CN108103219A - A kind of molecular labeling, primer pair and its application for being used to differentiate red bayberry male and female - Google Patents
A kind of molecular labeling, primer pair and its application for being used to differentiate red bayberry male and female Download PDFInfo
- Publication number
- CN108103219A CN108103219A CN201710221539.3A CN201710221539A CN108103219A CN 108103219 A CN108103219 A CN 108103219A CN 201710221539 A CN201710221539 A CN 201710221539A CN 108103219 A CN108103219 A CN 108103219A
- Authority
- CN
- China
- Prior art keywords
- red bayberry
- female
- plant
- primer pair
- male
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses a kind of for differentiating molecular labeling, primer pair and its application of red bayberry male and female.Pass through the gene order-checking to male and female red bayberry plant, it was found that female plant specific gene FT1 and the FT2 genes shared with male and female plant of the FT1 genes with higher sequence homology compare the sequence of the two by analysis, and design obtains primer pair of the present invention.Primer pair, including sense primer and anti-sense primer, nucleotides sequence is classified as：Sense primer：5′‑GTATCAAATCGATCTTTTC‑3′；Anti-sense primer：5′‑ACAGCTACCTATTTTGGATT‑3′.Differentiate the gender of red bayberry plant using primer pair of the present invention, the accuracy of prediction female plant is up to 99%.PCR identifications red bayberry gender, seedling identification, crossbreeding to red bayberry etc. is carried out using primer pair of the present invention to have great importance, and there is higher guiding value to the practice production of red bayberry.
Description
Technical field
The present invention relates to molecular identificalion technical field, more particularly to it is a kind of for differentiate the molecular labeling of red bayberry male and female,
Primer pair and its application.
Background technology
Red bayberry (Myrica rubra Sieb.＆Zucc.) belongs to Myruca ceas red bayberry spp.ing plant, originates in China southeast each province
And the Yunnan-Guizhou Plateau, cultivation history is long, is the characteristic fruit of south China, and red bayberry main breed is distributed in China Zhejiang at present,
Cultivated area, yield, quality of the provinces such as Jiangsu, Fujian, Jiangxi, Hunan, Guangdong, Guizhou and Yunnan, wherein Zhejiang Province etc. are
Most preferably.The Waxberry fruit maturity period (June) at a time when fruit dull season in 1 year, can effectively fill up fruit vacancy in the market
Phase, along with red bayberry fruit color is gorgeous, unique flavor, while rich in anthocyanin, there is higher nutritive value, deeply by consumer's
Like.
Red bayberry is mostly dioecian plant, rare monoecism；Small, unisexuality is spent, no perianth is anemophilous flower；Female flower Wei Rou
Catkin is opened gradually at the beginning of female flower from early March to 4 months, and mid-March is full-bloom stage, about 20 days florescences；Male flower Wei Fu Rou sprout flowers
Sequence opens successively from late Febuary to early April, and mid-March is full-bloom stage, about 45 days florescences.
However, red bayberry staminiferous plant cannot directly generate economic benefit, therefore at present in cultivation based on female plant.And in red bayberry
It is used in breeding more and grows directly from seeds breeding, it is necessary to wait more than the 10 years male and female that can identify plant.This traditional breeding mode year
Limit for length, production cost is high, and economic benefit is low.It is female to be conducive to relatively early selection using the gender of molecular markers for identification dioecian plant
Strain offspring, can cause the above problem to be improved.The relevant Sex Determination Mechanism of other fruit trees at home and abroad had largely
Report, such as pawpaw, Kiwi berry etc., however correlative study is blank on red bayberry.Searching out one kind can plant in red bayberry
Strain early stage just can effectively differentiate red bayberry plant property method for distinguishing, and seedling identification, crossbreeding to red bayberry etc. have important
Meaning has higher guiding value to the practice production of red bayberry.
The content of the invention
In view of the deficiencies of the prior art, the present invention provides a kind of for differentiating the molecular labeling of red bayberry male and female, Yi Jiji
In a kind of primer pair of molecular labeling design, can early sex mirror effectively be carried out to red bayberry plant using the primer pair
It is fixed.
A kind of molecular labeling for being used to differentiate red bayberry male and female is the special gene FT1 of red bayberry female, and nucleotide sequence is such as
Shown in SEQ ID No.3.
