1 (available from Beijing TransGen Biotechnology Co., Ltd.), and heat-shocked to transform DH 5. alpha. into a plasmid. Positive clones were sequenced by blue-white screening and colony PCR identification in Nanjing Kingsrey Bio Inc. Sequencing results show that the ALS2 gene in the mutant DS3 has NO base mutation, but the ALS1 gene and the ALS3 gene both have point mutation, wherein the +545 th site of the ALS1 gene has point mutation, the nucleotide is mutated from C to T, and the nucleotide sequence is shown as SEQ ID NO: 1, leading to the mutation of proline (P) at position 182 of a corresponding coded protein into leucine (L), wherein the amino acid sequence is shown as SEQ ID NO: 2 is shown in the specification; the ALS3 gene has point mutation at the +1667, the nucleotide is changed from G to T, and the nucleotide sequence is shown in SEQ ID NO: 3, resulting in the 556 th amino acid change from tryptophan (W) to leucine (L) of the corresponding encoded protein, the amino acid sequence being as shown in SEQ ID NO: 4, in the mutant strain DS3, the amino acid substitution of Pro182Leu of ALS1 and Trp556Leu of ALS3 occurred in both genes, and 1 site mutation was added to EM28 (P182L).

Example 5: expression analysis of acetolactate synthase mutant encoding gene in wild type rape

The acetolactate synthase mutant coding gene in the DS3 is introduced into other wild type rape varieties or lines which have no resistance to ALS herbicides by using a cross breeding method. In brief, DS3 was used to mix with restorer 3075R (Puhuiming et al, 2002, Jiangsu agricultural science, 4:33-34) and 3018R (purkiningh et al, 1999, Jiangsu agricultural science, 6: 32-33) preparing a hybridization combination, and harvesting 2F in the same year₁Seeds are planted in the vernalization/culture room with additional generations, single plants with consistent growth are selected in the flowering phase and are bagged for selfing, and F is harvested₂The seeds were sown in Lishui plant science base, Nongkoseh, Jiangsu province, of Nanjing, and each F₂Seeding 20 rows in colony, taking F in seedling stage₂Individual leaf of the population, DNA extracted, and ALS1 and ALS3 genes PCR amplified, the product according to example 4 steps purification, recovery, sequencing. Screening for homozygous F having the acetolactate synthase mutant encoding Gene in DS3 based on the sequencing results₂And (3) a single strain, namely the ALS1 sequence of the single strain is shown as SEQ ID NO: 2, the nucleotide sequence of ALS3 is shown as SEQ ID NO: 4, respectively. F for each selection in rape flowering₂Bagging and selfing the single plant, and harvesting F₃And (4) seeds. Following the procedure of example 2, field identification and greenhouse potting test pair F₃And (5) identifying the seedling stage resistance. As a result, it was found that all of the candidates F were treated with tribenuron-methyl and mesosulfuron-methyl herbicides at a concentration of 12X or less for 3 weeks₃The growth state of the rape seedlings is good, the growth of the rape treated by 16X is inhibited to a certain extent, the growth is inhibited, but the plants do not die, all the control materials die, and the fact that the coding gene carrying the acetolactate synthase mutant in DS3 is homozygotic F is shown₃The concentration of the effect of the strains on the resistance of both ALS herbicides was between 12 and 16 times the recommended use concentration for herbicide weed control (table 2).

TABLE 2 resistance Performance of the selected oilseed rape F3 line after treatment with various concentrations of herbicide

Example 6: expression of acetolactate synthase mutant encoding gene in Arabidopsis thaliana

The coding genes of the two mutant enzymes in the DS3 are respectively transferred into wild type Arabidopsis plants by a conventional Agrobacterium tumefaciens mediated method, and then the transgenic Arabidopsis plants which are homozygous at the same time with the coding genes of the two mutant enzymes in the DS3 are selected in the later generation for the phenotypic identification of the herbicide by crossing the two transgenic lines. Briefly, specific primers were designed based on the ALS1 and ALS3 gene sequences, respectively, ALS1 primer 3:

5′CGCGGTACCTCATCTCTCTCTCCTCTAACC 3' (underlined sequence is a KpnI enzyme recognition site, the same below) and ALS1 primer 4: 5' CGCACTAGTGATCACCAGCTTCATCTCTC 3' (the underlined sequence is the SpeI enzyme recognition site, the same below); ALS3 primer 3:

5′CGCGGTACCCTCTCTCTCTCTCATCTAACCAT 3' and ALS3 primer 4:

5′CGCACTAGTCTCTCAGTACTTAGTGCGACC 3'. taking genome DNA of mutant DS3 as a template, performing PCR amplification to obtain a target mutant enzyme coding gene P182L and W556L.PCR product, recovering, cloning and sequencing by the method of example 4 to obtain a recombinant T vector with the mutant enzyme coding gene, obtaining a fragment containing the target gene by using a KpnI and SpeI double-restriction enzyme T vector, recovering the fragment, connecting the fragment to a pCAMBIA1390 vector (purchased from CAMBI, Australia) which is also subjected to double-restriction enzyme digestion to obtain a recombinant plant expression vector, transforming the constructed recombinant vector into Escherichia coli DH5 α, extracting plasmids for enzyme digestion and sequencing detection, transforming the recombinant vector containing the target gene which is detected to be correct into an Agrobacterium EH105 α strain, extracting the plasmids for PCR and enzyme digestion identification, culturing the obtained recombinant strain, transforming the Arabidopsis thaliana by using an Agrobacterium infection floral sequencing method (floral dip) to obtain a T0 generation, obtaining a T1 generation plant, transplanting the T1 generation plant into an artificial culture box, obtaining a T3 generation of homozygous T strain obtained by PCR and screening, and obtaining a T862 generation combined transgenic plant strain obtained by PCR amplification and 3 preparation₁Seed, PCR screening and expanding propagation to obtain homozygous transgenic strain F with mutant enzyme coding gene in DS3₃. Following the procedure of example 2, field identification and greenhouse potting test pair F₃And (5) identifying the seedling stage resistance. After 3 weeks of treatment with tribenuron-methyl and mesosulfuron-methyl herbicides at concentrations below 12X, all transgenic Arabidopsis thaliana F₃Seedlings grew well, and the growth of 16X-treated seedlings was somewhat inhibited, but the plants did not die, while all non-transgenic Arabidopsis (WT) seedlings died, indicating that they harbored acetolactate synthase in DS3Transgenic Arabidopsis F homozygous for the gene encoding the mutant₃The resistance effect concentration of the families to both SU herbicides was between 12-16 times the recommended use concentration for herbicide weed control (table 3).

TABLE 3 resistance Performance after different concentrations of herbicide-treated transgenic Arabidopsis thaliana crossed strain F3

While specific embodiments of the invention have been described in detail, it will be appreciated by those skilled in the art that various modifications and alternatives to those details could be developed in light of the overall teachings of the disclosure, and are within the scope of the invention. The full scope of the invention is given by the appended claims and any equivalents thereof.

Sequence listing

<110> agricultural science and academy of Jiangsu province

<120> acetolactate synthase mutein having herbicide resistance and use thereof

<160>14

<170>SIPOSequenceListing 1.0

<210>1

<211>1968

<212>DNA

<213> ALS1 mutant Gene (ALS1)

