CN116218876A - Gene OsB12D3 for regulating rice chalkiness, encoding protein and application thereof - Google Patents

Abstract

The invention relates to the technical field of plant genetic engineering, in particular to a gene for regulating and controlling rice chalkinessOsB12D3And encoded proteins and uses thereof; the gene and the encoding protein thereof participate in the chalky regulation of rice and influence the quality of the rice; by conventional methodsOsB12D3Performing gene editing and overexpression, thereby changing the expression level of the gene,thereby obtaining different productsOsB12D3Novel rice germplasm with gene expression level; the rice created by the invention has no obvious difference in the growth and development of plants and basic agronomic traits compared with a parent control, but has obvious influence on the chalkiness rate and chalkiness degree of rice; in the present inventionOsB12D3The gene over-expression can obviously reduce the chalkiness rate and chalkiness degree of rice, improve the appearance quality of rice, provide useful gene resources for genetic improvement of rice quality, and have important breeding utilization value.

Description

Gene OsB12D3 for regulating rice chalkiness, encoding protein and application thereof

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to a gene OsB12D3 for regulating rice chalkiness, and a coding protein and application thereof.

Background

Rice is an important grain crop in China, and more than 60% of people in China take rice as main food. In recent years, the rice unit yield and the total yield in China are both in an increasing trend, however, the cultivation progress of high-quality rice is relatively slow, and the market share of the high-quality rice in China is low. The quality character of rice relates to various aspects including appearance, taste, nutrition and the like, wherein the appearance quality of rice directly determines the commodity value of the rice and is one of key indexes for evaluating the quality of the rice. Chalkiness are the most important factors affecting the appearance quality of rice, and at the same time, they have a certain influence on the appearance quality and taste quality of rice. Therefore, the level of chalkiness of rice directly affects the commercial value of rice, and how to quickly improve chalkiness has become a problem to be solved in the rice breeding industry in China.

During the development of rice kernels, the filling of the endosperm is the process of accumulating a large amount of storage substances such as starch and protein. The filling level of substances such as starch or protein during this period affects not only the yield of rice but also the appearance of rice, especially when the stock is not filled sufficiently, easily causing the appearance of inter-starch-granule cavities and thus the chalky phenotype. Previous studies have shown that many factors, besides genetic factors, such as temperature, humidity, light, water and fertilizer conditions during grouting, can significantly influence chalky development.

There have been many studies on genetic regulation of rice chalkiness, such as genes involved in rice endosperm sugar transport, energy metabolism and stress response, which may affect rice chalkiness (Zhao et al genetic control of grain appearance quality in rice [ J ]. Biotechnology advances,2022,60,108014.). Nevertheless, there is still a lot of blank research on chalkiness, and there are currently few genes cloned for chalkiness that are more practical in breeding, such as chalkiness 5, which are fewer genes that are more suitable for chalkiness-improved breeding (Li YIbo et al, chalkines 5 encodes a vacuolar H (+) -translocating pyrophosphatase influencing grain chalkiness in rice. [ J ]. Nature genetics,2014,46 (4): 398-404.). Therefore, a plurality of novel chalky regulation genes are discovered and cloned, the breeding application potential is further explored, and the method has important theoretical and practical significance on the current rice quality breeding research.

Disclosure of Invention

In order to solve the problems in the existing rice appearance quality improvement process, the invention provides a gene OsB12D3 for regulating and controlling rice chalkiness, a coding protein and application thereof, and provides a new gene resource for genetic improvement of rice quality.

In order to achieve the above purpose, the technical scheme adopted by the invention for solving the technical problems is as follows:

in a first aspect, the invention provides a gene OsB12D3 for regulating rice chalkiness, wherein the nucleotide sequence of the gene OsB12D3 is shown as SEQ ID NO.1, or the nucleotide sequence of the gene OsB12D3 is at least 90% homologous with the sequence shown as SEQ ID NO. 1.