The molecular labeling is by the way that red bayberry gene order-checking, the mixed pond that female, male each 100 individuals separately constitute is surveyed
The 5 individual weights sequencing of sequence and male and female, finds the special genomic segment of female, one of them and relevant function base of blooming
Because of FT1 (SEQ ID No.3), in male plants and the gene is not contained.
Primer pair, including sense primer and anti-sense primer, nucleotides sequence is classified as：
Sense primer：5′-GTATCAAATCGATCTTTTC-3′；
Anti-sense primer：5′-ACAGCTACCTATTTTGGATT-3′.
Homologous gene order FT2 (SEQ ID No.4) is deposited in male and female with the nucleotide sequence 80% of FT1 genes
.By carrying out analysis comparison to their sequence, final design obtains primer pair of the present invention, and by verification with higher
Reliability.
Carry out PCR amplification using primer pair of the present invention, theoretically female red bayberry plant can finally amplify 470bp and
Two specific bands of 268bp, the wherein band of 470bp are the segments of amplification obtained by primer amplification female specific gene FT1
Sequence is as shown in SEQ ID No.5, and the band of 268bp is the fragment sequence such as SEQ of amplification obtained by primer amplification gene FT2
Shown in ID No.6；And the red bayberry plant of male can only amplify a specific band of 268bp.
Certainly, due to the difference between individual plants, there may be gene mutation or chromosome sides for indivedual red bayberry plant
The variation in face causes indivedual male plants also to amplify two specific bands, but for entirety, uses primer pair pair of the present invention
197 parts of red bayberry plant carry out sex identification, and the accuracy rate of identification red bayberry plant female is up to 99% or so, has enough economy
Benefit.
Invention further provides application of the primer pair in red bayberry gender is differentiated.
The red bayberry is red bayberry seedling.
Invention further provides application of the primer pair in the kit for differentiating red bayberry gender is prepared.
The present invention also provides a kind of kits for including the primer pair.
The present invention also provides application of the kit in red bayberry gender is differentiated.
The present invention also provides a kind of discriminating red bayberry property method for distinguishing, comprise the following steps：
(1) red bayberry plant to be detected is sampled and extracts genomic DNA；
(2) using the genomic DNA as template, PCR amplification is carried out using primer pair described in claim 1；
(3) pcr amplification product carries out electrophoresis detection,
If electrophoresis detection result has specific band at 470bp and 268bp, red bayberry plant to be detected is female plant；
If electrophoresis detection result only has specific band at 268bp, red bayberry plant to be detected is staminiferous plant.
The system of the PCR amplification is：
The condition of the PCR amplification is：
94 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 53 DEG C of annealing 30s, 72 DEG C of extension 10s, totally 35 cycle；72 DEG C are prolonged
Stretch 10min.
The present invention passes through the gene order-checking to male and female red bayberry plant, it was found that female plant specific gene FT1 and and FT1
Gene has the FT2 genes that the male and female plant of higher sequence homology shares, and the sequence of the two is compared by analysis, is finally designed
Obtain primer pair of the present invention.Red bayberry male and female plant largely from different places different lines is detected, finds to utilize this
Invention primer pair differentiates the gender of red bayberry plant, and the accuracy of prediction female plant is up to 99%.Using primer pair of the present invention into
Row PCR identifications red bayberry gender, seedling identification, crossbreeding to red bayberry etc. has great importance, and the practice of red bayberry is produced
With higher guiding value.
Description of the drawings
The female mixed pond that it is 0 in male mixed pond DNA sequencing overburden depth on No. 2 chromosomes of red bayberry in embodiment 2 that Fig. 1, which is,
The point of coverage result figure, wherein horizontal line top is female, and the point of lower part is male.