<400>1

atggcggcgg caacatcgtc ttctccgatc tccttaaccg ctaaaccttc ttccaaatcc 60

cctctaccca tttccagatt ctcccttccc ttctccttaa ccccacagaa agactcctcc 120

cgtctccacc gtcctctcgc catctccgcc gttctcaact cacccgtcaa tgtcgcacct 180

ccttcccctg aaaaaaccga caagaacaag actttcgtct cccgctacgc tcccgacgag 240

ccccgcaagg gtgctgatat cctcgtcgaa gccctcgagc gtcaaggcgt cgaaaccgtc 300

tttgcttatc ccggaggtgc ttccatggag atccaccaag ccttgactcg ctcctccacc 360

atccgtaacg tccttccccg tcacgaacaa ggaggagtct tcgccgccga gggttacgct 420

cgttcctccg gcaaaccggg aatctgcata gccacttcgg gtcccggagc taccaacctc 480

gtcagcgggt tagcagacgc gatgcttgac agtgttcctc ttgtcgccat tacaggacag 540

gtccttcgcc ggatgatcgg tactgacgcc ttccaagaga caccaatcgt tgaggtaacg 600

aggtctatta cgaaacataa ctatttggtg atggatgttg atgacatacc taggatcgtt 660

caagaagctt tctttctagc tacttccggt agacccggac cggttttggt tgatgttcct 720

aaggatattc agcagcagct tgcgattcct aactgggatc aacctatgcg cttacctggc 780

tacatgtcta ggttgcctca gcctccggaa gtttctcagt taggtcagat cgttaggttg 840

atctcggagt ctaagaggcc tgttttgtac gttggtggtg gaagcttgaa ctcgagtgaa 900

gaactgggga gatttgtcga gcttactggg atccccgttg cgagtacttt gatggggctt 960

ggctcttatc cttgtaacga tgagttgtcc ctgcagatgc ttggcatgca cgggactgtg 1020

tatgctaact acgctgtgga gcatagtgat ttgttgctgg cgtttggtgt taggtttgat 1080

gaccgtgtca cgggaaagct cgaggctttc gctagcaggg ctaaaattgt gcacatagac 1140

attgattctg ctgagattgg gaagaataag acacctcacg tgtctgtgtg tggtgatgta 1200

aagctggctt tgcaagggat gaacaaggtt cttgagaacc gggcggagga gctcaagctt 1260

gatttcggtg tttggaggag tgagttgagc gagcagaaac agaagttccc tttgagcttc 1320

aaaacgtttg gagaagccat tcctccgcag tacgcgattc agatcctcga cgagctaacc 1380

gaagggaagg caattatcag tactggtgtt ggacagcatc agatgtgggc ggcgcagttt 1440

tacaagtaca ggaagccgag acagtggctg tcgtcatcag gcctcggagc tatgggtttt 1500

ggacttcctg ctgcgattgg agcgtctgtg gcgaaccctg atgcgattgt tgtggatatt 1560

gacggtgatg gaagcttcat aatgaacgtt caagagctgg ccacaatccg tgtagagaat 1620

cttcctgtga agatactctt gttaaacaac cagcatcttg ggatggtcat gcaatgggaa 1680

gatcggttct acaaagctaa cagagctcac acttatctcg gggacccggc aagggagaac 1740

gagatcttcc ctaacatgct gcagtttgca ggagcttgcg ggattccagc tgcgagagtg 1800

acgaagaaag aagaactccg agaagctatt cagacaatgc tggatacacc aggaccatac 1860

ctgttggatg tgatatgtcc gcaccaagaa catgtgttac cgatgatccc aagtggtggc 1920

actttcaaag atgtaataac agaaggggat ggtcgcacta agtactga 1968

<210>2

<211>655

<212>PRT

<213> ALS1 mutant Gene (ALS1)