The amino acid sequence of the OsB12D3 is shown as SEQ ID NO.2, or the amino acid sequence of the OsB12D3 is at least 90% homologous with the sequence shown as SEQ ID NO. 2.

In a second aspect, the invention provides an application of a gene OsB12D3 for regulating rice chalkiness in reducing rice grain chalkiness and improving rice quality.

The application method comprises the following steps: editing, knocking out, modifying, inhibiting or overexpressing the rice chalky gene OsB12D3 to change the expression level of the OsB12D3 gene in the target rice variety, thereby obtaining rice plants with different phenotypes.

Preferably, the vector used in the gene encoding process is pC1300-Cas9-B12D3, and comprises a gene OsB12D3; the carrier system is CRISPR/Csa9; the system comprises an intermediate vector SK-gRNA and a final vector pC1300-Cas9.

A method for preparing a vector pC1300-Cas9-B12D3, which comprises the following steps: mixing the primer with a linear intermediate carrier SK-gRNA cut by Aar I restriction enzyme, connecting the mixture with T4DNA ligase to obtain a plasmid SK-gRNA-B12D3, cutting the SK-gRNA-B12D3 plasmid by using restriction enzymes Kpn I and Bgl II, recovering a 300bp fragment, mixing the 300bp fragment with a pC1300-Cas9 carrier cut by Kpn I and BamH I, and connecting the mixture with T4DNA ligase.

Preferably, the primer sequences are as follows:

sequence name	Sequence(s)	Sequence numbering
			Primer3	5'GGCAGCCGCGATGATGTTGGCAT 3'	SEQ ID NO.5
Primer4	5'AAACATGCCAACATCATCGCGGC 3'	SEQ ID NO.6

Preferably, the over-expression vector used in the gene over-expression process is 3×Flag-B12D3, and comprises a gene OsB12D3, and the vector is a plant expression vector pC1300Actin-3×Flag, wherein the over-expression vector comprises a promoter of rice self-constitutive high-expression gene Actin.

The preparation method of the excess expression vector 3-flag-B12D 3 comprises the following steps: the pC1300 action-3 x flag vector carrying the action promoter linearized by restriction endonucleases Sma I and Sal I cleavage was mixed with PCR amplification product comprising OsB12D3 and subjected to homologous recombination ligation using ClonExpress Ultra One Step Cloning Kit.

Preferably, the PCR amplification primer sequences are as follows:

sequence name	Sequence(s)	Sequence numbering
			Primer7	5'TCCCCCGGGATGGGGCGTTGGGTTAGGCCT 3'	SEQ ID NO.9
Primer8	5'GTCGACATCATCATTGTTCTCATCATGAT 3'	SEQ ID NO.10

The invention has the following beneficial effects: the invention discovers that the disruption of the biological function of the OsB12D3 gene encoding protein can significantly influence the appearance quality of rice, and is expressed as the increase of the chalkiness of grains; after the OsB12D3 is excessively expressed, the chalk of rice can be obviously reduced, the rice quality is improved, and the gene has an important effect on improving the rice quality. The invention provides useful gene resources and technical routes for genetic improvement of rice appearance quality.

Drawings

FIG. 1 is an analysis of the expression pattern of the OsB12D3 gene in rice according to the first embodiment of the present invention;

FIG. 2 is a schematic diagram of an OsB12D3 gene editing target site and a mutation type in a second embodiment of the present invention;

FIG. 3 shows the chalkiness analysis of OsB12D3 knockout strain rice in the third embodiment of the present invention; "x" indicates very significant differences;

FIG. 4 shows the analysis of the target gene expression level of an OsB12D3 gene overexpression line according to the fourth embodiment of the present invention; "x" indicates very significant differences;

FIG. 5 shows a chalkiness analysis of rice of an OsB12D3 gene over-expression strain in a fourth embodiment of the present invention; "x" indicates a very significant difference.