Fig. 2 is the electrophoresis detection result figure of plant part when primer Mr-F1 is used in embodiment 4, wherein, M is
DL2000DNA Markers；Swimming lane 1~9 is female plant, and strain is followed successively by：Water chestnut, east chief, pink kind, Shangyu white poplar plum, An Hai
Piece morning life, Niu Yemei, the black plum in Guangdong, big discipline, black Rayleigh；Swimming lane 10~18 is staminiferous plant, and strain is followed successively by：C2010-1、Y2010-
1、T2011-26、W2011-4、Y2015-1、Y2015-2、FJ2011-40、JS2011-14、GX2011-20。
Fig. 3 is the electrophoresis detection result figure of plant part when primer Mr-F2 is used in embodiment 4, wherein, M is
DL2000DNA Markers；Swimming lane 1~9 is female plant, and strain is followed successively by：Water chestnut, east chief, pink kind, Shangyu white poplar plum, An Hai
Piece morning life, Niu Yemei, the black plum in Guangdong, big discipline, black Rayleigh；Swimming lane 10~18 is staminiferous plant, and strain is followed successively by：C2010-1、Y2010-
1、T2011-26、W2011-4、Y2015-1、Y2015-2、FJ2011-40、JS2011-14、GX2011-20。
Specific embodiment
Embodiment 1
The extraction of genomic DNA.
It extracts the genomic DNA of 197 parts of (100 parts of staminiferous plant, 97 parts of female plant) red bayberry kinds respectively with the CTAB methods of improvement, has
Body method is as follows：
1st, buffer solution is prepared
CTAB buffer solutions：2%CTAB, 0.1M Tris, 20mM EDTA, 1.4M NaCl, pH 8.0；
DNA dissolving buffer solutions TE：10mM Tris；1mM EDTA；pH 8.0.
2nd, red bayberry genomic DNA is extracted
1. weighing the red bayberry young leaflet tablet tissue that about 1.0g is stored in -80 DEG C of refrigerators rapidly with balance, a little PVP is added to prevent
Powder is quickly transferred to the 4mL CTAB solution and 80 for filling the preheating at 65 DEG C by block after being fully ground with liquid nitrogen in mortar
In the 10mL centrifuge tubes of μ L beta -mercaptoethanols, 65 DEG C of water-bath 1h；
2. 4mL chloroforms/isoamyl alcohol (24: 1) will be added in step 1. mixture, vortex mixing, 12000rpm centrifugations
10min takes supernatant in new 10mL pipes, adds in 4mL chloroforms/isoamyl alcohol (24: 1), vortex mixing, 12000rpm centrifugations again
10min；
3. the supernatant of gained is transferred to new 10mL pipes 2. step is centrifuged after, and adds in the isopropyl of isometric -20 DEG C of precoolings
Alcohol, gently mixing, 30min to DNA precipitations are placed at -20 DEG C.10000rpm centrifuges 2min, removes supernatant；
4. with 75% ethyl alcohol cleaning step 3. DNA sediments 3 times；
5. the DNA 4. step is washed after is dried and is dissolved in the TE buffer solutions of 200 μ L, 2 μ L RNase (10mg/ are added in
ML) to remove RNA；DNA detections use ultraviolet specrophotometer (Beckman coulter, USA), determine its concentration and quality,
1 μ L is taken to be detected after diluting 5 times with TE buffer solutions on 1.0% Ago-Gel simultaneously.DNA stostes are stored in -20 DEG C, work
It is spare that liquid is diluted to 30ng/ μ L.
Embodiment 2
Gene order-checking is analyzed, design of primers.
By red bayberry gene order-checking, female, male each 100 mixed pond sequencings and 5 individual weight sequencings of male and female are found female
Property special genomic segment, on No. 2 chromosomes (chr2) tool there are one with relevant functional gene FT1 (SEQ ID of blooming
No.3), the results are shown in Figure 1 for sequencing analysis.The gene order FT2 (SEQ ID No.4) homologous with this sequence 80% is in male and female
In all exist.PCR primer Mr-F1, the Mr-F2 of 2 pairs of discriminating red bayberry genders, hundred biotechnology difficult to understand of commission Hangzhou gold are devised accordingly
Co., Ltd synthesizes, and primer information is as shown in table 1.
Table 1
Embodiment 3
PCR amplification.
1. reaction system：
2. response procedures：94 DEG C of pre-degeneration 5min；94 DEG C denaturation 30s, 53 DEG C annealing 30s, 72 DEG C extension 10s, totally 35
Xun Huan；72 DEG C of extension 10min.
3. product electrophoresis detection on 2.0% Ago-Gel, observation and film recording result under ultraviolet lamp.
