CN107880099A

CN107880099A - Rice paddy seed dormant trait controlling gene OsMPK7 and its application

Info

Publication number: CN107880099A
Application number: CN201711153430.7A
Authority: CN
Inventors: 毛兴学; 刘斌; 王丰; 张建军; 柳武革
Original assignee: Rice Research Institute of Guangdong Academy of Agricultural Sciences
Current assignee: Rice Research Institute of Guangdong Academy of Agricultural Sciences
Priority date: 2017-11-20
Filing date: 2017-11-20
Publication date: 2018-04-06
Anticipated expiration: 2037-11-20
Also published as: CN107880099B

Abstract

The invention discloses a kind of rice paddy seed dormant trait controlling gene OsMPK7 and its application, belong to biotechnology and crop gene field of engineering technology.Rice paddy seed dormant trait controlling gene OsMPK7 disclosed in this invention plays an important role in rice paddy seed dormant trait is improved, and its sequence is as shown in SEQ ID NO.2, protein of the encoding amino acid sequence as shown in SEQ ID NO.1.The application is particular by CRISPR/Cas9 systems editor, interference or knocks out OsMPK7 genes, destroys the biological function of OsMPK7 genes, obtains anti growing out rice strain.The OsMPK7 genes of current material can be knocked out by gene OsMPK7 edit methods provided by the invention, screening knocks out offspring, can obtain the rice strain of dormant trait enhancing, can effectively improve its ear germinating resistance.

Description

Rice paddy seed dormant trait controlling gene OsMPK7 and its application

Technical field

The present invention relates to biotechnology and crop gene field of engineering technology, and in particular to a kind of rice paddy seed dormant trait is adjusted Control gene OsMPK7 and its application.

Background technology

The weak material ear germinating resistance of Grain Dormancy is weak, is unfavorable for agricultural production.Flowed in China rice main producing region the Changjiang river Domain and the band of south China one, the harvest season of Indica rice just catch up with the plum rain season of locality, and high temperature, the environmental condition of high humidity are more easy to lead Cause Spike sprouting.According to statistics, loss late up to more than 5%, has a strong impact on early rice rice to China's rice caused by Spike sprouting every year The yield and quality of paddy.During the production of hybrid seeds of south China hybrid paddy rice, gibberellin is widely used, weakens Grain Dormancy, is added The hot and humid condition of upper harvest season, Spike sprouting phenomenon are serious.Once there is Spike sprouting, seed storage thing largely consumes, directly Connecing causes the underproduction；Even cause processing quality, nutritional quality, edible quality and seed vitality to decline, lose commercial value.Rice It is important cereal crops, is China the first generalized grain crop.Different year Spike sprouting causes different degrees of to Rice Production Harm.Therefore, rice ear germinating resistance problem is researched and solved to promoting Rice Production, ensuring that the grain security in China has great meaning Justice.

The ear germinating resistance of rice and Grain Dormancy are closely related.By Screening germplasm and genetic analysis is carried out at present, A large amount of dormant trait quantitative trait locus (QTL) have been located, but only a few is cloned, therefore can apply to actual life The gene of production is considerably less.The other economical characters of influence that the dormant trait related gene cloned has, such as qSD1-2；Some functions Property mark it is indefinite, such as sdr4；Cause production application inconvenient.Applicant has found to knock out in Study On Rice Spike sprouting character OsMPK7 genes can improve rice paddy seed dormant trait, to solve the problems, such as that rice Spike sprouting provides an important research direction.

The content of the invention

For overcome the deficiencies in the prior art, it is an object of the invention to provide a kind of rice paddy seed dormant trait controlling gene OsMPK7 and its application.

To solve the above problems, the technical solution adopted in the present invention is as follows：

Rice paddy seed dormant trait modulin involved in the present invention, from rice, its amino acid sequence such as SEQ ID Shown in NO.1.

The rice paddy seed dormant trait controlling gene OsMPK7 of the present invention, ammonia shown in the SEQ ID NO.1 in polynucleotide Base acid sequence.

Controlling gene OsMPK7 of the present invention can be gene OsMPK7 cDNA sequence or gene OsMPK7 genomic dna sequence.Such as the cDNA sequence in sequence table as shown in SEQ ID NO.2.

Another object of the present invention is to provide above-mentioned rice paddy seed dormant trait modulin and its encoding gene and is improving rice Application in Grain Dormancy.The application is particular by CRISPR/Cas9 systems editor, interference or knocks out OsMPK7 genes, The biological function of OsMPK7 genes is reduced or destroyed, obtains anti growing out strain.

As the preferred embodiment of the present invention, the application specifically comprises the following steps：

1) vector construction is edited：With reference to CRISPR/Cas9 editing techniques, target sequence, structure editor's carrier are selected；

2) it is transferred to using agrobcterium-mediated transformation by carrier is edited in easy Spike sprouting rice varieties；

3) with reference to acceptor kind OsMPK7 gene orders, OsMPK7 gene knockout mutant strains are screened；The mutant strain is bred to obtain Obtain the strain that ear germinating resistance is improved.

Compared with prior art, the beneficial effects of the present invention are：

1st, the characteristics of present invention participates in rice paddy seed dormancy control using the albumen of OsMPK7 genes and its coding and The genome targeting modification of CRISPR/Cas9 systems, by being mutated gene nucleotide series screening rice there is Spike sprouting to resist The strain of property, has highly important application in agricultural production.

2nd, the present invention for create the rice varieties with ear germinating resistance based on rice Os MPK7 genes, germ plasm resource, Hybrid rice parentses provide a kind of efficient breeding mode.

Brief description of the drawings

Before Rice Offspring seed breaking dormancies of the Fig. 1 for the knockout OsMPK7 genes obtained by method of the present invention Germination percentage；

After Rice Offspring seed breaking dormancies of the Fig. 2 for the knockout OsMPK7 genes obtained by method of the present invention Germination percentage.

Embodiment

The present invention is described in further detail with reference to the accompanying drawings and detailed description.

The present invention is by building the editor support C risp-OsMPK7 of OsMPK7 genes, then passes through agriculture bacillus mediated heredity Method for transformation will edit support C risp-OsMPK7 and import easy fringe bud rice material PHS, from offspring screening obtain OsMPK7 and strike The strain removed, successive propagation obtain strain homozygosis offspring, and its seed is investigated finally by the germination percentage of the new harvest seed of measure Dormant trait.Specifically comprise the following steps：

First, structure editor's support C risp-OsMPK7：With reference to CRISPR/Cas9 editing techniques, according in control material OsMPK7 genes base sequence selectes target sequence " GGGTCCTCAGTGCATCCACACGG ", according to target sequence synthetic primer Cris6aF and Cris6aR；

1) amplification synthesis expression cassette fragment：

A, using pYLsgRNA-OsU6a DNAs template, respectively using Cris6aF+U-F and Cris6aR+gR-R as drawing Thing, enter performing PCR amplification, the polymerase used in PCR is KOD FX (Toyobo companies).Reaction system is 50uL, according to KOD FX Specification prepare PCR reaction systems.Reaction condition is：94℃、3min；94℃、30sec；60℃、30sec；68℃、 20sec, 25 circulations.

B, take step to obtain two parts of each 1uL of PCR primer, add water 8uL, mix；1uL is taken as template, with Pps-GGL+ Pps-GGL is that primer is expanded, and reaction system, reaction condition is same as above.

C, amplified production is reclaimed using agarose gel electrophoresis, obtains expression cassette fragment sgRNA-MPK7.

2) editor's support C risp-OsMPK7 is obtained：

A, prepare coupled reaction mixed liquor according to following table (restriction endonuclease Bsa I-HF and ligase T4 are purchased from NEB companies)

The circulation of digestion connection 15 is carried out with temperature varied cyclical:37℃、5min；10 DEG C, 5min, 20 DEG C, 5min；Last 37 DEG C, 5min。

B, 1uL connection products are taken, are transformed into electric shocking method in bacillus coli DH 5 alpha, converted product coating kalamycin resistance LB solid mediums, 37 DEG C of overnight incubations, choose 10 monoclonals and carry out extraction plasmid, with SpeI and MluI digestions identify；Choosing Select three positive colonies and carry out sequencing detection, using SP2 as sequencing primer, sequence verification its expression cassette sgRNA-MPK7 sequences are just Really, the clone edits support C risp-OsMPK7.

Used primer sequence is as follows in above step：

Cris6aF：TGTGGATGCACTGAGGACCCGGCAGCCAAGCCAGCA

Cris6aR：GGTCCTCAGTGCATCCACAGTTTTAGAGCTAGAAAT

U-F：CTCCGTTTTACCTGTGGAATCG

gR-R：CGGAGGAAAATTCCATCCAC

Pps-GGL：TTCAGAGGTCTCTCTCGACTAGTATGGAATCGGCAGCAAAGG

Pgs-GGR：AGCGTGGGTCTCGACCGACGCGTATCCATCCACTCCAAGCTC

SP2：GCGCGGTGTCATCTATGTTACT

2nd, transgenosis obtains Variants：

Support C risp-OsMPK7 will be edited using the genetic transforming method of Agrobacterium EHA105 mediations and import easy fringe bud material Expect PHS.T₀In generation, DNA is extracted, expanded with primer HygBioF and HygBioR, Ago-Gel detection amplified production, amplified band It is clearly positive transformants plant；Again using positive strain DNA as template, expanded and be sequenced using primer DecF and DecR, with acceptor material Expect that DNA sequence dna for control, compares sequencing result, selects OsMPK7 gene mutation strains.

HygBioF：ACGGTGTCGTCCATCACAGTTTGCC

HygBioR：TTCCGGAAGTGCTTGACATTGGGGA

DecF：GGGTGCCCTTAGGTGTTTCAG

DecR：CATGGTGGAACCGCTGCTT

3rd, Variants DNA analysis：

Successive propagation OsMPK7 gene mutation strains, selfing obtain T₁For strain.Extract DNA, with primer HygBioF and HygBioR is expanded, and Ago-Gel detection amplified production, amplified band is clearly offspring containing hpt marker gene；Screening There is no the individual plant of Hygromycin marker, then using the DNA without Hygromycin marker strain as template, expanded using primer DecF and DecR OsMPK7 genetic fragments, sequencing screening OsMPK7 knockout mutant strains.This experiment obtains single base insertion offspring's (underscore base To insert base), cause coded amino acid that frameshift mutation occurs, OsMPK7 genes are knocked.

Compare PHS：

188CAACAATGTCTTTGACAACCGTGTGGATGCACTGAGGACCCTAAGGGAGC

Knock out offspring：

188CAACAATGTCTTTGACAACCGTGTGGGATGCACTGAGGACCCTAAGGGAGC

4th, Grain Dormancy is analyzed：

1) continue to breed OsMPK7 knockout individual plants, OsMPK7 genetic fragments are expanded with primer DecF and DecR, according to sequencing As a result screening knocks out heterozygote and homozygote.

2) OsMPK7 is harvested respectively knocks out heterozygote seed, OsMPK7 knockout homozygotes and control PHS seeds.Per ware 50 Grain, is placed in 9CM and is covered with the culture dish of filter paper, adds 15 milliliters of water, soaks 36 hours；Abandon water juxtaposition culture dish to be incubated in 30 DEG C, 3 Germination percentage is counted after it, substantially expose husk using radicle or plumule repeats as germination standard, 3 biology.With acceptor material PHS is control, compares the germination percentage of different materials.

As shown in figure 1, relative to control PHS, OsMPK7 knocks out offspring's germination percentage and declines a lot, OsMPK7 before breaking dormancy The percentage of seedgermination for knocking out homozygous offspring is zero.As shown in Fig. 2 after breaking dormancy, OsMPK7 knocks out offspring's germination percentage with compareing It is close.As can be seen here, the Grain Dormancy of the homozygous offspring of OsMPK7 knockouts greatly improves, and can be improved by knocking out OsMPK7 genes The anti growing out ability of acceptor material.

Above-mentioned embodiment is only the preferred embodiment of the present invention, it is impossible to the scope of protection of the invention is limited with this, The change and replacement for any unsubstantiality that those skilled in the art is done on the basis of the present invention belong to institute of the present invention Claimed scope.

Sequence table

<110>Rice research institute of Guangdong Academy of Agricultural Sciences

<120>Rice paddy seed dormant trait controlling gene OsMPK7 and its application

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 369

<212> PRT

<213>Rice (Oryza sativa)

<400> 1

Met Ala Met Met Val Asp Pro Pro Asn Gly Met Gly Asn Gln Gly Lys

1 5 10 15

His Tyr Tyr Thr Met Trp Gln Thr Leu Phe Glu Ile Asp Thr Lys Tyr

20 25 30

Val Pro Ile Lys Pro Ile Gly Arg Gly Ala Tyr Gly Ile Val Cys Ser

35 40 45

Ser Ile Asn Arg Ala Thr Asn Glu Lys Val Ala Ile Lys Lys Ile Asn

50 55 60

Asn Val Phe Asp Asn Arg Val Asp Ala Leu Arg Thr Leu Arg Glu Leu

65 70 75 80

Lys Leu Leu Arg His Leu Arg His Glu Asn Val Ile Ala Leu Lys Asp

85 90 95

Ile Met Met Pro Val His Arg Arg Ser Phe Lys Asp Val Tyr Leu Val

100 105 110

Tyr Glu Leu Met Asp Thr Asp Leu His Gln Ile Ile Lys Ser Ser Gln

115 120 125

Pro Leu Ser Asn Asp His Cys Gln Tyr Phe Leu Phe Gln Leu Leu Arg

130 135 140

Gly Leu Lys Tyr Leu His Ser Ala Gly Ile Leu His Arg Asp Leu Lys

145 150 155 160

Pro Gly Asn Leu Leu Val Asn Ala Asn Cys Asp Leu Lys Ile Cys Asp

165 170 175

Phe Gly Leu Ala Arg Thr Asn Asn Thr Lys Gly Gln Phe Met Thr Glu

180 185 190

Tyr Val Val Thr Arg Trp Tyr Arg Ala Pro Glu Leu Leu Leu Cys Cys

195 200 205

Asp Asn Tyr Gly Thr Ser Ile Asp Val Trp Ser Val Gly Cys Ile Phe

210 215 220

Ala Glu Leu Leu Gly Arg Lys Pro Ile Phe Pro Gly Thr Glu Cys Leu

225 230 235 240

Asn Gln Leu Lys Leu Ile Val Asn Val Leu Gly Thr Met Ser Glu Ala

245 250 255

Asp Ile Glu Phe Ile Asp Asn Pro Lys Ala Arg Lys Tyr Ile Lys Thr

260 265 270

Leu Pro Tyr Thr Pro Gly Ile Pro Leu Thr Ser Met Tyr Pro Gln Ala

275 280 285

His Pro Leu Ala Ile Asp Leu Leu Gln Lys Met Leu Val Phe Asp Pro

290 295 300

Ser Lys Arg Ile Ser Val Thr Glu Ala Leu Glu His Pro Tyr Met Ser

305 310 315 320

Pro Leu Tyr Asp Pro Ser Ala Asn Pro Pro Ala Gln Val Pro Ile Asp

325 330 335

Leu Asp Ile Asp Glu Asn Leu Gly Val Asp Met Ile Arg Glu Met Met

340 345 350

Trp Gln Glu Met Leu His Tyr His Pro Glu Val Val Ala Gly Val Asn

355 360 365

Met

<210> 2

<211> 1110

<212> DNA

<213>Rice (Oryza sativa)

<400> 2

atggcgatga tggtggaccc tcctaatggc atgggaaacc aagggaagca ttactacaca 60

atgtggcaaa cgctatttga gattgacacc aagtatgtgc caatcaagcc catcggaaga 120

ggggcttatg gaatagtttg ctcctctata aaccgtgcaa ccaacgaaaa agttgcaata 180

aagaagatca acaatgtctt tgacaaccgt gtggatgcac tgaggaccct aagggagctg 240

aaactactgc gacacttgcg ccatgaaaat gttattgcct tgaaagatat aatgatgcca 300

gtacacagaa ggagtttcaa agatgtatac ttggtttatg aactcatgga cacagatcta 360

caccagataa ttaaatcatc tcaacctctt tctaatgacc actgtcaata tttccttttt 420

cagctactcc gaggtctgaa gtacctccat tcagcaggga tactccatcg agacctgaaa 480

ccagggaacc tcctggttaa tgcaaactgc gatctgaaga tctgcgactt tggtttggct 540

cgcacaaaca acactaaagg ccagtttatg actgaatatg tcgtgacccg gtggtatagg 600

gctcctgagc tgctgctctg ctgcgacaat tacggaacct ccatagatgt ctggtctgtt 660

ggctgcatct ttgctgagct tcttggccgc aagccaatat ttccaggaac tgagtgcctc 720

aatcagctca agctcatagt caacgttctc ggcaccatga gtgaagctga cattgagttc 780

attgacaacc caaaggcccg caagtatatc aagacccttc catacactcc tggcatcccc 840

ctcaccagta tgtacccgca agcacatcct cttgccattg atctgttgca gaagatgctc 900

gtctttgatc cctccaaaag gattagtgtc actgaagctc tggagcaccc ttacatgtct 960

ccactgtatg atccaagcgc aaaccctcct gctcaagtgc ccatcgatct cgacatcgat 1020

gaaaatcttg gcgtggatat gatccgggag atgatgtggc aggagatgct ccactatcac 1080

ccagaggttg ttgcaggagt gaatatgtga 1110

Claims

1. a kind of rice paddy seed dormant trait modulin, its amino acid sequence is as shown in SEQ ID NO.1.

2. a kind of rice paddy seed dormant trait controlling gene OsMPK7, amino acid sequence shown in the SEQ ID NO.1 in polynucleotide Row.

3. rice paddy seed dormant trait controlling gene OsMPK7 according to claim 2, it is characterised in that：The controlling gene OsMPK7 is gene OsMPK7 cDNA sequence or genomic dna sequence.

4. rice paddy seed dormant trait controlling gene OsMPK7 according to claim 3, it is characterised in that：The controlling gene OsMPK7 nucleotide sequence is as shown in SEQ ID NO.2.

5. rice paddy seed dormant trait modulin as claimed in claim 1 and its encoding gene are improving rice paddy seed dormant trait In application.

6. application according to claim 5, it is characterised in that：The application is by CRISPR/Cas9 systems editor, interference Or OsMPK7 genes are knocked out, the biological function of OsMPK7 genes is reduced or destroyed, obtains anti growing out strain.

7. application according to claim 6, it is characterised in that：Build editor's carrier of the Grain Dormancy controlling gene And rice transformation, offspring is screened, obtains the rice strain that Grain Dormancy is improved.

8. application according to claim 7, it is characterised in that：Specifically comprise the following steps：

3) with reference to acceptor kind OsMPK7 gene orders, OsMPK7 gene mutation strains are screened；Breed the mutant strain and obtain Spike sprouting The strain that resistance is improved.