Detailed Description

The following is a description of specific embodiments of the invention to facilitate the understanding of the invention by those skilled in the art. It should be understood that the invention is not limited to the scope of the specific embodiments, and that any obvious modifications, equivalent changes, simple substitutions, etc. based on the technical solutions of the present invention, all inventions making use of the inventive concept are included in the protection.

In the following examples, various processes and methods, which are not described in detail, are conventional methods well known in the art. The primers used are all indicated at the first occurrence, and the same primers used thereafter are all identical to the first indicated ones.

The methods used in the examples described below are conventional methods unless otherwise specified. The test materials used in the examples described below, unless otherwise specified, were purchased from conventional Biochemical reagent companies.

Embodiment one: analysis of expression pattern of OsB12D3 Gene in Rice

Obtaining the OsB12D3 Gene sequence

The research focuses on the influence of endosperm dominant expression genes on rice quality, so a series of endosperm specific expression genes are screened for functional research based on a rice gene chip expression database. Wherein an endosperm dominance expression gene OsB12D3 is identified, the encoded protein of which consists of 96 amino acids (SEQ ID NO. 2) and the corresponding gene comprises 5443 nucleotides (SEQ ID NO. 1). The above genes and amino acid sequences are derived from the Japanese genome of rice varieties (http:// rice. Plant biology, msu. Edu).

OsB12D3 Gene expression Pattern verification

In order to verify the endosperm dominant expression characteristics of the OsB12D3 gene, a pair of quantitative analysis primers crossing exons were designed in the exon region of the OsB12D3 gene by using on-line software QuantPrime (https:// quatpprime. Mpimp-golm. Mpg. De /), the primer sequences were as follows:

sequence name	Sequence(s)	Sequence numbering
			primer1	5'ATGATGTTGGCATCGGGCA3'	SEQ ID NO.3
primer2	5'GCGCTTGCTGATCTTGACTT 3'	SEQ ID NO.4

Taking japonica rice Nippon fine as a material, taking different tissues (roots, stems, leaves, leaf sheaths and young ears) and grains (0, 5, 10, 15, 20, 25 and 30 DAF) of rice in different development periods, extracting plant total RNA by using a plant rapid RNA extraction kit (Nuo-uzan, fastPure Universal Plant Total RNA Isolation Kit), and synthesizing first-strand cDNA by using a reverse transcription kit (Nuo-uzan, hiScript III RT SuperMix for qPCR). The expression level of OsB12D3 in different tissues was detected using a quantitative PCR kit (Norflu, chamQ Universal SYBR qPCR Master Mix) and the above quantitative PCR primers (SEQ ID NO.3 and SEQ ID NO. 4). As shown in FIG. 1, the gene is expressed only during rice grouting, and especially the expression level is highest in 20 days after flowers, and is an endosperm specific gene, which indicates that the gene may have important biological significance in endosperm development.

Embodiment two: construction of OsB12D3 gene knockout vector in rice and transgene detection

1. Gene editing site design

According to the existing CRISPR/Cas9 related experimental method, GGCCGCGATGATGTTGGCATCGGG sequence containing GGG as a recognition site is selected on the 2 nd exon of OsB12D3 to be taken as a knockout target site (shown in figure 2), and Primer3 and Primer4 (SEQ ID No. 5 and SEQ ID No. 6) are designed by using online tool targetDesign software (http:// skl. Scau. Edu. Cn/targetdign /) and are used for constructing a gene editing vector.

The CRISPR primer sequences are as follows:

sequence name	Sequence(s)	Sequence numbering
			Primer3	5'GGCAGCCGCGATGATGTTGGCAT3'	SEQ ID NO.5
Primer4	5'AAACATGCCAACATCATCGCGGC3'	SEQ ID NO.6

CRISPR/Cas9 vector construction and genetic transformation method

The CRISPR/Csa9 vector system used in the research is provided by a research institute Wang Kejian of China paddy rice, the system comprises an intermediate vector SK-gRNA and a final vector pC1300-Cas9, and the DNA frameworks of the system are respectively derived from a pBlueScript (SK+) vector and a pCAMBLA1300 vector.