Embodiment 4
Using the genomic DNA extracted in embodiment 1 as template, using the primer designed in embodiment 2, according to embodiment 3
In PCR amplification method carry out augmentation detection.The electrophoresis result of plant part such as Fig. 2 (primer Mr-F1) and Fig. 3 (Mr-F2) institute
Show, since Mr-F2 primer amplification clip sizes are close, electrophoresis detection effect is unintelligible, therefore using Mr-F1 primers as most final inspection
Survey primer.
It is expanded using Mr-F1 primers, 197 parts of (100 parts of staminiferous plant, 97 parts of female plant) red bayberry crowd surveillance result such as tables 2
It is shown.The results show：With Mr-F1 primer amplifications, female plant main genotypes are 268/470bp, and the main genotype of staminiferous plant is
268bp, the gender of 197 parts of red bayberry plant is corresponding with amplification gene type, wherein 97 parts of female plant red bayberry testing results are correct；
98 parts of testing results are correct in 100 parts of staminiferous plant red bayberry testing results, 2 parts (number 99,100) male red bayberry testing result with it is pre-
Phase is not inconsistent, and two specific fragments occurs.99% is up to using the accuracy rate of Mr-F primer prediction red bayberry plant females.
Table 2
Note：* with the associated token name of gender, clip size：bp；-/- is not obtain amplified production；♀-female；♂-hero.
SEQUENCE LISTING
<110>Zhejiang University
<120>A kind of molecular labeling, primer pair and its application for being used to differentiate red bayberry male and female
<130>
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 19
<212> DNA
<213>Artificial sequence
<400> 1
gtatcaaatc gatcttttc 19
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence
<400> 2
acagctacct attttggatt 20
<210> 3
<211> 2635
<212> DNA
<213>Red bayberry（Myrica rubra Sieb. & Zucc.）
<400> 3
atggccaggg aaagggacac tctcgctgtt gggcgtgtta taggagatgt gctggacccc 60
tttacaaggt ccattgctct gagggcaatt tataacagta gggaggttaa caacggttgt 120
gagctcaaac cctctcaggt tgtcaaccaa cctagggttg atgttggtgg tgaagatcta 180
aggacgttct atactctggt aaatgtatct tacctctttt ttcctttgct aagcgtcttt 240
ctcttcaact agcttttccc tcaagttgac caccattttt ctcatgagca tttttggttc 300
ttgatatttg acttatgatc atgtccactg cagcttatgg tggatcctga tgcgcccagt 360
ccaagtgatc ccaacctcag ggagtacttg cattggtgag cactctctct ctcattccac 420
aaatacacaa gcacattgca aaggtatcaa atcgatcttt tctctgccct cgatcgtctc 480
tgcgacataa atgcgtagac atccgtttct gactctctat ttgacttccc tcccttcata 540
aaaggactgg taggcggtat agtaatcagg attccatcaa aagctggtta gaagggctca 600
gcattttaaa aaataaatct aatgattgat cccaagtcaa acaaaaaact ctctttattt 660
catctcatta aataaatgaa atggttaaat tcaggccctt ggatttattt tttaaaatct 720
tgacccctcc ttgcaataac ttagaacaaa tgtccttatg atggaaccct ttggcatata 780
ggttggccaa aagaagagag agagaggaaa aagtgatgag aaccggaata ttcttgtttc 840
aattgttcag cctcttttcg ggaaagtagt tcatgcatct tacagaagaa agcaatccaa 900
aataggtagc tgtcgagggc gggatggcgg cggagccaga cattaatatt tgagaaacct 960
ctcgcaatgt actaattgtt taatacgttt aaaaattatg gttaattagt agatttattg 1020
accaacagga tcgatcgaaa gcctaagggg aagcaaaagg acaaggaaga agagttcccc 1080
ctgttgtgat ttttagataa gatacttttt ttcctttaag aagtttttga gcaaaagaaa 1140
aattagattt taaaaaaatt tcttgatttt taagaaaaat ctatacatat atttctatgt 1200
acctatgttg tccttttatt ttattttaat aatcaccaga aagcccaagt actggttttt 1260
tgtgtgaaat tgacaaatat ctttgtcctt ttgttttgct tcctggttga ccgattgagg 1320
gcacgtatga tctctcatgg aaagaaatca tttggaggac cactactaaa gtatctcagg 1380
atatataaag tttctgggat atgcaatgga accgtacatg catgtacgta ccaattacca 1440
tgatacagcc aacaatattg tcatcgtgct ttactcctat attctctccc aggctgtcct 1500
tttccttgtt tctttctctt tgcagttttg tctcctttct ttctcttata cgtacgcacg 1560
tacgtaattc ttcttattcc attgggtagt gatagactct ggaacgtcgc atgttgaata 1620
tttccacatc tgatgacttg tatagtagtg ttgatcgact accatgacaa aggctatcaa 1680
ctctccttaa tatattagag tgatttggca gccagttaat tattgtccgc tgtttaaatc 1740
tgccattgct aatgtaaata ttgcatttaa caaactaatt aattaagaaa ctgtctttaa 1800
gaggacttca agtgataatt tagttgccaa attactgaga agtactctct cgttctttgt 1860
agctattcta tcactattat tatttcttct tggcctttct taactcttgc gataattgtt 1920
aactttttgt catatattta tatatagtga tcaatgatta accgttacca aggcatcggg 1980
tgctattatt gtaacctttc tactttagtt tcatttgaag gtccatttgt cgtagttatg 2040
attttatatt ttgtctagga gaaatttgat attatccgta actgttactt ctactaagtt 2100
tttcaaaatt aagattaatt tgtcgtctcc ctctggtttg ttaggttggt gactgatatt 2160
ccagaaacta cgggggcaag ctttggtgag tatactacac atgcacatgt ggtttagtaa 2220
attatcaaga gttaaagaca cctctcttga gacatgcaaa gcactgtcgt acggcaaaca 2280
atgcttgtat ggctttgtga gaaggccaag catttgtagg gatagtttga tctagcagta 2340
ctattattgt ttgtatcttc atgagtaaca tgtatatatg atctatggcc aaattttttt 2400
gggcgtaggg caagaggttg tgtgctacga aagtccacga ccagtggtag ggatccatcg 2460
gtttgttttc gtgttgttcc gtcaactggg taggcagaca gtatatgcac cagggtggcg 2520
ccaaaatttc aacaccagag acttcgctga gcaatacaat ctcggattgc cagtggctgc 2580
actttacttt aactgccaga gggaaagcgg ctgtggtgga aggagaagat tgtga 2635
<210> 4
<211> 2620
<212> DNA
<213>Red bayberry（Myrica rubra Sieb. & Zucc.）
<400> 4
atggctaggg aaagggaccc tctcactgtt gggcgtgtta taggagatgt gttggacccc 60
tttacgagat ccatcgctat gagggcaatt tataacagta gggaggttaa caacggttgt 120
gagctcaaac cctctcaggt tgtcaaccaa cctagggttg atattggtgg tgaagatctc 180
aggacgttct atactctggt aaatgtatct taccctcttt cttcctttgc cgtgcgtctt 240
tctcttcagc tagctcttcc ctcaagttga ccacctttct tttttctcat gagctttttt 300
ggttcttgat attttactta tgatcatgtc cactgcagct tatggtggat cctgatgcgc 360
ccagtccaag tgatcccagc ctcagggagt acttgcattg gtgagctctc tctctctctc 420
tctctcccca aaatacacaa gccctttgca aaggtactat atatatatag atatattttt 480
cttgtaaaga tgggggaaca tatatttttt cttcttgtaa agatgggaac atatatagta 540
tcaaatcgat cttttctctg ccctcgatcg tctctgcaat ataattccat atacatctgt 600
ttctgactct ctatttgaca tccctagctc cctccataaa acgactggta ggcggtatat 660
aggtcggcca aaaaaaaaaa cagagagagc aagaagagag aagaaccaga atattcttgt 720
ttcagtcgtt cagcctcttt ccgggaaagt agttcatctt ggagcatcaa taatcagcag 780
aaagcaatcc aaaataggta gctgttgagg acgtacggga tggcggcgga tccagaaatt 840
aatatttgag aaacctcgta atatactaat tatttatata cgtttttata gaatatatat 900
ttcttgatct ctcctatatg tatatataac gatagaaaaa ggtagggata taattcaaaa 960
tttaaaaatt atcgatgata tatagattta ttgaccaaca ggatcgatcg aaagcctaag 1020
gggaagcaaa aggacaagga agaagaaatc cccctattgt gattttcaga taagatactt 1080