<400>2

Met Ala Ala Ala Thr Ser Ser Ser Pro Ile Ser Leu Thr Ala Lys Pro

1 5 10 15

Ser Ser Lys Ser Pro Leu Pro Ile Ser Arg Phe Ser Leu Pro Phe Ser

20 25 30

Leu Thr Pro Gln Lys Asp Ser Ser Arg Leu His Arg Pro Leu Ala Ile

35 40 45

Ser Ala Val Leu Asn Ser Pro Val Asn Val Ala Pro Pro Ser Pro Glu

50 55 60

Lys Thr Asp Lys Asn Lys Thr Phe Val Ser Arg Tyr Ala Pro Asp Glu

65 70 75 80

Pro Arg Lys Gly Ala Asp Ile Leu Val Glu Ala Leu Glu Arg Gln Gly

85 90 95

Val Glu Thr Val Phe Ala Tyr Pro Gly Gly Ala Ser Met Glu Ile His

100 105 110

Gln Ala Leu Thr Arg Ser Ser Thr Ile Arg Asn Val Leu Pro Arg His

115 120 125

Glu Gln Gly Gly Val Phe Ala Ala Glu Gly Tyr Ala Arg Ser Ser Gly

130 135 140

Lys Pro Gly Ile Cys Ile Ala Thr Ser Gly Pro Gly Ala Thr Asn Leu

145 150 155 160

Val Ser Gly Leu Ala Asp Ala Met Leu Asp Ser Val Pro Leu Val Ala

165 170 175

Ile Thr Gly Gln Val Leu Arg Arg Met Ile Gly Thr Asp Ala Phe Gln

180 185 190

Glu Thr Pro Ile Val Glu Val Thr Arg Ser Ile Thr Lys His Asn Tyr

195 200 205

Leu Val Met Asp Val Asp Asp Ile Pro Arg Ile Val Gln Glu Ala Phe

210 215 220

Phe Leu Ala Thr Ser Gly Arg Pro Gly Pro Val Leu Val Asp Val Pro

225 230 235 240

Lys Asp Ile Gln Gln Gln Leu Ala Ile Pro Asn Trp Asp Gln Pro Met

245 250 255

Arg Leu Pro Gly Tyr Met Ser Arg Leu Pro Gln Pro Pro Glu Val Ser

260 265 270

Gln Leu Gly Gln Ile Val Arg Leu Ile Ser Glu Ser Lys Arg Pro Val

275 280 285

Leu Tyr Val Gly Gly Gly Ser Leu Asn Ser Ser Glu Glu Leu Gly Arg

290 295 300

Phe Val Glu Leu Thr Gly Ile Pro Val Ala Ser Thr Leu Met Gly Leu

305 310 315 320

Gly Ser Tyr Pro Cys Asn Asp Glu Leu Ser Leu Gln Met Leu Gly Met

325 330 335

His Gly Thr Val Tyr Ala Asn Tyr Ala Val Glu His Ser Asp Leu Leu

340 345 350

Leu Ala Phe Gly Val Arg Phe Asp Asp Arg Val Thr Gly Lys Leu Glu

355 360 365

Ala Phe Ala Ser Arg Ala Lys Ile Val His Ile Asp Ile Asp Ser Ala

370 375 380

Glu Ile Gly Lys Asn Lys Thr Pro His Val Ser Val Cys Gly Asp Val

385 390 395 400

Lys Leu Ala Leu Gln Gly Met Asn Lys Val Leu Glu Asn Arg Ala Glu

405 410 415

Glu Leu Lys Leu Asp Phe Gly Val Trp Arg Ser Glu Leu Ser Glu Gln

420 425 430

Lys Gln Lys Phe Pro Leu Ser Phe Lys Thr Phe Gly Glu Ala Ile Pro

435 440 445

Pro Gln Tyr Ala Ile Gln Ile Leu Asp Glu Leu Thr Glu Gly Lys Ala

450 455 460

Ile Ile Ser Thr Gly Val Gly Gln His Gln Met Trp Ala Ala Gln Phe

465 470 475 480

Tyr Lys Tyr Arg Lys Pro Arg Gln Trp Leu Ser Ser Ser Gly Leu Gly

485 490 495

Ala Met Gly Phe Gly Leu Pro Ala Ala Ile Gly Ala Ser Val Ala Asn

500 505 510

Pro Asp Ala Ile Val Val Asp Ile Asp Gly Asp Gly Ser Phe Ile Met

515 520 525

Asn Val Gln Glu Leu Ala Thr Ile Arg Val Glu Asn Leu Pro Val Lys

530 535 540

Ile Leu Leu Leu Asn Asn Gln His Leu Gly Met Val Met Gln Trp Glu

545 550 555 560

Asp Arg Phe Tyr Lys Ala Asn Arg Ala His Thr Tyr Leu Gly Asp Pro

565 570 575

Ala Arg Glu Asn Glu Ile Phe Pro Asn Met Leu Gln Phe Ala Gly Ala

580 585 590

Cys Gly Ile Pro Ala Ala Arg Val Thr Lys Lys Glu Glu Leu Arg Glu

595 600 605

Ala Ile Gln Thr Met Leu Asp Thr Pro Gly Pro Tyr Leu Leu Asp Val

610 615 620

Ile Cys Pro His Gln Glu His Val Leu Pro Met Ile Pro Ser Gly Gly

625 630 635 640

Thr Phe Lys Asp Val Ile Thr Glu Gly Asp Gly Arg Thr Lys Tyr

645 650 655

<210>3

<211>1959

<212>DNA

<213> ALS3 mutant Gene (ALS3)