The method comprises the following specific steps: respectively diluting primers primer3 and primer4 to 100 mu M concentration, respectively mixing 10 mu L of the primers, denaturing at 100 ℃ for 5 minutes, and naturally cooling to obtain a double-chain sequence containing a knocked-out target site; 7. Mu.L of annealed primers were mixed with the linear intermediate vector SK-gRNA (100 ng) after cleavage with AarI restriction enzyme and ligated with T4DNA ligase; taking out competent cells of Escherichia coli DH5 alpha (Nanjinouzan Co.) from-80 ℃, thawing on ice, rapidly adding the connection product of the previous step after the cells are dissolved, gently mixing by a pipette, standing on ice for 30min, then carrying out heat shock at 42 ℃ for 30s, standing on ice for 2min again, adding 10 times of LB non-antibiotic culture solution into the transformation product, and culturing at 37 ℃ for 50min at 200 rpm; taking out the activated bacterial liquid, centrifuging at 4000rpm, removing most of supernatant, plating the residual liquid (about 100 mu L) after suspension (LB+ampicillin resistance), and standing and culturing at 37 ℃ overnight; the next day, 3mL (LB+ampicillin resistance) of monoclonal colony is picked up for amplification culture, a special sequencing primer is constructed by using a vector for sequencing and verifying the target site sequence, positive clone is selected and plasmid is extracted for standby.

The SK-gRNA-B12D3 plasmid was cut with restriction enzymes Kpn I and Bgl II, and the 300bp fragment was recovered and mixed with the pC1300-Cas9 vector cut with both Kpn I and BamH I, and ligated with T4DNA ligase. Coli was transformed in line with the previous procedure and clones were selected for sequencing and the properly sequenced plasmid was designated pC1300-Cas9-B12D3. Taking out Agrobacterium EHA105 cells from-80 ℃, thawing on ice, adding 1 mu L of prepared positive cloning plasmid, gently mixing, placing on ice for 30min, freezing in liquid nitrogen for 2min, rapidly taking out, placing in 37 ℃ water bath, dissolving cells for 2min, adding 10 times volume of LB non-antibiotic culture solution into the transformation product, and culturing at 28 ℃ at 250rpm for 2-3h; taking out activated bacterial liquid, centrifuging at 5000rpm, removing most of supernatant, re-suspending the bacterial liquid (about 100 mu L), coating (LB+kanamycin) on the bacterial liquid, and standing at 28 ℃ overnight for culturing for 36-48h; and (3) picking a monoclonal colony for sequencing, and obtaining a positive strain named as Cas9-B12D3.

The positive Cas9-B12D3 agrobacterium strain is used for transforming the flower 11 (ZH 11) callus of rice by using an agrobacterium-mediated rice mature embryo transformation method (Liu Qiaoquan and the like, plant physiological report, 1998), and the successfully transferred callus cells are obtained through hygromycin resistance screening and are subjected to redifferentiation to form positive transgenic rice seedlings. When the seedling is about 10cm high, transplanting after detection and identification to obtain T ₀ And (5) generating rice plants.

Embodiment III: phenotypic analysis of OsB12D3 knockout line

1. Transgenic seedling detection

The agrobacterium infection transformation obtains 30 seedlings in total, a hygromycin detection primer is firstly used for screening to obtain positive seedlings, and then sequencing primers primer5 (SEQ ID NO. 7) and primer6 (SEQ ID NO. 8) are designed at the upstream and downstream of the genome sequence of the target site and are used for detecting mutation conditions near the target site. After sequence amplification based on the target site and sequencing analysis, 2 types of gene mutation were obtained in total (as shown in fig. 2).