tttgtttcct tttagaagtt tttgagcaaa agaaaaattg gattttcaaa atatttcttg 1140
atttttaaca aaaatctata catattatat atttctatgt atttatcagc ttgtcctttt 1200
gttttatttt aataattacc agaaagccca agtgctgttt tttcgtgtga aattgacaaa 1260
tatctcttgt ccttttgttt tgcttcctgc ctgatcgatt gagggcacgt atctctcatg 1320
gatgtgaaat tattggagga ccactactaa agtatctttc gatttataag gtttctggga 1380
tatgcatgca tatacgtacc atgataaagc caacaatatt gtcatcgtac gtgctttact 1440
cctatcttct ctccccgtcc ttttccttgt ttgatctttc tccttgaagt tttgtctcct 1500
ttctttctct tatattaata cgtacgcgcg tacgtaattc tccttattct tttttttttc 1560
ttcttgaaaa ttattctcct ttttccattg ggtagtgata gactctggaa cgcatataga 1620
atatttcccc atctaaggac ttgcatatat agtgttaatc gactaccatg ataagggcta 1680
tcaactctct ccttaatata ttagagtgat ttggcagcca gttaaatatt attgcccgct 1740
gtttaaatct agctagctac catgcattgc taatattgta aatatatatt gcatttaaca 1800
aactaagaaa ccatttttaa aaggacttca agtgataaac tattattttc ttcttggcct 1860
ttcttaactc ttacgataac tttttaactt ttgaattata tttatacttt tttgtggtat 1920
tgtcatacat acatatatat atatatatat ataaccgtca ctaaggtgtc aggatttatt 1980
attgtaaact ttctaattta gttttatttg aaggtgcata tgccgtagtt atgattattt 2040
tgtccagtta ggagaaattt gagattattc gtaacagttc tatacaaagt ttttcaaaac 2100
taaaattaat tccctctggt taatttgtca ggttggtgac tgatattcca gcaactacgg 2160
ggacaagctt tggtgagtat tatactatac atgcatgcac atgtggttta ttaaattatc 2220
aagagttaaa gacacctctc ttgagacatg gaaagcaatg tcgtacggga aacaatgctt 2280
gcatggcttt gtgagaatta ggccaagcat ttgtagggat agtttgatta gcactattat 2340
tgttggtatc cttgattgac atatgatgta ttggccaaat tcaatgggtg taggacaaga 2400
ggtggtgtgc tacgaaagtc cacgaccagt ggtagggatc catcggtttg ttttcgtgtt 2460
gttccgtcaa atgggtaggc agacagtata tgcaccgggg tggcgccaga atttcaacac 2520
caaggacttc gctgagctct acaatctcgg attgccagtg gctgcacatt acttcaactg 2580
ccagagggaa agcggttccg gtggaaggag aagatcgtga 2620
<210> 5
<211> 470
<212> DNA
<213>Red bayberry（Myrica rubra Sieb. & Zucc.）
<400> 5
gtatcaaatc gatcttttct ctgccctcga tcgtctctgc gacataaatg cgtagacatc 60
cgtttctgac tctctatttg acttccctcc cttcataaaa ggactggtag gcggtatagt 120
aatcaggatt ccatcaaaag ctggttagaa gggctcagca ttttaaaaaa taaatctaat 180
gattgatccc aagtcaaaca aaaaactctc tttatttcat ctcattaaat aaatgaaatg 240
gttaaattca ggcccttgga tttatttttt aaaatcttga cccctccttg caataactta 300
gaacaaatgt ccttatgatg gaaccctttg gcatataggt tggccaaaag aagagagaga 360
gaggaaaaag tgatgagaac cggaatattc ttgtttcaat tgttcagcct cttttcggga 420
aagtagttca tgcatcttac agaagaaagc aatccaaaat aggtagctgt 470
<210> 6
<211> 268
<212> DNA
<213>Red bayberry（Myrica rubra Sieb. & Zucc.）
<400> 6
gtatcaaatc gatcttttct ctgccctcga tcgtctctgc aatataattc catatacatc 60
tgtttctgac tctctatttg acatccctag ctccctccat aaaacgactg gtaggcggta 120
tataggtcgg ccaaaaaaaa aaacagagag agcaagaaga gagaagaacc agaatattct 180
tgtttcagtc gttcagcctc tttccgggaa agtagttcat cttggagcat caataatcag 240
cagaaagcaa tccaaaatag gtagctgt 268
<210> 7
<211> 20
<212> DNA
<213>Artificial sequence
<400> 7
cctctcaggt tgtcaaccaa 20
<210> 8
<211> 19
<212> DNA
<213>Artificial sequence
<400> 8
gaaaagatcg atttgatac 19
Claims (10)
1. it is a kind of for differentiating the molecular labeling of red bayberry male and female, it is the special gene FT1 of red bayberry female, nucleotide sequence is such as
Shown in SEQ ID No.3.