<400>3

atggcggcgg caacatcgtc ttctccgatc tccttaaccg ctaaaccttc ttccaaatcc 60

cctctaccca tttccagatt ctcccttccc ttctccttaa ccccacagaa accctcctcc 120

cgtctccacc gtccactcgc catctccgcc gttctcaact cacccgtcaa tgtcgcacct 180

gaaaaaaccg acaagatcaa gactttcatc tcccgctacg ctcccgacga gccccgcaag 240

ggtgctgata tcctcgtgga agccctcgag cgtcaaggcg tcgaaaccgt cttcgcttat 300

cccggaggtg cctccatgga gatccaccaa gccttgactc gctcctccac catccgtaac 360

gtcctccccc gtcacgaaca aggaggagtc ttcgccgccg agggttacgc tcgttcctcc 420

ggcaaaccgg gaatctgcat agccacttcg ggtcccggag ctaccaacct cgtcagcggg 480

ttagccgacg cgatgcttga cagtgttcct ctcgtcgcca tcacaggaca ggtccctcgc 540

cggatgatcg gtactgacgc gttccaagag acgccaatcg ttgaggtaac gaggtctatt 600

acgaaacata actatctggt gatggatgtt gatgacatac ctaggatcgt tcaagaagca 660

ttctttctag ctacttccgg tagacccgga ccggttttgg ttgatgttcc taaggatatt 720

cagcagcagc ttgcgattcc taactgggat caacctatgc gcttgcctgg ctacatgtct 780

aggctgcctc agccaccgga agtttctcag ttaggccaga tcgttaggtt gatctcggag 840

tctaagaggc ctgttttgta cgttggtggt ggaagcttga actcgagtga agaactgggg 900

agatttgtcg agcttactgg gatccctgtt gcgagtacgt tgatggggct tggctcttat 960

ccttgtaacg atgagttgtc cctgcagatg cttggcatgc acgggactgt gtatgctaac 1020

tacgctgtgg agcatagtga tttgttgctg gcgtttggtg ttaggtttga tgaccgtgtc 1080

acgggaaagc tcgaggcgtt tgcgagcagg gctaagattg tgcacataga cattgattct 1140

gctgagattg ggaagaataa gacacctcac gtgtctgtgt gtggtgatgt aaagctggct 1200

ttgcaaggga tgaacaaggt tcttgagaac cgggcggagg agctcaagct tgatttcggt 1260

gtttggagga gtgagttgag cgagcagaaa cagaagttcc cgttgagctt caaaacgttt 1320

ggagaagcca ttcctccgca gtacgcgatt caggtcctag acgagctaac ccaagggaag 1380

gcaattatca gtactggtgt tggacagcat cagatgtggg cggcgcagtt ttacaagtac 1440

aggaagccga ggcagtggct gtcgtcctca ggactcggag ctatgggttt cggacttcct 1500

gctgcgattg gagcgtctgt ggcgaaccct gatgcgattg ttgtggacat tgacggtgat 1560

ggaagcttca taatgaacgt tcaagagctg gccacaatcc gtgtagagaa tcttcctgtg 1620

aagatactct tgttaaacaa ccagcatctt gggatggtca tgcaattgga agatcggttc 1680

tacaaagcta acagagctca cacttatctc ggggacccgg caagggagaa cgagatcttc 1740

cctaacatgc tgcagtttgc aggagcttgc gggattccag ctgcgagagt gacgaagaaa 1800

gaagaactcc gagaagctat tcagacaatg ctggatacac ctggaccgta cctgttggat 1860

gtcatctgtc cgcaccaaga acatgtgtta ccgatgatcc caagtggtgg cactttcaaa 1920

gatgtaataa ccgaagggga tggtcgcact aagtactga 1959

<210>4

<211>652

<212>PRT

<213> ALS3 mutant Gene (ALS3)

<400>4

Met Ala Ala Ala Thr Ser Ser Ser Pro Ile Ser Leu Thr Ala Lys Pro

1 5 10 15

Ser Ser Lys Ser Pro Leu Pro Ile Ser Arg Phe Ser Leu Pro Phe Ser

20 25 30

Leu Thr Pro Gln Lys Pro Ser Ser Arg Leu His Arg Pro Leu Ala Ile

35 40 45

Ser Ala Val Leu Asn Ser Pro Val Asn Val Ala Pro Glu Lys Thr Asp

50 55 60

Lys Ile Lys Thr Phe Ile Ser Arg Tyr Ala Pro Asp Glu Pro Arg Lys

65 70 75 80

Gly Ala Asp Ile Leu Val Glu Ala Leu Glu Arg Gln Gly Val Glu Thr

85 90 95

Val Phe Ala Tyr Pro Gly Gly Ala Ser Met Glu Ile His Gln Ala Leu

100 105 110

Thr Arg Ser Ser Thr Ile Arg Asn Val Leu Pro Arg His Glu Gln Gly

115 120 125

Gly Val Phe Ala Ala Glu Gly Tyr Ala Arg Ser Ser Gly Lys Pro Gly

130135 140

Ile Cys Ile Ala Thr Ser Gly Pro Gly Ala Thr Asn Leu Val Ser Gly

145 150 155 160

Leu Ala Asp Ala Met Leu Asp Ser Val Pro Leu Val Ala Ile Thr Gly

165 170 175

Gln Val Pro Arg Arg Met Ile Gly Thr Asp Ala Phe Gln Glu Thr Pro

180 185 190

Ile Val Glu Val Thr Arg Ser Ile Thr Lys His Asn Tyr Leu Val Met

195 200 205

Asp Val Asp Asp Ile Pro Arg Ile Val Gln Glu Ala Phe Phe Leu Ala

210 215 220

Thr Ser Gly Arg Pro Gly Pro Val Leu Val Asp Val Pro Lys Asp Ile

225 230 235 240

Gln Gln Gln Leu Ala Ile Pro Asn Trp Asp Gln Pro Met Arg Leu Pro

245 250 255

Gly Tyr Met Ser Arg Leu Pro Gln Pro Pro Glu Val Ser Gln Leu Gly

260 265 270

Gln Ile Val Arg Leu Ile Ser Glu Ser Lys Arg Pro Val Leu Tyr Val

275 280 285

Gly Gly Gly Ser Leu Asn Ser Ser Glu Glu Leu Gly Arg Phe Val Glu

290295 300

Leu Thr Gly Ile Pro Val Ala Ser Thr Leu Met Gly Leu Gly Ser Tyr

305 310 315 320

Pro Cys Asn Asp Glu Leu Ser Leu Gln Met Leu Gly Met His Gly Thr

325 330 335

Val Tyr Ala Asn Tyr Ala Val Glu His Ser Asp Leu Leu Leu Ala Phe

340 345 350

Gly Val Arg Phe Asp Asp Arg Val Thr Gly Lys Leu Glu Ala Phe Ala

355 360 365

Ser Arg Ala Lys Ile Val His Ile Asp Ile Asp Ser Ala Glu Ile Gly

370 375 380

Lys Asn Lys Thr Pro His Val Ser Val Cys Gly Asp Val Lys Leu Ala

385 390 395 400

Leu Gln Gly Met Asn Lys Val Leu Glu Asn Arg Ala Glu Glu Leu Lys

405 410 415

Leu Asp Phe Gly Val Trp Arg Ser Glu Leu Ser Glu Gln Lys Gln Lys

420 425 430

Phe Pro Leu Ser Phe Lys Thr Phe Gly Glu Ala Ile Pro Pro Gln Tyr

435 440 445

Ala Ile Gln Val Leu Asp Glu Leu Thr Gln Gly Lys Ala Ile Ile Ser

450 455460

Thr Gly Val Gly Gln His Gln Met Trp Ala Ala Gln Phe Tyr Lys Tyr

465 470 475 480

Arg Lys Pro Arg Gln Trp Leu Ser Ser Ser Gly Leu Gly Ala Met Gly

485 490 495

Phe Gly Leu Pro Ala Ala Ile Gly Ala Ser Val Ala Asn Pro Asp Ala

500 505 510

Ile Val Val Asp Ile Asp Gly Asp Gly Ser Phe Ile Met Asn Val Gln

515 520 525

Glu Leu Ala Thr Ile Arg Val Glu Asn Leu Pro Val Lys Ile Leu Leu

530 535 540

Leu Asn Asn Gln His Leu Gly Met Val Met Gln Leu Glu Asp Arg Phe

545 550 555 560

Tyr Lys Ala Asn Arg Ala His Thr Tyr Leu Gly Asp Pro Ala Arg Glu

565 570 575

Asn Glu Ile Phe Pro Asn Met Leu Gln Phe Ala Gly Ala Cys Gly Ile

580 585 590

Pro Ala Ala Arg Val Thr Lys Lys Glu Glu Leu Arg Glu Ala Ile Gln

