CN117165598A

CN117165598A - Application of over-expressed GhAFP2 gene in delaying cotton flowering time

Info

Publication number: CN117165598A
Application number: CN202311112290.4A
Authority: CN
Inventors: 马亮; 吕晓炎; 魏恒玲; 孙璐; 李世云; 付小康; 喻晓云; 芦建华
Original assignee: Handan Academy Of Agricultural Sciences; Institute of Cotton Research of Chinese Academy of Agricultural Sciences
Current assignee: Handan Academy Of Agricultural Sciences; Institute of Cotton Research of Chinese Academy of Agricultural Sciences
Priority date: 2023-08-31
Filing date: 2023-08-31
Publication date: 2023-12-05

Abstract

The invention provides an application of an over-expressed GhAFP2 gene in delaying cotton flowering time, belonging to the technical field of genetic engineering. The invention analyzes the expression mode of GhAFP2 gene in the flower bud of 1-5 leaf stage of cotton institute 50 in early maturing variety and cotton bud 11 in late maturing variety, and the result shows that the expression quantity of the gene in 5 stages of late maturing variety is obviously higher than that of early maturing variety. In order to further study the influence of GhAFP2 on flowering time, an over-expression vector is constructed, and compared with wild flowering time, the over-expression transgenic strain obtained by heterologous expression in Arabidopsis is delayed, so that the GhAFP2 gene plays a negative regulation role on cotton flowering time.

Description

Application of over-expressed GhAFP2 gene in delaying cotton flowering time

Technical Field

The invention relates to the technical field of genetic engineering, in particular to application of an over-expressed GhAFP2 gene in delaying cotton flowering time.

Background

The development of cotton industry has important strategic position in the industrial structure and national economy of China, and the cotton industry of China is characterized in that the demand is larger than the output, and the contradiction between the supply and demand of cotton in China is continuously developed along with the rapid development of economy in recent years (Xu Aiwu, 2022). China has been the largest cotton producer and consumer world worldwide for many years, and from the current international political forms, it is more necessary to ensure that cotton production is stable and cannot depend excessively on importation. Meanwhile, the contradiction between cotton and grain in China is continuously outstanding, and how to balance the planting areas of cotton and grain crops and ensure the complementation of cotton and grain production is also a problem to be solved urgently. And the cultivation of the early maturing cotton with excellent properties provides ideas and methods for solving the problems. The early maturing cotton has the characteristics of short plant height, compact plant type, short growth period, faster growth and development and the like. In coastal saline-alkali soil areas unsuitable for planting grain and oil crops, the characteristics of early maturing cotton and late spring sowing can avoid the damage to cotton emergence caused by the increase of drought and salt-alkali concentration in early spring, so that the cotton planting area is effectively increased. In northwest inland regions with low air temperature in spring, rapid air temperature drop in autumn, poor photo-thermal conditions and little precipitation, the premature cotton can also improve the pre-frost flower rate of the cotton and avoid the yield reduction of the cotton caused by the premature frost (Yu Shuxun and the like, 1991). The precocity of cotton is a complex trait, subject to the limitations of growth rate, length of growth period, first fruit branch position and flowering time (Feng Lu, etc., 2022). Flowering is an important turning point for changing plant from vegetative growth to reproductive growth, and plays a decisive role in the maturity of cotton, so that research on related genes for regulating flowering time in cotton and a regulation network are beneficial to cultivation of new varieties of early maturing cotton.

Studies have shown that ABI5-BINDING PROTEIN 2 (AFP 2) links CO and TPR2 as bridging PROTEINs in arabidopsis to form complexes, recruiting Histone Deacetylases (HDACs) to inhibit FT expression, and possibly also promoting ubiquitin-mediated degradation of CO PROTEINs by COP1, leading to the late flowering phenotype of arabidopsis (CHANG et al, 2019). AFP2 is able to promote synthesis of arabidopsis thaliana seedling stage Jasmonic Acid (JA) and delay flowering, whereas mutant jasmonic acid synthase LOX2 or receptor COI1 can partially alleviate late flowering phenotype caused by AFP2-ox, while overexpression of AFP2 enhances the ability of TOE1 to bind to FT promoter, inhibiting transcription of FT resulting in late flowers (An Minmin et al, 2019). AFP2 has been reported to negatively regulate ABA signal by accelerating the degradation of bZIP transcription factor abscisic acid-inssisitiv mut 5 (ABI 5), ABI5 being a key component of ABA signal transduction and being episomal to AFP2, and also to be able to delay arabidopsis flowering by binding to the G-box element on the FloweringLocus C (FLC) promoter to up-regulate FLC expression (WANG et al 2013).

Disclosure of Invention

In order to solve the problems, the invention provides application of the over-expressed GhAFP2 gene in delaying cotton flowering time, and the invention analyzes the expression patterns of the GhAFP2 gene in flower buds of 1-5 leaf stage of cotton in early maturing variety 50 and late maturing variety Guoxin 11, and results show that the expression quantity of the gene in 5 stages of the late maturing variety is obviously higher than that of the early maturing variety. In order to further study the influence of GhAFP2 on flowering time, an over-expression vector is constructed, and compared with wild flowering time, the over-expression transgenic strain obtained by heterologous expression in Arabidopsis is delayed, so that the GhAFP2 gene plays a negative regulation role on cotton flowering time.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides application of over-expressed GhAFP2 gene in delaying cotton flowering time.

Preferably, the nucleotide sequence of the GhAFP2 gene is shown as SEQ ID No. 1.

Preferably, the amino acid sequence of the GhAFP2 gene is shown in SEQ ID No. 2.

Preferably, the nucleotide sequence of the upstream primer for amplifying the GhAFP2 gene is shown as SEQ ID No.3, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 4.

The beneficial effects of the invention are as follows:

the invention analyzes the expression mode of GhAFP2 gene in the flower bud of 1-5 leaf stage of cotton institute 50 in early maturing variety and cotton bud 11 in late maturing variety, and the result shows that the expression quantity of the gene in 5 stages of late maturing variety is obviously higher than that of early maturing variety. In order to further study the influence of GhAFP2 on flowering time, an over-expression vector is constructed, and compared with wild flowering time, the over-expression transgenic strain obtained by heterologous expression in Arabidopsis is delayed, so that the GhAFP2 gene plays a negative regulation role on cotton flowering time.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required to be used in the embodiments will be briefly described below.

FIG. 1 shows the expression pattern of GhAFP2 gene in different stages of early and late maturing materials;

FIG. 2 shows the flowering-time delay of Arabidopsis thaliana overexpressed by the GhAFP2 gene.

Detailed Description

In the invention, the nucleotide sequence of the GhAFP2 gene is shown as SEQ ID No.1, and the nucleotide sequence is specifically as follows:

ATGGGAAAAGCTGAAGAAATTGGAAGGAAAGAAACCCAACAAAGCATATCCATGCAAGTTACGAATCTACCGAGGGATTTACTTCAAAGATTCATGTCATCAAGCTATCATTTTTCCCAAAATGGTGAAACAGAGGAAGAAGAACAAGAAGAAGAGATTGAGTTAAGTTTAGGACTTTCATTGAATGGTCGTTTTGGGGTTGACCCAAAAGCCAAAAAACTCACTAGATCATCATCAATACCTGATTTCATCAACAACACTAATGAATCATCTTCTTCTCCGTCATCATTATTCCCCATGGCTTGTGGTTCACTTGTTAGAACATGTTCTTTACCTGTTGAAACTGAAGAAGAATGGAGGAAAAGGAAGGAGATACAGAGTTTAAGGAGGTTGGCAGCTAAGAGGAAAAGGTCTGAGAAACAAAAGAATTTGAAAGCTTTAAAAGATAAGAATAGAGAAGGTTTAGGTGAAGAGAATTGTGAAGAAGATAAGAAAGAAGAGGGTAGGGTTAATGGTGGTCGTGGACCATTAATGGCTGCTTCACAAGGTTCAATTGGTTCTCAAGGAAGTGGTTCTTCAGGCATATCTGAACTTGACAGCCAACCACCTCAAGGAAGTTACAAATGCCAAGGGTCAAGAAGCCCTACGAGTGTGCAATCTACAACACAAACCGAGCAAAAACCAAACATCATCAACCCCGGAAAGATATCAACTCAGAAATCCGAAAAGTTAGCCGGAATCACAGCTAAGAATCAACATAATCAACCAGGAGTAGATGAAAAAGGAGTTAAGGCAAGTGTGAGGAACATAATGGAAGACATGCCATGTGTGTCAACAACAGGAGATGGTCCTAATGGGAAAAGAATAGAAGGGTTTCTTTACAGATATAGAAAAGGTGAAGGAGTGAGAATAGTATGTGTTTGTCATGGCAGTTTCCTTTCTCCGGCCGAGTTCGTCAAACATGCCGGCGGTGGCGACGTAGAACATCCGTTAAAGCATATAGTTGTTAGCCCTTCTTTCATTTTCTAG。

in the invention, the amino acid sequence of the GhAFP2 gene is shown as SEQ ID No.2, and the specific steps are as follows:

MGKAEEIGRKETQQSISMQVTNLPRDLLQRFMSSSYHFSQNGETEEEEQEEEIELSLGLSLNGRFGVDPKAKKLTRSSSIPDFINNTNESSSSPSSLFPMACGSLVRTCSLPVETEEEWRKRKEIQSLRRLAAKRKRSEKQKNLKALKDKNREGLGEENCEEDKKEEGRVNGGRGPLMAASQGSIGSQGSGSSGISELDSQPPQGSYKCQGSRSPTSVQSTTQTEQKPNIINPGKISTQKSEKLAGITAKNQHNQPGVDEKGVKASVRNIMEDMPCVSTTGDGPNGKRIEGFLYRYRKGEGVRIVCVCHGSFLSPAEFVKHAGGGDVEHPLKHIVVSPSFIF。

in the invention, the nucleotide sequence of an upstream primer for amplifying the GhAFP2 gene is shown as SEQ ID No.3, and the nucleotide sequence of a downstream primer is shown as SEQ ID No.4, and the specific steps are as follows:

SEW ID No.3:

CACGGGGGACTCTAGAATGGGAAAAGCTGAAGAAATTGG；

SEW ID No.4:

GATCGGGGAAATTCGAGCTCCTAGAAAATGAAAGAAGGGCTAACAA。

the present invention will be described in detail with reference to examples for further illustration of the invention, but they should not be construed as limiting the scope of the invention.

Example 1

1. Test materials

1.1 Cotton Material

The cotton materials selected by the invention are cotton institute 50 in early maturing varieties of upland cotton and cotton 11 in late maturing varieties, wherein the cotton institute 50 and the cotton 11 have extremely remarkable differences in flowering time and growth period (table 1), and are planted in a cotton institute test field (white wall town of an Anyang city in Henan province) of China academy of agricultural sciences, and the management measure is normal field management. The sampling mode is that the buds of two cotton varieties from one leaf stage to five leaf stage are placed in liquid nitrogen and are preserved at-80 ℃ before the sample RNA is extracted.

Significance test of cotton institute 50 and Guoxin cotton 11 traits in Table 1

Traits (3)	Middle 50	Guoxin cotton 11	Differences in
				Growth period (Tian)	108	124	15 ^**
Flowering phase (Tian)	62	70	8 ^**

1.2 reagents and consumables

Restriction endonuclease, modification enzyme, related enzyme of PCR reaction system, homologous recombination enzyme, gel recovery kit, cloning kit, plasmid small extraction kit are purchased from Novamat biotechnology Co., ltd, fluorescent quantitative kit is purchased from century biotechnology Co., ltd, and RNA extraction kit is purchased from Beijing-day root biochemical technology Co., ltd

Other drugs: agarose is spanish original product, peptone, yeast extract, chloroform, isoamyl alcohol, ethanol, isopropanol, sodium chloride, etc. are domestic analytically pure, kanamycin, etc. Soilebao biological Co., ltd, and E.coli competent cells DH5 alpha and Agrobacterium competent cells are purchased from Optimago biological Co., ltd

Culture medium: LB liquid medium: tryptone (Tryptone) 10g/L, yeast extract (Yeastogract) 5g/L, sodium chloride (NaCl) 10g/L; LB solid medium: 10g/L of Tryptone (Tryptone), 5g/L of Yeast extract (Yeast extract), 10g/L of sodium chloride (NaCl) and 15g/L of agar powder, and fixing the volume to 1L; LB selection Medium: before LB plate paving, adding antibiotics with corresponding concentration when the culture medium is sterilized under high pressure and cooled to 55 ℃, shaking uniformly, and then paving the plate; 1/2MS solid medium: 1/2MS22g/L, agar powder (agarwder) 8g/L, sucrose (sucrose) 30g/L.

The main instrument is as follows: PCR amplification apparatus (BIO-RAD), high-speed centrifuge (HettichMIKRO 200R), electrophoresis apparatus (BIO-RAD), gel imaging system (BIO-RAD), fluorescent quantitative PCR apparatus (ABI 7500), electrothermal constant temperature incubator (Shanghai Senxin), constant temperature culture oscillator (Shanghai Zhi Cheng), artificial climate test chamber (Saifu), artificial climate chamber.

2. Test methods and results

2.1 Gene cloning and sequence analysis

The CDS sequence and the encoded amino acid sequence of the GhAFP2 (GH_A09G 0095) gene, which was 1029bp in CDS sequence, encoded 342 amino acids, were obtained from cottonFGD (http:// www.cottonfgd.org /), designated GhAFP2, and the function thereof was studied.

The CDS sequence of GhAFP2 is (SEQ ID No. 1):

ATGGGAAAAGCTGAAGAAATTGGAAGGAAAGAAACCCAACAAAGCATATCCATGCAAGTTACGAATCTACCGAGGGATTTACTTCAAAGATTCATGTCATCAAGCTATCATTTTTCCCAAAATGGTGAAACAGAGGAAGAAGAACAAGAAGAAGAGATTGAGTTAAGTTTAGGACTTTCATTGAATGGTCGTTTTGGGGTTGACCCAAAAGCCAAAAAACTCACTAGATCATCATCAATACCTGATTTCATCAACAACACTAATGAATCATCTTCTTCTCCGTCATCATTATTCCCCATGGCTTGTGGTTCACTTGTTAGAACATGTTCTTTACCTGTTGAAACTGAAGAAGAATGGAGGAAAAGGAAGGAGATACAGAGTTTAAGGAGGTTGGCAGCTAAGAGGAAAAGGTCTGAGAAACAAAAGAATTTGAAAGCTTTAAAAGATAAGAATAGAGAAGGTTTAGGTGAAGAGAATTGTGAAGAAGATAAGAAAGAAGAGGGTAGGGTTAATGGTGGTCGTGGACCATTAATGGCTGCTTCACAAGGTTCAATTGGTTCTCAAGGAAGTGGTTCTTCAGGCATATCTGAACTTGACAGCCAACCACCTCAAGGAAGTTACAAATGCCAAGGGTCAAGAAGCCCTACGAGTGTGCAATCTACAACACAAACCGAGCAAAAACCAAACATCATCAACCCCGGAAAGATATCAACTCAGAAATCCGAAAAGTTAGCCGGAATCACAGCTAAGAATCAACATAATCAACCAGGAGTAGATGAAAAAGGAGTTAAGGCAAGTGTGAGGAACATAATGGAAGACATGCCATGTGTGTCAACAACAGGAGATGGTCCTAATGGGAAAAGAATAGAAGGGTTTCTTTACAGATATAGAAAAGGTGAAGGAGTGAGAATAGTATGTGTTTGTCATGGCAGTTTCCTTTCTCCGGCCGAGTTCGTCAAACATGCCGGCGGTGGCGACGTAGAACATCCGTTAAAGCATATAGTTGTTAGCCCTTCTTTCATTTTCTAG.

the amino acid sequence encoded by GhAFP2 is (SEQ ID No. 2):

MGKAEEIGRKETQQSISMQVTNLPRDLLQRFMSSSYHFSQNGETEEEEQEEEIELSLGLSLNGRFGVDPKAKKLTRSSSIPDFINNTNESSSSPSSLFPMACGSLVRTCSLPVETEEEWRKRKEIQSLRRLAAKRKRSEKQKNLKALKDKNREGLGEENCEEDKKEEGRVNGGRGPLMAASQGSIGSQGSGSSGISELDSQPPQGSYKCQGSRSPTSVQSTTQTEQKPNIINPGKISTQKSEKLAGITAKNQHNQPGVDEKGVKASVRNIMEDMPCVSTTGDGPNGKRIEGFLYRYRKGEGVRIVCVCHGSFLSPAEFVKHAGGGDVEHPLKHIVVSPSFIF

2.2 expression Pattern analysis

Flowering time is an important index of the maturity of cotton, 50 cotton seeds in early-maturing varieties and 11 cotton seeds in late-maturing varieties are selected for further researching whether the expression modes of the gene in early-maturing varieties are different, flower bud RNA of one-leaf stage to five-leaf stage is extracted, and the expression mode analysis of GhAFP2 is carried out by using qRT-PCR technology.

2.2.1 sampling and grinding

Terminal buds of cotton seed 50 and Guoxin 11, one-leaf stage to five-leaf stage, were selected, placed in liquid nitrogen, ground to a powder using a mortar and pestle, and about 1g of the sample was placed in a 1.5ML centrifuge tube.

2.2.2 extraction of RNA

RNA extraction was performed using kit FastPure Universal PlantTotal RNAIsolationKit (novidan, south kyo, china) as follows:

(1) The experiment was performed at normal temperature, 600. Mu.l of BufferPSL (polyphenol polysaccharide plant) was immediately added to a centrifuge tube containing plant tissue, vigorously vortexed and oscillated for 30sec, and the sample was thoroughly and uniformly mixed with the lysate, centrifuged at 12,000rpm (134,00 Xg) for 5min, and immediately subjected to the subsequent operation.

(2) About 500. Mu.l of the supernatant was taken up to FastPure gDNA-Filter Columns III (FastPuregDNA-Filter Columns III)

Has been placed in a collection tube), centrifuged at 12,000rpm (13,400 Xg) for 30sec, fastPuregDNA-Filter Columns III is discarded and the filtrate is collected.

(3) Anhydrous ethanol (about 250 μl, adjusted according to the actual condition of the supernatant) was added to the collection tube in an amount of 0.5 times the volume of the filtrate, and mixed by shaking for 15sec. The above mixture was transferred to FastPure RNA Columns V (FastPure RNAColumns V was placed in a collection tube, centrifuged at 12,000rpm (13,400×g) for 30sec, and the filtrate was discarded.

(4) To FastPure RNA Columns V, 700. Mu.l Buffer RWA was added, and the mixture was centrifuged at 12,000rpm (13,400 Xg) for 30sec, and the filtrate was discarded.

(5) To FastPure RNA Columns V, 500. Mu.l Buffer RWB (please check whether 48ml absolute ethanol had been added before use), and centrifuge at 12,000rpm (13,400 Xg) for 30sec, discard the filtrate.

(6) And (6) repeating the step 6.

(7) FastPure RNA Columns V was put back into the collection tube and centrifuged at 12,000rpm (13,400 Xg) for 2min.

(8) FastPure RNA Columns V was transferred to a fresh RNase-free Collection Tubes 1.5.5 ml centrifuge tube, 30-100. Mu.l of RNase-free ddH2O was suspended in the center of the column membrane, and centrifuged at 12,000rpm (13,400 Xg) for 1min.

The elution volume of (2) is not less than 30. Mu.l, and too small a volume may affect the recovery efficiency of nucleic acid.

Can help to increase the concentration of RNA products by: dropwise adding RNase-free ddH2O, and standing at room temperature for 5min; and (3) adding the first eluent into the adsorption column again for eluting.

(9) The extracted RNA can be directly used for downstream experiments or stored at-85 to-65 ℃.

2.2.3 Synthesis of reverse transcribed cDNA

Kit for synthesis and utilization of reverse transcription cDNAIIQ RT SuperMix for qPCR (+gDNA wind) (Norvezan, nanjing, china) can be divided into two parts, removal of genomic gDNA and reverse transcription of RNA, the reaction is carried out on ice, and the reaction steps are as follows:

(1) Removal of genomic gDNA

Configuration of reaction System

TABLE 2 reaction system

Reagent(s)	Dosage of
		RNase-free ddH ₂ O	to16μl
4×gDNA wiper Mix	4μl
		Template RNA	1pg-1μg

Gently beating and mixing by a pipette. 42 ℃ for 2min.

(2) Preparation of reverse transcription reaction System

TABLE 3 reaction system

Reagent(s)	Dosage of
		Reaction solution of the first step	16μl
5×HiScript II qRT SuperMix II	4.0μl

The mixture was gently stirred with a pipette, and 20. Mu.l of the mixture was placed in a PCR apparatus at 50℃for 15min and 85℃for 5sec. The product can be used immediately for qPCR reactions or stored at-20 ℃ and used within half a year.

2.2.4 fluorescent quantitative PCR

(1) Specific primers of the GhAFP2 gene are designed by utilizing Oligo 7 software, and the cotton GhACtin gene is used as an internal reference gene.

TABLE 4 primer sequences

(2) Fluorescent quantitative PCR

Was done using a Cwbio (China) UltraSYBR Mixture (Low ROX) kit and an applied biosystems 7500 instrument. The specific process is as follows:

1) Diluting the cDNA stock solution by 5 times;

2) Configuration of the reaction system (on ice operation):

TABLE 5 reaction system

Reagent(s)	Dosage of
		2×UltraSYBR Mixture	10.0μl
PCR Forward Primer(10μM)	0.4μl
		PCR Reverse Primer(10μM)	0.4μl
cDNA template (diluted working solution)	2.0μl
		dH ₂ O (sterilizing distilled water)	upto20μl

Mixing the prepared system uniformly, centrifuging until no bubble exists, and then carrying out fluorescence quantitative PCR by using Applied Biosystems 7500: the PCR procedure was set up according to the two-step method: pre-denaturation: 95 ℃ for 2min;95 ℃ for 5s; at 60 ℃,34s (fluorescence signal is collected in this step), 40 cycles are set in these two steps; and finally, analyzing a dissolution curve: 95 ℃ for 15s;60 ℃ for 20s;95℃for 15s. The data were processed using Microsoft Excel 2019 software to calculate gene expression levels and Origin 2022 software was plotted.

2.2.5 GhAFP2 quantitative result analysis

The relative expression amount of GhAFP2 in different periods of two materials of Zhongcotton institute 50 (CCRI-50) and Guoxin cotton 11 (GX 11) is utilized to 2 ^-△△Ct And (5) calculating a method. As can be seen from FIG. 1, the expression level of the GhAFP2 gene in the first-leaf stage to the fifth-leaf stage of the late-maturing variety Guoxin 11 is significantly higher than that of cotton 50 in the early-maturing variety, which indicates that the gene may be related to the cotton maturing.

2.3 Cloning of GhAFP2 Gene and construction of PBI121-GhAFP2 plant expression vector

2.3.1 GhAFP2 gene cloning primer design

The full length of the CDS sequence of GhAFP2 was ligated to the PBI121 vector to construct a 35S promoter vector. Primers containing appropriate cleavage sites were designed at the start codon and stop codon, respectively. The cleavage sites used for the PBI121 vector were XbaI and SacI.

The primer sequences of the GhAFP2 cleavage site are as follows:

TABLE 6 primer sequences

Primer name	Primer sequence (5 'to 3')
		PBI121-GhAFP2-F	SEQ ID No.3CACGGGGGACTCTAGAATGGGAAAAGCTGAAGAAATTGG
PBI121-GhAFP2-R	SEQ ID No.4GATCGGGGAAATTCGAGCTCCTAGAAAATGAAAGAAGGGCTAACAA

2.3.2 PCR cloning of GhAFP2 Gene

(1) PCR reaction system

According to PrimeSTAR GXL DNA polymerase instructions, the PCR reaction system is as follows:

TABLE 7 reaction system

(2) PCR reaction procedure:

(3) Detection of PCR products

Mu.l of the PCR product was taken, 3. Mu.l of 6×Loading Buffer was added, mixed well, spotted on 1% agarose gel, and the size of the band was checked by electrophoresis as to whether it was 1029bp or not.

(4) PCR product purification

The product purification kit (Vazyme, DC 301) was used as follows:

1) Rapidly cutting gel containing target DNA fragment under ultraviolet lamp, weighing gel, wherein 100mg gel is equivalent to 100 μl volume, and taking the gel volume as one gel volume;

2) An equal volume of Buffer GDP was added. Water bath at 50-55 deg.c until the gel is dissolved completely;

3) The adsorption column was placed in a collection tube, and 700. Mu.l or less of the sol was transferred to the adsorption column, and centrifuged at 12,000Xg for 30-60sec.

4) The filtrate was discarded and the column was placed in a collection tube. Add 300 μl Buffer GDP to the column. Standing for 1min. Centrifuge at 12,000Xg for 30-60sec.

5) The filtrate was discarded and the column was placed in a collection tube. 700 μl Buffer GW (absolute ethanol added) was added to the column. Centrifuge at 12,000Xg for 30-60sec.

6) And (5) repeating the step 5.

7) The filtrate was discarded and the column was placed in a collection tube. Centrifuge at 12,000Xg for 2min.

8) The column was placed in a 1.5ml centrifuge tube, 20-30. Mu.l of sterilized water was added to the center of the column, and the column was left for 2min. Centrifuge at 12,000Xg for 1min. The column was discarded and the DNA was stored at-20 ℃.

2.3.3 Construction of PBI121-GhAFP2 plant expression vector

(1) Double enzyme digestion and glue recovery of PBI121 plasmid

The PBI121 plasmid was digested with XbaI and SacI, and the digested product of the PBI121 vector was purified by agarose gel electrophoresis. The enzyme digestion reaction system is as follows:

TABLE 8 reaction system

Reagent name	Dosage of reagent
		XbaI	1μl
SacI	1μl
		Cut Smart	5μl
PBI121 plasmid	1μg
		ddH ₂ O	Upto50μl

(2) Ligation of PCR gel recovery product and restriction enzyme digestion PBI121 plasmid

Use of Vazyme homologous recombinase reagentsIIOne Step Cloning Kit carrying out a ligation reaction:

TABLE 9 reaction system

Reagent name	Dosage of reagent
		5XCEⅡBuffer	2μl
ExnaseⅡ	1μl
		PBI121 double enzyme cutting carrier	25～100ng
PCR fragment	10～100ng
		ddH ₂ O	Upto10μl

After the system is completed, the components are blown and evenly mixed, and the reaction is carried out for 30min at 37 ℃.

(3) Ligation product transformation of E.coli

1) Adding 100ul of escherichia coli DH5 alpha competent ligation reaction system, adding ligation reaction product into the ligation reaction system, and ice-bathing for 25min;

2) Heat shock in 42 ℃ water bath for 45s;

3) Ice bath for 2min; 700ul of non-resistant LB liquid medium is added, and the mixture is incubated for 1h at 37 ℃ and 200 rpm;

4) Centrifuging at 5000rpm for 1min, leaving about 100ul of supernatant, mixing, and coating on LB plate containing kana resistance;

5) Culturing at 37 deg.C overnight;

(4) Detection and sequencing of Positive clones

1) Selecting a monoclonal from the transformation plate, putting the monoclonal into a liquid LB culture medium containing Kan, and carrying out shaking culture at a constant temperature of 37 ℃ for 8 hours;

2) Colony PCR verifies positive clones and the correct monoclonal is sent to Shang Ya biotechnology limited for sequencing, 3 replicates per sequence.

(5) Preservation of positive bacterial liquid

And (3) performing PCR verification on bacterial liquid, and adding glycerol into bacterial liquid with correct sequencing until the final concentration is more than 20%, and preserving at-80 ℃. The correctly sequenced plasmid was returned for transformation of Agrobacterium.

(6) Transformation of Agrobacterium

Transformation of Agrobacterium tumefaciens GV3101 competent cells by freeze thawing:

1) The agrobacterium is thawed at-80 ℃ and the ice water is inserted into the ice in a mixed state.

2) Mu.l of competent plasmid DNA was added to 1. Mu.g, and the mixture was stirred by hand to the bottom of the tube, and then allowed to stand on ice for 5min, liquid nitrogen for 5min, and ice-bath for 5min at 37 ℃.

3) Adding 700ul of non-resistant LB liquid medium, and shake culturing at 28deg.C for 2-3 hr

4) 100-150ul of bacterial liquid is placed on an LB plate containing kana and rifampicin, and is placed in an incubator at 28 ℃ for 2-3 days in an inverted manner.

5) Positive clones are selected, cultured for 48 hours at 28 ℃ on LB liquid culture medium with resistance, and the bacterial liquid is preserved for standby at-80 ℃ after the bacterial liquid with correct strips is verified by PCR and glycerol is added.

2.3.4 Agrobacterium-mediated transformation of Arabidopsis thaliana

(1) Arabidopsis thaliana culture

And planting Columbia wild type Arabidopsis thaliana in a phytotron, growing to a full bloom stage, and cutting off pod which is already fruiting.

(2) Transformation of Arabidopsis inflorescence infection

1) Activating bacterial liquid: inoculating 20 μl of Agrobacterium solution stored at-80deg.C into 1ml LB liquid culture medium (corresponding antibiotics: kanamicin and rifampin are added), culturing at 28deg.C and 180rpm for 14-18 hr;

2) Expanding and shaking: adding 500 μl of activated bacterial liquid into 50ml LB liquid culture medium containing corresponding antibiotics, culturing at 28deg.C and 180rpm until bacterial liquid OD ₆₀₀ The value is about 0.8-1.2 (about 18-20 h), 5000rpm, centrifuging for 10min, discarding supernatant, and collecting thallus;

3) Preparation of infection transformation medium: 1/2MS halving, 5% sucrose, 0.02% Silwet L-77, pH adjusted to 5.6-5.7 with NaOH, 0.1mM AS (acetosyringone);

4) Resuspension of the cells with transformation medium, OD ₆₀₀ Adjusting to 0.6-0.8;

5) Dip dyeing: placing the arabidopsis inflorescence into a transformation medium for 60s, and culturing for 24h under the condition of weak light or light shading after dip dyeing;

6) Placing the treated arabidopsis thaliana under normal conditions for culture, and carrying out secondary infection by using the same method after one week;

7) After maturation, the Arabidopsis seeds are harvested, namely the transgenic T ₀ Seed generation.

2.3.5 phenotypic characterization of transgenic Arabidopsis plants

(1) The harvested seeds are planted on 1/2MS containing kanamycin after sterilization, vernalization is carried out at 4 ℃ for 2 days, the seeds are transferred into a manual climate test box, positive plants grow normally about 10 days, and negative plant leaves turn yellow and do not grow any more.

(2) Transplanting the positive arabidopsis plants into nutrient soil, extracting DNA after growing for one month, and detecting the positive plants by PCR, wherein the primers used in the detection are as follows:

TABLE 10 primer sequences

(3) Breeding to T ₃ And (3) generating, namely obtaining the homozygous transgenic arabidopsis strain.

(4) Will T ₃ The generation plants and the wild type plants (WT) are planted in nutrient soil, after about 10 days, arabidopsis seedlings grow true leaves and then move into flowerpots to grow, and under the same conditions, the qRT-PCR technology is used for planting and cultivating, the expression quantity of the GhAFP2 gene in the GhAFP2 transgenic plants is found to be obviously higher than that of the wild type, the phenotype observation shows that the GhAFP2 transgenic arabidopsis flowers are obviously later than that of the wild type (figure 2), and the result shows that the GhAFP2 possibly plays a negative regulation role in the process of regulating and controlling flowering time.

Although the foregoing embodiments have been described in some, but not all, embodiments of the invention, it should be understood that other embodiments may be devised in accordance with the present embodiments without departing from the spirit and scope of the invention.

Claims

1. Use of overexpressing the GhAFP2 gene for delaying cotton flowering time.

2. The use according to claim 1, wherein the nucleotide sequence of the GhAFP2 gene is shown in SEQ ID No. 1.

3. The use according to claim 2, wherein the amino acid sequence of the GhAFP2 gene is shown in SEQ ID No. 2.

4. The use according to claim 2, wherein the nucleotide sequence of the upstream primer for amplifying the GhAFP2 gene is shown in SEQ ID No.3 and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 4.