2. primer pair, including sense primer and anti-sense primer, which is characterized in that nucleotides sequence is classified as：
Sense primer：5′-GTATCAAATCGATCTTTTC-3′；
Anti-sense primer：5′-ACAGCTACCTATTTTGGATT-3′.
3. application of the primer pair as claimed in claim 2 in red bayberry gender is differentiated.
4. application as claimed in claim 3, which is characterized in that the red bayberry is red bayberry seedling.
5. application of the primer pair as claimed in claim 2 in the kit for differentiating red bayberry gender is prepared.
6. a kind of kit for including primer pair as claimed in claim 2.
7. application of the kit as claimed in claim 6 in red bayberry gender is differentiated.
8. a kind of discriminating red bayberry property method for distinguishing, which is characterized in that comprise the following steps：
(1) red bayberry plant to be detected is sampled and extracts genomic DNA；
(2) using the genomic DNA as template, PCR amplification is carried out using primer pair described in claim 2；
(3) pcr amplification product carries out electrophoresis detection,
If electrophoresis detection result has specific band at 470bp and 268bp, red bayberry plant to be detected is female plant；
If electrophoresis detection result only has specific band at 268bp, red bayberry plant to be detected is staminiferous plant.
9. method as claimed in claim 8, which is characterized in that the system of the PCR amplification is：
10. method as claimed in claim 8, which is characterized in that the condition of the PCR amplification is：
94 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 53 DEG C of annealing 30s, 72 DEG C of extension 10s, totally 35 cycle；72 DEG C of extensions
10min。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710221539.3A CN108103219B (en) | 2017-04-06 | 2017-04-06 | Molecular marker and primer pair for identifying male and female waxberry and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710221539.3A CN108103219B (en) | 2017-04-06 | 2017-04-06 | Molecular marker and primer pair for identifying male and female waxberry and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108103219A true CN108103219A (en) | 2018-06-01 |
| CN108103219B CN108103219B (en) | 2020-04-28 |
Family
ID=62207084
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710221539.3A Active CN108103219B (en) | 2017-04-06 | 2017-04-06 | Molecular marker and primer pair for identifying male and female waxberry and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108103219B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110923304A (en) * | 2019-11-29 | 2020-03-27 | 浙江大学 | Molecular marker, primer pair and method for identifying sex of ginkgo biloba |
| CN111088385A (en) * | 2019-12-31 | 2020-05-01 | 广州普邦园林股份有限公司 | Method for identifying sex of female and male heteroplant in early growth stage |
| CN112063705A (en) * | 2020-09-23 | 2020-12-11 | 国家林业和草原局泡桐研究开发中心 | Primer for identifying sex of persimmon tree and application thereof |
| CN113308565A (en) * | 2021-07-09 | 2021-08-27 | 宁波市农业科学研究院 | Molecular marker primer combination for rapidly identifying morphological characters of waxberry leaves and application thereof |
| CN113430280A (en) * | 2021-08-09 | 2021-09-24 | 宁波市农业科学研究院 | Molecular marker primer combination for rapidly identifying maturation stage of waxberry fruits and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104026001A (en) * | 2014-05-28 | 2014-09-10 | 浙江大学 | Method for performing cross breeding on water chestnut and Dongkui waxberry for waxberry cultivating variety |
| CN105441444A (en) * | 2016-01-04 | 2016-03-30 | 浙江大学 | Waxberry EST-SSR molecular markers and application thereof |
-
2017
- 2017-04-06 CN CN201710221539.3A patent/CN108103219B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104026001A (en) * | 2014-05-28 | 2014-09-10 | 浙江大学 | Method for performing cross breeding on water chestnut and Dongkui waxberry for waxberry cultivating variety |
| CN105441444A (en) * | 2016-01-04 | 2016-03-30 | 浙江大学 | Waxberry EST-SSR molecular markers and application thereof |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110923304A (en) * | 2019-11-29 | 2020-03-27 | 浙江大学 | Molecular marker, primer pair and method for identifying sex of ginkgo biloba |