595 600 605

Thr Met Leu Asp Thr Pro Gly Pro Tyr Leu Leu Asp Val Ile Cys Pro

610 615620

His Gln Glu His Val Leu Pro Met Ile Pro Ser Gly Gly Thr Phe Lys

625 630 635 640

Asp Val Ile Thr Glu Gly Asp Gly Arg Thr Lys Tyr

645 650

<210>5

<211>20

<212>DNA

<213> BnALS1 primer 1(Artificial Sequence)

<400>5

gtggatctaa ctgttcttga 20

<210>6

<211>19

<212>DNA

<213> BnALS1 primer 2(Artificial Sequence)

<400>6

agagatgaag ctggtgatc 19

<210>7

<211>21

<212>DNA

<213> BnALS2 primer 1(Artificial Sequence)

<400>7

gagtgttgcg agaaattgct t 21

<210>8

<211>24

<212>DNA

<213> BnALS2 primer 2(Artificial Sequence)

<400>8

ttgattattc tatgctctct tctg 24

<210>9

<211>23

<212>DNA

<213> BnALS3 primer 1(Artificial Sequence)

<400>9

atggttagat gagagagaga gag 23

<210>10

<211>21

<212>DNA

<213> BnALS3 primer 2(Artificial Sequence)

<400>10

ggtcgcacta agtactgaga g 21

<210>11

<211>30

<212>DNA

<213> BnALS1 primer 3(Artificial Sequence)

<400>11

cgcggtacct catctctctc tcctctaacc 30

<210>12

<211>29

<212>DNA

<213> BnALS1 primer 4(Artificial Sequence)

<400>12

cgcactagtg atcaccagct tcatctctc 29

<210>13

<211>32

<212>DNA

<213> BnALS3 primer 3(Artificial Sequence)

<400>13

cgcggtaccc tctctctctc tcatctaacc at 32

<210>14

<211>30

<212>DNA

<213> BnALS3 primer 4(Artificial Sequence)

<400>14

cgcactagtc tctcagtact tagtgcgacc 30

Claims

An ALS mutein, characterized in that the ALS mutein comprises ALS1 and ALS3, the ALS1 amino acid sequence of which is as set forth in SEQ ID NO: 2, the ALS3 amino acid sequence is shown as SEQ ID NO: 4, respectively.
2. A nucleic acid encoding the ALS mutein of claim 1.
3. The nucleic acid of claim 2, having the ALS1 nucleotide sequence set forth in SEQ ID NO: 1, the ALS3 nucleotide sequence is shown as SEQ ID NO: 3, respectively.
4. An expression cassette, recombinant vector or cell comprising the nucleic acid of claim 2 or 3.
5. Use of the protein of claim 1, the nucleic acid of claim 2 or 3, the expression cassette, the recombinant vector or the cell of claim 4 for herbicide resistance in plants.
6. Use according to claim 5, wherein the plant is Brassica napus or Arabidopsis thaliana.
7. A method for obtaining a plant with herbicide resistance, comprising the steps of:

1) allowing a plant to comprise the nucleic acid of claim 2 or 3; or

2) Allowing the plant to express the mutein of claim 1.
8. The method according to claim 7, characterized in that it comprises the steps of transgenesis, crossing, backcrossing or asexual propagation.
9. Method for identifying resistant plants, wherein the plants are plants comprising a nucleic acid according to claim 2 or 3, plants expressing a protein according to claim 1 or plants obtained by a method according to any one of claims 7 to 8, comprising the steps of:

1) determining whether the plant comprises the nucleic acid of claim 2 or 3; or the like, or, alternatively,

2) determining whether the plant expresses the protein of claim 1.