The sequencing primer sequences were as follows:

sequence name	Sequence(s)	Sequence numbering
			primer5	5'TAATGCCCGTCACAGATAAGG 3'	SEQ ID NO.7
Primer6	5'TACTTGACTTCAGGGTTGGTG 3'	SEQ ID NO.8

Phenotypic analysis of OsB12D3 knockout line

At T ₀ And T ₁ In the generation planting, the investigation on the agronomic characters of different strains shows that compared with the wild medium flower 11, the knockout mutant line has no obvious difference with other agronomic characters except rice chalkiness. Subsequently, a stably inherited mutant line was obtained in the T2 generation, and field planting was repeated three times, 2 lines each, and chalky properties of rice were further examined. The results show a significant increase in both chalkiness and chalkiness of the knockout mutant seeds compared to wild-type medium flower 11. Thus, it was demonstrated that OsB12D3 is a rice chalkiness regulatory gene (as shown in FIG. 3).

Embodiment four: construction of overexpression line of OsB12D3 Gene and phenotypic analysis

Construction of OsB12D3 overexpression vector and obtaining of transgenic plant

The plant expression vector used in this study was Pc1300 action-3 x flag (purchased from Shanghai-associated michaelia corporation) which included the promoter of the rice self-constitutive high-expression gene action.

The sequence of the amplification primer of the OsB12D3 coding sequence is as follows

Sequence name	Sequence(s)	Sequence numbering
			Primer7	5'TCCCCCGGGATGGGGCGTTGGGTTAGGCCT 3'	SEQ ID NO.9
Primer8	5'GTCGACATCATCATTGTTCTCATCATGAT 3'	SEQ ID NO.10

The method comprises the following specific steps: the method comprises amplifying the coding region sequence of OsB12D3 (without stop codon) by using Japanese cDNA as a template and primers 7 and 8, performing gene amplification on a PCR instrument by using high-fidelity DNA polymerase Phanta Master (Noruzan corporation), detecting the PCR product by 1% agarose gel electrophoresis, cutting off gel containing the target gene fragment, and recovering the target fragment by using a gel recovery kit (DP 209 days root). The recovered product was then mixed with pC 1300-Actin-3. Times. Flag vector carrying an Actin promoter linearized by restriction enzymes Sam I and Sal I cleavage and subjected to homologous recombination ligation with ClonExpress Ultra One Step Cloning Kit (Noruzan). The ligation product was transformed into E.coli DH 5. Alpha. Competent cells (Nanjinopran Corp.) by heat shock. The transformed cells were plated on LB solid medium containing 100mg/L ampicillin and cultured, and clones were selected for sequencing, and the plasmid with correct sequencing was designated 3X flag-B12D3. Transforming the carrier 3-Flag-B12D 3 into flowers 11 in japonica rice by using an agrobacterium-mediated method, and obtaining transgenic seedlings. Wherein the agrobacterium transformation and rice genetic transformation methods are described in examples two and three.

Phenotypic analysis of transgenic plants overexpressing OsB12D3

For the transgenic rice carrying the 3 x flag-B12D3 construct, at T ₂ In the transgenic lines, hygromycin resistance screening is utilized to obtain homozygous lines. Subsequently, seeds 15 days after the flowers of the homozygous lines were collected, total RNA of the seeds was extracted and reverse transcribed into cDNA, and the expression level of the OsB12D3 gene in the homozygous lines was analyzed by using the above primers primer1 (SEQ ID NO. 3) and primer2 (SEQ ID NO. 4), to obtain 2 lines whose expression levels were significantly up-regulated for the subsequent plant phenotype analysis (as shown in FIG. 4). Basic agronomic trait analysis shows that the traits of the OsB12D3 over-expression transgenic rice, such as plant height, tiller number, growth period, spike length, grain shape and the like, are not obviously different from those of a parent control (data slightly), so that the OsB12D3 over-expression does not obviously influence the growth and development of the rice. The visual quality of the B12D3 overexpressing line rice was emphasized, and both the chalkiness and chalkiness of OsB12D3 overexpressing line rice were significantly reduced compared to wild-type (as shown in fig. 5). This indicates that the appearance quality of rice can be improved by means of over-expressing OsB12D3, which has important breeding value for genetic improvement of rice quality traits. SEQ ID NO.1:

/>

/>

SEQ ID NO.2：

/>

Claims (10)

1. the gene OsB12D3 for regulating rice chalkiness is characterized in that the nucleotide sequence of the gene OsB12D3 for regulating rice chalkiness is shown as SEQ ID No.1, or the nucleotide sequence of the gene OsB12D3 for regulating rice chalkiness is at least 90% homologous with the sequence shown as SEQ ID No. 1.

2. The gene OsB12D3 for regulating rice chalkiness according to claim 1, wherein the amino acid sequence encoded by OsB12D3 is shown in SEQ ID NO.2 or the amino acid sequence encoded by OsB12D3 is at least 90% homologous to the sequence shown in SEQ ID NO. 2.

3. Use of the gene OsB12D3 according to claim 1 or 2 for regulating rice chalkiness for reducing rice grain chalkiness and improving rice quality.

4. The use according to claim 3, characterized in that the method of use is as follows: editing, knocking out, modifying, inhibiting or overexpressing the rice chalky gene OsB12D3 to change the expression level of the OsB12D3 gene in the target rice variety, thereby obtaining rice plants with different phenotypes.

5. The use according to claim 4, wherein the vector used in the gene encoding process is pC1300-Cas9-B12D3, comprising the gene OsB12D3; the carrier system is CRISPR/Csa9; the system comprises an intermediate vector SK-gRNA and a final vector pC1300-Cas9.

6. The method of making vector pC1300-Cas9-B12D3 of claim 5, wherein the method is as follows: mixing the primer with a linear intermediate carrier SK-gRNA cut by Aar I restriction enzyme, connecting the mixture with T4DNA ligase to obtain a plasmid SK-gRNA-B12D3, cutting the SK-gRNA-B12D3 plasmid by using restriction enzymes Kpn I and Bgl II, recovering a 300bp fragment, mixing the 300bp fragment with a pC1300-Cas9 carrier cut by Kpn I and BamH I, and connecting the mixture with T4DNA ligase.

7. The method of preparing vector pC1300-Cas9-B12D3 according to claim 6, wherein the primer sequences are as follows:

sequence name Sequence(s) Sequence numbering Primer3 5'GGCAGCCGCGATGATGTTGGCAT 3' SEQ ID NO.5 Primer4 5'AAACATGCCAACATCATCGCGGC 3' SEQ ID NO.6

8. The method according to claim 4, wherein the overexpression vector used in the process of overexpression of the gene is 3 x flag-B12D3, the gene OsB12D3 is contained, and the vector is a plant expression vector pC1300Actin-3 x flag, wherein the expression vector comprises a promoter of a rice self-constitutive high-expression gene Actin.

9. The method for preparing the over-expression vector 3 x flag-B12D3 according to claim 8, wherein the method is as follows: the pC1300 action-3 x flag vector carrying the action promoter linearized by restriction endonucleases Sma I and Sal I cleavage was mixed with PCR amplification product comprising OsB12D3 and subjected to homologous recombination ligation using ClonExpress Ultra One Step Cloning Kit.

10. The method for preparing the over-expression vector 3 x flag-B12D3 according to claim 9. The PCR amplification primer is characterized by comprising the following sequences:

sequence name Sequence(s) Sequence numbering Primer7 5'TCCCCCGGGATGGGGCGTTGGGTTAGGCCT 3' SEQ ID NO.9 Primer8 5'GTCGACATCATCATTGTTCTCATCATGAT 3' SEQ ID NO.10

Images