| CN111088385A (en) * | 2019-12-31 | 2020-05-01 | 广州普邦园林股份有限公司 | Method for identifying sex of female and male heteroplant in early growth stage |
| CN112063705A (en) * | 2020-09-23 | 2020-12-11 | 国家林业和草原局泡桐研究开发中心 | Primer for identifying sex of persimmon tree and application thereof |
| CN113308565A (en) * | 2021-07-09 | 2021-08-27 | 宁波市农业科学研究院 | Molecular marker primer combination for rapidly identifying morphological characters of waxberry leaves and application thereof |
| CN113308565B (en) * | 2021-07-09 | 2022-03-01 | 宁波市农业科学研究院 | Molecular marker primer combination for rapidly identifying morphological characters of waxberry leaves and application thereof |
| CN113430280A (en) * | 2021-08-09 | 2021-09-24 | 宁波市农业科学研究院 | Molecular marker primer combination for rapidly identifying maturation stage of waxberry fruits and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108103219B (en) | 2020-04-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108103219A (en) | A kind of molecular labeling, primer pair and its application for being used to differentiate red bayberry male and female | |
| Porcel et al. | BvCOLD1: A novel aquaporin from sugar beet (Beta vulgaris L.) involved in boron homeostasis and abiotic stress | |
| CN107557369B (en) | Characteristic sequence, labeled primer and identification method of apocarya variety Nacono | |
| US9745596B2 (en) | Identification and use of KRP mutants in wheat | |
| CN107840872A (en) | Albumen and the application of wax plum CpWOX13 genes and its coding | |
| CN107099588B (en) | Development and application of SSR (simple sequence repeat) marker for identifying earliness of upland cotton | |
| CN105936898B (en) | A kind of tea tree purple bud GAP-associated protein GAP CsGST and its encoding gene and application | |
| CN112048488B (en) | OsPEAMT2 gene for improving heading stage maturing rate of paddy rice under high temperature stress, protein and application thereof | |
| CN107586866B (en) | Characteristic sequence, labeled primer and identification method of apocarya variety Moore | |
| CN105420256A (en) | Rice yellow-green leaf mutation gene YGL8, protein coded by rice yellow-green leaf mutation gene YGL8, and application of rice yellow-green leaf mutation gene YGL8 | |
| CN109971763A (en) | Florescence control gene C MP1 and relevant carrier and its application | |
| CN116218876A (en) | Gene OsB12D3 for regulating rice chalkiness, encoding protein and application thereof | |
| CN108913698B (en) | CAPS marker related to wheat ear germination resistance/sensibility and application thereof | |
| CN108085405B (en) | Molecular marker and primer pair for identifying male and female waxberry and application thereof | |
| CN114736280B (en) | Application of ZmROA1 protein in regulation and control of plant tolerance | |
| WO2018196744A1 (en) | Transgenic soybean event gc1-1 exogenous insert flanking sequence and application thereof | |
| CN113943732B (en) | SNP (Single nucleotide polymorphism) marker, primer set, kit and application related to heat resistance of cucumber in adult stage | |
| KR101375952B1 (en) | SNP primer for discrimination of Chunpoong cultivar of Panax ginseng C.A. Meyer and method for discriminating the Chunpoong cultivar using the same | |
| CN103834647A (en) | SSR marker Xgwm537 in close linkage with wheat dwarf gene RhtDC20 and application thereof | |
| CN105175519B (en) | Applications of the Protein S RL2 in cultivating leaf roll Qushui River rice | |
| CN106011152A (en) | Transcription factor TFSALT1 for improving salt resistance of rice, and application thereof | |
| CN110407922B (en) | Rice cold-resistant gene qSCT11 and application thereof | |
| CN106317214B (en) | The heat-resisting GAP-associated protein GAP TaXPD of wheat and its encoding gene and application | |
| CN102994528B (en) | Haynaldia villosa calmodulin interacting protein kinase gene and expression vector and application thereof | |
| CN106916213A (en) | A kind of albumin A sT and its encoding gene and the application in plant stress tolerance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |