CN102994528B - Haynaldia villosa calmodulin interacting protein kinase gene and expression vector and application thereof - Google Patents
Haynaldia villosa calmodulin interacting protein kinase gene and expression vector and application thereof Download PDFInfo
- Publication number
- CN102994528B CN102994528B CN201210512583.7A CN201210512583A CN102994528B CN 102994528 B CN102994528 B CN 102994528B CN 201210512583 A CN201210512583 A CN 201210512583A CN 102994528 B CN102994528 B CN 102994528B
- Authority
- CN
- China
- Prior art keywords
- wheat
- gene
- powdery mildew
- resistance
- hvcipk1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a haynaldia villosa calmodulin interacting protein kinase gene and expression vector and application thereof, belonging to the field of gene engineering. The cDNA sequence of HvCIPK1 is SEQ ID NO.1, and the encoded amino acid sequence thereof is SEQ ID No.2. The gene is reported in the haynaldia villosa for the first time, expression is up-regulated due to the induction of powdery mildew germ, and overexpression of the gene in winnow wheat 158 of wheat variety resisting powdery mildew can improve the resistance of the winnow wheat 158 to powdery mildew germ. HvCIPK1 is an important element in disease resistant signal transduction pathway of haynaldia villosa and can be guided into wheat variety resisting powdery mildew, so that the resistance to powdery mildew is improved; the molecular mechanism exploring the action thereof can help to understand the broad-spectrum resistance mechanism of the powdery mildew.
Description
Technical field
The invention belongs to genetically engineered field, disclose a cluster hair wheat class calmodulin interact protein kinase gene HvCIPK1 and expression vector thereof and application.
Background technology
Wheat is the food crop the widest, cultivated area is maximum that distribute in the world, has very important effect to mankind's grain security.In Wheat Production process, be subject to coercing (as disease and pest, arid, salt marsh etc.) of many adverse circumstances, restrict the raising of its yield and quality.Infect by obligatory parasitism fungi Blumeria graminis f.sp.tritici the second largest disease that the wheat powdery mildew caused is China's wheat, occur the gesture increased the weight of gradually from south to north in recent years, bring more and more serious harm to Wheat Production.Preventing and treating the most economical effective means of Powdery Mildew is use disease-resistant variety, but due to the change of pathogenic bacteria microspecies fast, the existing most of kind of China loses the resistance to Powdery Mildew gradually.The mildew-resistance gene that separation andpreconcentration is new, utilizes transgenic technology to improve and creates wheat anti-powdery mildew new germ plasm, for the seed selection of wheat anti-white powder new variety provides new path.
Cluster hair wheat (Haynaldia villosa, 2n=14, VV), it is a wild relatives of wheat, the diseases such as its high resist powdery mildew of wheat, rust, Wheat spindle streak mosaic, gaeumannomyces graminis disease, and there is drought resisting, salt tolerant, the characteristic such as cold-resistant, be the valuable genetic resources storehouse of the degeneration-resistant genetic improvement of wheat.Pm21 gene wherein from cluster hair wheat 6VS is one of current mildew-resistance major gene, there is the features such as strong resistance, anti-spectrum be wide, it is the most effective mildew-resistance gene (reference: Chen P D so far, Qi L L, ZhouB, et al.Development and molec μ lar cytogenetic analysis of wheat-Haynaldia villosa6VS/6AL translocation lines specifying resistance to powdery mildew.Theor Appl Genet, 1995,91:1125-1128.).Therefore, research Pm21 gene plays signal transduction pathway gene involved in resistant effect process and important Defense response gene, for the molecule mechanism understanding resistance of wide spectrum, uses genetic engineering means to improve the resistance of wheat to Powdery Mildew significant.
Summary of the invention:
The object of the invention is the above-mentioned defect for prior art, a kind of cluster hair wheat class calmodulin interact protein kinase gene HvCIPK1 is provided.
Another object of the present invention is to provide the expression vector of this gene.
Another object of the present invention is to provide the application of this gene and expression vector.
Object of the present invention realizes by following technical scheme:
Class calmodulin interact protein kinase gene HvCIPK1, from cluster hair wheat, its nucleotides sequence is classified as SEQ ID NO.1.
The protein HvCIPK1 of this cluster hair wheat class calmodulin interact protein kinase gene coding, its aminoacid sequence is SEQ IDNO.2.
Expression vector containing described class calmodulin interact protein kinase gene HvCIPK1.
Expression vector containing described class calmodulin interact protein kinase gene HvCIPK1 preferably with pAHC25 for the carrier that sets out, by described HvCIPK1 gene insert pAHC25 SmaI and SacI restriction enzyme site between gained.
Described class calmodulin interact protein kinase gene HvCIPK1 is cultivating the application in powdery-mildew-resistance wheat kind.
The expression vector of described class calmodulin interact protein kinase gene HvCIPK1 is cultivating the application in Powdery Mildew wheat breed.
Beneficial effect:
The present invention clones and obtains a class calmodulin interact protein kinase gene HvCIPK1 and coded protein HvCIPK1 thereof from cluster hair wheat.HvCIPK1 can be used for genetic engineering breeding, is inserted into expression vector pAHC25, and the Overexpression vector obtaining this gene imports in susceptible wheat breed, can improve sense Powdery Mildew wheat breed to the resistance of Powdery Mildew.
Accompanying drawing explanation
Fig. 1 utilizes a set of interpolation based material of China spring, cluster hair wheat and Wheat-Haynaldia villosa translocation lines 6VS/6AL and wheat-haynaldia villosa to carry out chromosome segment location to HvCIPK1 gene, HvCIPK1 is navigated to 6V the short arm of a chromosome.
1, cluster hair wheat; 2, wheat-haynaldia villosa 6VS/6AL translocation line 92R137; 3, China spring (Chinese Spring); 4, wheat-haynaldia villosa DA1V; 5, wheat-haynaldia villosa DA2V; 6, wheat-haynaldia villosa DA3V; 7, wheat-haynaldia villosa DA4V; 8, wheat-haynaldia villosa DA5V; 9, wheat-haynaldia villosa DA6V; 10, wheat Haynaldia villosa DA7V; 12, Marker DL2000 (Takala).
The RT-PCR of Fig. 2 HvCIPK1 after the induction of cluster hair wheat vanes powdery mildew analyzes
0h, 2h, 6h, 12h, 24h, 48h represent the leaf cDNA sample of Powdery Mildew induction of 0h, 2h, 6h, 12h, 24h, 48h respectively.
Fig. 3 HvCIPK1 Overexpression vector builds
The T of Fig. 4 HvCIPK1 gene transformation Yangmai No.158
0for positive transgenic plant PCR Molecular Identification result
Swimming lane 1 is the contrast of unconverted Yangmai No.158, and swimming lane 2 is Marker DL2000, and swimming lane 3 is for comprising the plasmid of goal gene, and swimming lane 4-23 is followed successively by T
0for regeneration plant (wherein swimming lane 4,5,7,13,14,15,17,18,21,22,23 is positive transformants plant), swimming lane 24 is water blank.
Fig. 5 common wheat karyomit(e) diagram
Fig. 6 H. villosa chromosome diagram
The diagram of Fig. 7 Wheat-Haynaldia villosa translocation lines 6VS/6AL
The interpolation of Fig. 8 wheat-haynaldia villosa is the diagram of DA6V
Embodiment
The clone of embodiment 1 cluster hair wheat class calmodulin interact protein kinase gene HvCIPK1
CDNA sample and barley chip of expression spectrum Barley 1GeneChip(http: //www.affymetrix.com/products/arrays/specific/barley.affx after this laboratory utilizes cluster hair wheat induced by powdery mildew in earlier stage) hybridize, screening and cloning one in cluster hair wheat by the serine/threonine kinase gene (Hv-S/TPK) of white powder abduction delivering, physical positioning is in Pm21 place section, high mildew-resistance (Cao A Z is showed after proceeding to susceptible wheat Yangmai No.158 overexpression, Xing L P, etal.Serine/threonine kinase gene Stpk-V, a key member of powdery mildew resistancegene Pm21, confers powdery mildew resistance in wheat, PNAS, 2011, 108(19): 7727 – 7732).For clone is positioned at the mildew-resistance genes involved of cluster hair wheat Pm21 place section further, the present invention is starting point with Hv-S/TPK, screens the disease resistance gene analog around it.
Large quantity research shows, certain collinearity is there is between paddy rice and chromosome of wheat, wherein there is collinearity between wheat Part VI homology group's karyomit(e) and paddy rice the 2nd article of karyomit(e), the homologous gene of Hv-S/TPK in paddy rice is positioned on clone AP004093.3 and AP004863.3, and the clone of these two next-door neighbours to be positioned on the 2nd article of karyomit(e) and to partly overlap.By search Genbank, obtain BAC homologous sequence paddy rice the 2nd article of karyomit(e) being positioned at Hv-S/TPK gene upstream and downstream, utilize the sequence information of rice genome further, the homology BAC around Hv-S/TPK continues the disease resistance gene analog of screening Part VI homology group region intermediate.
Around the homology BAC of Hv-S/TPK, in wheat Part VI homology group, find the EST23 with disease-resistant gene structure altogether, devise 68 primers (composition 49 to).49 pairs of primers all can amplify band in cluster hair wheat, in order to filter out the disease resistance gene analog be positioned on 6VS, the present invention is with 6VS/6AL translocation line, wheat-haynaldia villosa alien addition line (DA1V-DA7V) (1, Chen P D, Qi L L, Zhou B, et al.Development and molecular cytogenetic analysisof wheat-Haynaldia villosa 6VS/6AL translocation lines specifying resistance topowdery mildew.Theor Appl Genet, 1995, 91:1125-1128.2, L.L.Qi, S.L.Wang, P.D.Chen, D.J.Liu, B.S.Gill 1998 Identification and physical mapping of three Haynaldiavillosa chromosome-6V deletion lines TAG 97:1042-1046) genomic dna is that template carries out pcr amplification, finally obtain 6 genes be positioned on 6VS.Wherein 1 is Barley1-14940(primer pair P1tgctctccttggatacattt(SEQ ID NO.3) and P2(acaaggttcagaaaggtgaa(SEQ ID NO.4)), chromosomal localization is as Fig. 1, the result display of its prediction, it comprises the serine threonine kinases structural domain that is different from Hv-S/TPK completely, in order to study the function difference of it and Hv-S/TPK, and whether it is related with Hv-S/TPK in mildew-resistance, the method clone of screening cluster hair wheat Leaf cDNA Library is utilized to obtain the full length sequence of this gene further.
The cluster hair wheat Leaf cDNA Library (Chen Yaping, 2005) of the powdery mildew induction 12h that the present invention is used, can meet and study the clone of Pm21 gene and other resistant gene, Analysis of Defence Genes Involved and other excellent genes in cluster hair wheat blade.CDNA fragment two ends through Not I and Sal I restriction enzyme site directed cloning in carrier.PSPORT1 can be induced by 1mmol/L IPTG (isopropylthio-β-galactoside), the gene be cloned by galactoside promoter expression.Structure and the order-checking of carrying out nested deletion by Henikoff method are convenient in the design of multiple clone site, further feature and PUC serial carrier similar.For preserving library and reduction sieve storehouse workload for a long time, first each suction 1 μ l bacterium liquid from 5 every 4-5 of 384 orifice plate little mixing pits, admixed together by it, extracts plasmid after 37 DEG C of enlarged culturing.Every block 384 orifice plate extracts 80 plasmids, has 400 plasmids.First with Barley1-14940 primer with above-mentioned 400 mixing pit plasmid DNA for template carries out pcr amplification, screen a positive mixing plasmid; Then getting 1.5 μ l elementary mixing pit plasmid does electroporated, is coated with 10 LBA flat boards, and 37 DEG C of cultivations are after its growth 16h, and every dull and stereotyped Fen30Ge community scraping bacterium colony, access after 5 hours, carries out PCR screening containing cultivation in the 1.5ml centrifuge tube of 500 μ l LBA.With Barley1-14940 primer with these 300 communities for template carries out pcr amplification, the subclone pond of more than 70% can expand positive band.Wherein No. 83 positives bands in subclone pond are the denseest, get 5 μ l No. 83 bacterium liquid and dilute 200 times, every 1mlLBA inoculation of medium 10 μ l.Totally 100 pipe bacterium liquid, carry out PCR screening with Barley1-14940 primer.The bacterium liquid of 50% can amplify positive band, and wherein the band that expands of No. 60 bacterium liquid is the denseest.Get No. 60 bacterium liquid and dilute 10000 times, get 10 μ l diluents and be coated with dull and stereotyped.Get 15-20 mono-clonal with rifle choicest to cultivate in 500 μ l LBA, carry out PCR screening with Barley1-14940 primer.Filter out the mixed bacteria liquid containing target fragment, again dilute bed board and choose mono-clonal, cultivate the screening of laggard performing PCR in LBA, obtain 1 positive colony.
Sequencing result shows, this cDNA Cloning of full length 2491 bases, sequence is as shown in SEQ ID NO.1, wherein there are 404 bases in 5 ' UTR district, 3 '-UTR has 692 bases, open reading frame (ORF) long 1395bp (Fig. 5-8), 465 amino acid of encoding, aminoacid sequence is as shown in SEQ ID NO.2.By carrying out conserved structure analysis to this aminoacid sequence, find that it contains a serine threonine kinases active zone and a NAF structural domain.NAF structural domain has another name called FISL structural domain, is made up of 21 amino-acid residues, and wherein A, F and L residue is guarded at the CIPK cloned (CBL-Interacting serine-threonine proteinkinases) gene camber.CIPK be the distinctive response Ca2+ oscillations of a class plant, CBL (B-like calcium sensorproteins) particular target to serine-threonine kinase.Analyze through BLAST, the CIPK31 genetic homology in the protein sequence of this genes encoding and Chinese sorghum is up to 82%, is respectively 58%, 44% with the amino acid sequence homology coded by Arabidopis thaliana CIPK2, paddy rice CIPK1.The gene of Yin Ben experiment clone contains conservative NAF structural domain and has higher homology with the CIPK gene of other kind, therefore is HvCIPK1 by this unnamed gene.
The expression characteristic analysis of HvCIPK1 after the induction of embodiment 2 powdery mildew
The cDNA of sample of the non-induced of cluster hair wheat and induction different time be template, with primer pair P3(TTCGAGGATTGGCCTAATTG(SEQ ID NO.5)) and P4(GCACTGATGAGCTGATGGAA(SEQ ID NO.6)) carry out real time fluorescent quantitative qPCR analysis, using house-keeping gene Tubulin as internal reference.PCR reaction is above increased at real-time fluorescence quantitative PCR instrument (MyIQ, Bio-Rad, USA) and detects fluorescence.Containing 2 × SYBR Green PCR MasterMix 10 μ l in 20 μ l PCR reaction systems, 0.4nmol/ μ l primer P3 and P4, reverse transcription product 2 μ l.Amplification is: 95 DEG C of 10min, then 95 DEG C of 15s, 58 DEG C of 30s, 72 DEG C of 1min, totally 40 circulations.After reaction terminates, carry out the mensuration of melting curve.Gene expression detection horizontal quantitative MyiQ system software is analyzed.QPCR result shows: Hv-S/TPK gene is expressed by powdery mildew inducible up regulation in cluster hair wheat, and 12 hours periods reached maximum, declined subsequently and maintained lower level (Fig. 2).
The structure of the expression vector of embodiment 3HvCIPK1 gene and conversion common wheat Yangmai No.158 thereof
With P5(TCCCCCGGGATGGAGGAAAGGAGGACA(SEQ ID NO.7)) and P6(ACGCGAGCTCTTACTCCTGTGGCTGCTGT(SEQ ID NO.8)) to be built into conversion carrier pAHC-25(public for the HvCIPK1 gene fragment that increases out from cluster hair wheat cDNA, reference: Christensen A H, Quail P H, Ubiquitin promoter-based vectors for high-level expression of selectable and/orscreenable marker genes in monocotyledonous plants.Transgenic Research, 1996, 5:213-218.), with SmaI and SacI double digestion carrier pAHC-25 and target fragment HvCIPK1 gene respectively, the gus gene encoding sequence on pAHC25 carrier is replaced with HvCIPK1, connect transformation of E. coli and obtain recon, thus target gene is cloned into the downstream of strong promoter Ubi, obtain expression vector pAHC-HvCIPK1.Herbicide resistance gene (Bar gene) is as the selectable marker gene (accompanying drawing 3) of Plant Transformation.
By the Overexpression vector that builds by Bombardment-Mediated Transformation Yangmai No.158, select 1200 rataria callus and carry out biolistic bombardment, substratum (MS++2 is oozed at height before bombardment, 4-D2mg/L+ sucrose 30g/L+0.4mol/L N.F,USP MANNITOL, pH5.8) upper pre-treatment 4 hours, oozes on substratum at height after bombardment and continues cultivation 16 hours.Afterwards callus is transferred to recovery media (MS that 1/2MS(only has macroelement to reduce by half)+caseinhydrolysate 500mg/L+2,4-D2mg/L+ sucrose 30g/L, pH5.8) upper light culture 2 weeks, transfer them to (1/2MS+ZT 1mg/L+IAA 0.5mg/L+ caseinhydrolysate 500mg/L+2 in the screening culture medium containing weedicide again, 4-D1mg/L+ sucrose 30g/L+3mg/L Bialaphos, pH5.8), screening and culturing is broken up 2 weeks.Then the callus with resistance is transferred to (1/2MS+ caseinhydrolysate 200mg/L+ZT 1mg/L+ sucrose 30g/L+ agar 0.8% in division culture medium, pH5.8) break up, transfer them to when Bud Differentiation grows to 2-4cm in root media (1/2MS+IAA1mg/L+ sucrose 30g/L+ agar 0.8%, pH5.8).To regrowth be about 5-8cm, root system more healthy and stronger time, can open pipe hardening 1-2 days, finally wash away the substratum residue that root system carries and just can transplant engagement alms bowl, obtain regeneration plant totally 125 strains.
Extract all regeneration plant genomic dnas, promoter primer P7(CCCTGTTGTTTGGTGTTAC(SEQ ID NO.9 on carrier is utilized to transformed plant)) and gene HvCIPK1 internal primer P8(CTTCAATACGTTGGGATGT(SEQ ID NO.10)) carry out pcr amplification, to identify positive plant.PCR program: 10-50ng/ μ l genomic templates, each 0.5 μ l of 5 ' primer P7 and 3 ' primer P8 of 10 μMs; 2.5 μ l 10 × buffer; The dNTP of 2.5 μ l 2.5mM; The Mg of 1.5 μ l25mM
2+; 0.25 μ l (5U/ μ l) Taq polymerase(TaKaRa), add water to 25 μ l.PCR reaction conditions is: 94 DEG C of denaturation 3min; 94 DEG C of 45s, 58 DEG C of 45s, 72 DEG C of 1min, 35 circulations; 72 DEG C extend 10min.PCR primer through 8% polyacrylate hydrogel electrophoresis detection.Wherein 11 strains can be increased the object band of about 556bp, are initially identified as positive plant, and strain numbering is followed successively by: T
0-4, T
0-5, T
0-7, T
0-13, T
0-14, T
0-15, T
0-17, T
0-18, T
0-21, T
0-22, T
0-23(accompanying drawing 4).
The powder mildew resistance qualification of embodiment 4 transfer-gen plant
To T
0field resistance qualification has been carried out, to T for transfer-gen plant, transgene receptor kind Yangmai No.158
2in vitro and Adult plant powdery mildew disease-resistant qualification in seedling stage has been carried out for transfer-gen plant, transgene receptor kind Yangmai No.158.Resistance Identification standard adopts the grade scale of " 0-9 level " powder mildew resistance response type: 0-2 level is high resistance, 3-4 level is anti-in being, 5-6 level is middle sense, 7-9 is high sense.T
0result for strain-forming period resistance qualification shows: Yangmai No.158 shows as high sense, in positive transgenic plant, except T
0-18 and T
0-21 show as middle sense, anti-during all the other positive transgenic plant all show as.T
2for seedling stage, twice reproducible results of in vitro Resistance Identification shows: Yangmai No.158 shows as high sense; In positive transgenic plant, T
0-14, T
0-17, T
0-22 and T
0-23 all show as high resistance, T
0-4, T
0-5 and T
0-21 all show as in anti-.T
2show for Adult plant Powdery Mildew qualification result: Yangmai No.158 shows as high sense, in positive transgenic plant, T
0-14 show as high resistance, T
0-17, T
0-21, T
0-22 and T
0-23 all show as in anti-, T
0-4, T
0-5 and T
0-18 all show as middle sense.(table 2).
The powder mildew resistance qualification of table 2 transfer-gen plant
In table 2, T
0-4, T
0-5, T
0-7, T
0-13, T
0-14, T
0-17, T
0-18, T
0-21, T
0-22, T
0-23 is the positive transformants plant of identifying, "--" represents offspring and do not identify positive plant, and Yangmai No.158 is transgene receptor wheat breed.
Claims (2)
- Cluster hair wheat class calmodulin interact protein kinase gene shown in 1.SEQ ID NO.1 hvCIPK1cultivate the application in powdery-mildew-resistance wheat kind.
- 2. containing the cluster hair wheat class calmodulin interact protein kinase gene shown in SEQ ID NO.1 hvCIPK1expression vector cultivating the application in powdery-mildew-resistance wheat kind.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210512583.7A CN102994528B (en) | 2012-12-04 | 2012-12-04 | Haynaldia villosa calmodulin interacting protein kinase gene and expression vector and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210512583.7A CN102994528B (en) | 2012-12-04 | 2012-12-04 | Haynaldia villosa calmodulin interacting protein kinase gene and expression vector and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102994528A CN102994528A (en) | 2013-03-27 |
| CN102994528B true CN102994528B (en) | 2015-06-03 |
Family
ID=47923637
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210512583.7A Active CN102994528B (en) | 2012-12-04 | 2012-12-04 | Haynaldia villosa calmodulin interacting protein kinase gene and expression vector and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102994528B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105821055B (en) * | 2015-01-04 | 2019-08-13 | 王秀娥 | One haynaldia villosa Pleurotus Ostreatus receptor kinase gene and its expression vector and application |
| CN114317566B (en) * | 2022-01-13 | 2023-04-11 | 福建农林大学 | Application of powdery mildew resistance related gene MPK15 |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1813060A (en) * | 2003-04-15 | 2006-08-02 | 巴斯福植物科学有限公司 | Plant cells and plants with increased tolerance to environmental stress |
| CN102399799A (en) * | 2010-12-23 | 2012-04-04 | 浙江师范大学 | Tibetan plateau wild barley HsCIPK 26 gene |
-
2012
- 2012-12-04 CN CN201210512583.7A patent/CN102994528B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1813060A (en) * | 2003-04-15 | 2006-08-02 | 巴斯福植物科学有限公司 | Plant cells and plants with increased tolerance to environmental stress |
| CN102399799A (en) * | 2010-12-23 | 2012-04-04 | 浙江师范大学 | Tibetan plateau wild barley HsCIPK 26 gene |
Non-Patent Citations (3)
| Title |
|---|
| Hordeum vulgare subsp. vulgare mRNA for predicted protein, complete NIASHv2081P15;Matsumoto,T.et al.;《GenBank》;20110520;ORIGIN * |
| PREDICTED: CBL-interacting protein kinase 26-like;NCBI;《GenBank》;20111115;ORIGIN * |
| Serine/threonine kinase gene Stpk-V, a key member of powdery mildew resistance gene Pm21, confers powdery mildew resistance in wheat;Aizhong Cao et al.;《PNAS》;20110510;摘要，第7731左栏第2段-7732左栏第2段，第7728页左栏第2段-第7730页右栏第1顿以及图1-4 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102994528A (en) | 2013-03-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9663794B2 (en) | Heat-resistance rice gene OsZFP, screening marker and separation method thereof | |
| CN107164347A (en) | Control Culm of Rice rugosity, tiller number, grain number per spike, mass of 1000 kernel and the ideotype gene NPT1 of yield and its application | |
| CN110904071B (en) | Application of RAF49 protein and encoding gene thereof in regulation and control of plant drought resistance | |
| CN107177599B (en) | Encoding gene for enhancing tolerance of plant to cadmium poison and reducing cadmium content of plant and application | |
| CN102766618B (en) | Rice OsICL protein and coding gene thereof, and application of the two | |
| CN103865937A (en) | Cytoplasmic male sterility restorer gene in rice and application thereof | |
| CN110205332B (en) | Encoding gene for enhancing tolerance of plant to cadmium poison and reducing cadmium content of plant and application | |
| CN113234729B (en) | Gene GauRev2 capable of obviously improving verticillium wilt resistance of cotton and application thereof | |
| CN102994528B (en) | Haynaldia villosa calmodulin interacting protein kinase gene and expression vector and application thereof | |
| CN103183731B (en) | Dendrobe DnMYB type transcription factor, coding gene, carrier and engineering bacteria and application thereof | |
| Marlin et al. | Molecular diversity of the flowering related gene (LEAFY) on shallot (Allium cepa var. aggregatum) and Allium relatives. | |
| CN111087457A (en) | Protein NGR5 for improving nitrogen utilization rate and crop yield, and coding gene and application thereof | |
| CN104774854B (en) | One haynaldia villosa MAPK gene and its expression vector and application | |
| CN107326030A (en) | A kind of WRKY transcription factors of low potassium tolerance of regulation and control and its application | |
| CN109535236B (en) | Heme binding protein gene TaHBP1, recombinant interference vector and application thereof | |
| CN102154311B (en) | Gene GE1 for controlling size of paddy embryo and use thereof | |
| CN106434694B (en) | Application of cotton GbDREB gene in verticillium wilt resistance | |
| CN101831428B (en) | Separation clone and expression mode identification of promotor region of rice endosperm special expression gene | |
| US20210079414A1 (en) | Use of protein nog1 in regulation of plant yield and grain number per ear | |
| CN112501147B (en) | Common wild rice grain related coding gene and application thereof | |
| CN115109783B (en) | Peanut NBS-LRR coding gene AhRRS2 and application thereof in plant bacterial wilt resistance | |
| CN112458105B (en) | Common wild rice grain related coding gene and application thereof | |
| CN104630236A (en) | Application of haynaldia villosa ethylene-responsive element binding protein gene | |
| CN112080481B (en) | Spike-type related gene OsFRS5 and application and phenotype recovery method thereof | |
| CN117025625A (en) | Application of rice gene OsCS1 in cultivation of low-Cd rice variety |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |