CN108047319A - Rice paddy seed dormant trait controlling gene OsMPK14 and its application - Google Patents

Abstract

The invention discloses a kind of rice paddy seed dormant trait controlling gene OsMPK14 and its applications, belong to biotechnology and crop gene field of engineering technology.Rice paddy seed dormant trait controlling gene OsMPK14 disclosed in this invention plays an important role in rice paddy seed dormant trait is improved, and sequence is as shown in SEQ ID NO.2, protein of the encoding amino acid sequence as shown in SEQ ID NO.1.The application is particular by CRISPR/Cas9 systems editor, interference or knocks out OsMPK14 genes, destroys the biological function of OsMPK14 genes, obtains anti growing out rice strain.The OsMPK14 genes of current material can be knocked out by gene OsMPK14 knockout techniques provided by the invention, screening knocks out offspring, can obtain the rice strain of dormant trait enhancing, can effectively improve its ear germinating resistance.

Description

Rice paddy seed dormant trait controlling gene OsMPK14 and its application

Technical field

The present invention relates to biotechnologys and crop gene field of engineering technology, and in particular to a kind of rice paddy seed dormant trait tune Control gene OsMPK14 and its application.

Background technology

The weak material ear germinating resistance of Grain Dormancy is weak, is unfavorable for agricultural production.It is flowed in China rice main producing region the Changjiang river One band of domain and south China, the harvest season of Indica rice just catch up with local plum rain season, and high temperature, the environmental condition of high humidity are more easy to lead Cause Spike sprouting.According to statistics, loss late up to more than 5%, seriously affects early rice rice to China's rice caused by Spike sprouting every year The yield and quality of paddy.During the production of hybrid seeds of south China hybrid paddy rice, gibberellin is widely used, weakens Grain Dormancy, is added The hot and humid condition of upper harvest season, Spike sprouting phenomenon are serious.Once there is Spike sprouting, seed storage object largely consumes, directly Connecing causes the underproduction；Processing quality, nutritional quality, edible quality and seed vitality is even caused to decline, loses commercial value.Rice It is important cereal crops, is China the first generalized grain crop.Different year Spike sprouting causes Rice Production different degrees of Harm.Therefore, rice ear germinating resistance problem is researched and solved to promoting Rice Production, ensuring that the grain security in China has great meaning Justice.

The ear germinating resistance of rice and Grain Dormancy are closely related.By Screening germplasm and genetic analysis is carried out at present, A large amount of dormant trait quantitative trait locus (QTL) have been located, but only a few is cloned, therefore can apply to actual life The gene of production is considerably less.The other economical characters of influence that the dormant trait related gene cloned has, such as qSD1-2；Some functions Property mark it is indefinite, such as sdr4；Cause production application inconvenient.In Study On Rice Spike sprouting character, it is found by the applicant that knocking out OsMPK14 genes can improve rice paddy seed dormant trait, to solve the problems, such as that rice Spike sprouting provides an important research direction.

The content of the invention

For overcome the deficiencies in the prior art, it is an object of the invention to provide a kind of rice paddy seed dormant trait controlling genes OsMPK14 and its application.

To solve the above problems, the technical solution adopted in the present invention is as follows：

Rice paddy seed dormant trait modulin according to the present invention, from rice, amino acid sequence such as SEQ ID Shown in NO.1.

The rice paddy seed dormant trait controlling gene OsMPK14 of the present invention, ammonia shown in the SEQ IDNO.1 in polynucleotide Base acid sequence.

Controlling gene OsMPK14 of the present invention can be the cDNA sequence or gene of gene OsMPK14 The genomic dna sequence of OsMPK14.Such as the cDNA sequence in sequence table as shown in SEQ ID NO.2.

Another object of the present invention is to provide above-mentioned rice paddy seed dormant trait modulin and its encoding gene and is improving rice Application in Grain Dormancy.The application is particular by CRISPR/Cas9 systems editor, interference or knocks out OsMPK14 genes, The biological function of OsMPK14 genes is reduced or destroyed, obtains the high improvement strain of Grain Dormancy.

As the preferred embodiment of the present invention, the application specifically comprises the following steps：

1) vector construction is edited：With reference to CRISPR/Cas9 editing techniques, target sequence, structure editor's carrier are selected；

2) it is transferred to using agrobcterium-mediated transformation by carrier is edited in the low rice varieties of Grain Dormancy；

3) with reference to receptor kind OsMPK14 gene orders, OsMPK14 gene knockout mutant strains are screened；Breed the mutant strain Obtain the high improvement strain of Grain Dormancy.

Compared with prior art, the beneficial effects of the present invention are：

1st, the characteristics of present invention participates in rice paddy seed dormancy control using the albumen of OsMPK14 genes and its coding and The genome targeting modification of CRISPR/Cas9 systems has ear germinating resistance by being mutated gene nucleotide series screening Rice strain has highly important application in agricultural production.

2nd, the present invention for create the rice varieties with ear germinating resistance based on rice Os MPK14 genes, germ plasm resource, Hybrid rice parents provide a kind of efficient breeding mode.

Description of the drawings

Fig. 1 is the Rice Offspring seed breaking dormancy of the knockout OsMPK14 genes obtained by method of the present invention Preceding germination percentage；

Fig. 2 is the Rice Offspring seed breaking dormancy of the knockout OsMPK14 genes obtained by method of the present invention Germination percentage afterwards.

Specific embodiment

The present invention is described in further detail with reference to the accompanying drawings and detailed description.

The present invention is by building the editor support C risp-OsMPK14 of OsMPK14 genes, then passes through agriculture bacillus mediated something lost It passes method for transformation and will edit support C risp-OsMPK14 and import that Grain Dormancy is low, rice material WD of Yi Suiya；From offspring Screening obtains OsMPK14 and knocks out variant, and successive propagation obtains strain homozygosis offspring, finally by the new harvest seed of measure Germination percentage investigates its Grain Dormancy.Specifically comprise the following steps：

First, structure editor's support C risp-OsMPK14：With reference to CRISPR/Cas9 editing techniques, according in control material OsMPK14 gene base sequences select target sequence " CCCATAAGCTCCTCGCCCGATGG ", according to target sequence synthetic primer Cris6aF and Cris6aR；

1) amplification synthesis expression cassette segment：

A, using pYLsgRNA-OsU6a Plasmid DNA as template, respectively using Cris6aF+U-F and Cris6aR+gR-R as drawing Object carries out PCR amplification, and the polymerase used in PCR is KOD FX (Toyobo companies).Reaction system is 50uL, according to KOD FX Specification prepare PCR reaction systems.Reaction condition is：94℃、3min；94℃、30sec；60℃、30sec；68℃、 20sec, 25 Xun Huans.

B, two parts of each 1uL of PCR product of step are taken, add water 8uL, mixing；1uL is taken as template, with Pps-GGL+Pps-GGL It is expanded for primer, reaction system, reaction condition is same as above.

C, amplified production is recycled using agarose gel electrophoresis, obtains expression cassette segment sgRNA-MPK14.

2) editor's support C risp-OsMPK14 is obtained：

A, prepare coupled reaction mixed liquor according to following table (restriction endonuclease Bsa I-HF and ligase T4 are purchased from NEB companies)

15 Xun Huan of digestion connection is carried out with temperature varied cyclical:37℃、5min；10 DEG C, 5min, 20 DEG C, 5min；Last 37 DEG C, 5min。

B, 1uL connection products are taken, are transformed into electric shocking method in bacillus coli DH 5 alpha, converted product coating kalamycin resistance LB solid mediums, 37 DEG C of overnight incubations choose 10 monoclonals and extract plasmid, are identified with SpeI and MluI digestions；Choosing It selects three positive colonies and carries out sequencing detection, using SP2 as sequencing primer, sequence verification its expression cassette sgRNA-MPK14 sequences Correctly, which edits support C risp-OsMPK14.

Used primer sequence is as follows in above step：

Cris6aF：TCGGGCGAGGAGCTTATGGGCGGCAGCCAAGCCAGCA

Cris6aR：CCCATAAGCTCCTCGCCCGAGTTTTAGAGCTAGAAAT

U-F：CTCCGTTTTACCTGTGGAATCG

gR-R：CGGAGGAAAATTCCATCCAC

Pps-GGL：TTCAGAGGTCTCTCTCGACTAGTATGGAATCGGCAGCAAAGG

Pgs-GGR：AGCGTGGGTCTCGACCGACGCGTATCCATCCACTCCAAGCTC

SP2：GCGCGGTGTCATCTATGTTACT

2nd, transgenosis obtains Variants：

Support C risp-OsMPK14 will be edited using the genetic transforming method of Agrobacterium EHA105 mediations and import seed dormancy The weak material WD of property.T₀In generation, extracts DNA, is expanded with primer HygBioF and HygBioR, Ago-Gel detection amplified production, Amplified band is clearly positive transformants plant；Again using positive strain DNA as template, expanded and be sequenced using primer DecF and DecR； Using the extension increasing sequence of receptor WD as control, compare sequencing result, select OsMPK14 gene mutation strains.

HygBioF：ACGGTGTCGTCCATCACAGTTTGCC

HygBioR：TTCCGGAAGTGCTTGACATTGGGGA

DecF：AACTGTTGGAATCTGGGTTGGA

DecR：TGGGATGGGTAACCAAGGGA

3rd, Variants DNA analysis：

Successive propagation OsMPK14 gene mutation strains, selfing obtain T₁For strain.Extract DNA, with primer HygBioF and HygBioR is expanded, and Ago-Gel detection amplified production, amplified band is clearly offspring containing hpt marker gene；Screening There is no the single plant of Hygromycin marker, then using the DNA of no Hygromycin marker strain as template, expanded using primer DecF and DecR OsMPK14 genetic fragments, sequencing screening OsMPK14 gene knockout mutant strains.This experiment obtains single base (lower stroke of offspring of insertion Line base is insertion base), cause coded amino acid that frameshift mutation occurs, OsMPK14 genes are knocked.

Compare WD：

101CAATCAAGCCCATCGGGCGAGGAGCTTATGGGATTGTTTGTTCATCCATA

Knock out offspring：

101CAATCAAGCCCATCGGGGCGAGGAGCTTATGGGATTGTTTGTTCATCCATA

4th, Grain Dormancy is analyzed：

1) continue to breed OsMPK14 knockout single plants, OsMPK14 genetic fragments are expanded with primer DecF and DecR, according to survey The screening of sequence result knocks out heterozygote and homozygote.

2) OsMPK14 is harvested respectively knocks out heterozygote seed, OsMPK14 knockout homozygous seeds and control WD seeds. It per 50, ware, is placed in 9CM and is covered in the culture dish of filter paper, add 15 milliliters of water, when immersion 36 is small；Water juxtaposition culture dish is abandoned in 30 DEG C Heat preservation, germination percentage is counted after 3 days, substantially exposes husk as germination standard using radicle or plumule, 3 biology repeat.With by Body material WD is control, compares the germination percentage of different materials.

As shown in Figure 1, compared with control WD, before breaking dormancy OsMPK14 knock out offspring's germination percentage decline it is very much, The percentage of seedgermination that OsMPK14 knocks out homozygous offspring is zero.As shown in Fig. 2, after breaking dormancy, OsMPK14 knocks out progeny seed Germination percentage is close with compareing.It can be seen that the Grain Dormancy that OsMPK14 knocks out homozygous offspring greatly improves.Pass through knockout OsMPK14 genes can improve the anti growing out ability of acceptor material.

The above embodiment is only the preferred embodiment of the present invention, it is impossible to the scope of protection of the invention is limited with this, The variation and replacement for any unsubstantiality that those skilled in the art is done on the basis of the present invention belong to institute of the present invention Claimed scope.

Sequence table

<110>Rice research institute of Guangdong Academy of Agricultural Sciences

<120>Rice paddy seed dormant trait controlling gene OsMPK14 and its application

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 370

<212> PRT

<213>Rice (Oryza sativa)

<400> 1

Met Ala Ile Met Val Asp Pro Pro Asn Gly Met Gly Asn Gln Gly Lys

1 5 10 15

Tyr Tyr Tyr Ser Met Trp Gln Thr Leu Phe Glu Ile Asp Thr Lys Tyr

20 25 30

Val Pro Ile Lys Pro Ile Gly Arg Gly Ala Tyr Gly Ile Val Cys Ser

35 40 45

Ser Ile Asn Arg Glu Thr Asn Glu Lys Val Ala Ile Lys Lys Ile His

50 55 60

Asn Val Phe Asp Asn Arg Val Asp Ala Leu Arg Thr Leu Arg Glu Leu

65 70 75 80

Lys Leu Leu Arg His Leu Arg His Glu Asn Val Ile Ala Leu Lys Asp

85 90 95

Ile Met Met Pro Val His Arg Arg Ser Phe Lys Asp Val Tyr Leu Val

100 105 110

Tyr Glu Leu Met Asp Thr Asp Leu His Gln Ile Ile Lys Ser Pro Gln

115 120 125

Gly Leu Ser Asn Asp His Cys Gln Tyr Phe Leu Phe Gln Leu Leu Arg

130 135 140

Gly Leu Lys Tyr Leu His Ser Ala Glu Ile Leu His Arg Asp Leu Lys

145 150 155 160

Pro Gly Asn Leu Leu Val Asn Ala Asn Cys Asp Leu Lys Ile Cys Asp

165 170 175

Phe Gly Leu Ala Arg Thr Asn Ser Ser Lys Gly Gln Phe Met Thr Glu

180 185 190

Tyr Val Val Thr Arg Trp Tyr Arg Ala Pro Glu Leu Leu Leu Cys Cys

195 200 205

Asp Asn Tyr Gly Thr Ser Ile Asp Val Trp Ser Val Gly Cys Ile Phe

210 215 220

Ala Glu Leu Leu Gly Arg Lys Pro Ile Phe Pro Gly Thr Glu Cys Leu

225 230 235 240

Asn Gln Leu Lys Leu Ile Val Asn Val Leu Gly Thr Met Ser Glu Ser

245 250 255

Asp Leu Glu Phe Ile Asp Asn Pro Lys Ala Arg Arg Tyr Ile Lys Ser

260 265 270

Leu Pro Tyr Thr Pro Gly Val Pro Leu Ala Ser Met Tyr Pro His Ala

275 280 285

His Pro Leu Ala Ile Asp Leu Leu Gln Lys Met Leu Ile Phe Asp Pro

290 295 300

Thr Lys Arg Ile Ser Val Thr Glu Ala Leu Glu His Pro Tyr Met Ser

305 310 315 320

Pro Leu Tyr Asp Pro Ser Ala Asn Pro Pro Ala Gln Val Pro Ile Asp

325 330 335

Leu Asp Ile Asp Glu Asn Ile Ser Ala Asp Met Ile Arg Glu Met Met

340 345 350

Trp His Glu Met Leu His Tyr His Pro Glu Val Val Ala Ala Met Ser

355 360 365

Ala Arg

370

<210> 2

<211> 1113

<212> DNA

<213>Rice (Oryza sativa)

<400> 2

atggcgatca tggtggatcc tccaaatggg atgggtaacc aagggaagta ttactactcg 60

atgtggcaaa ctttgtttga gatagacact aagtatgtgc caatcaagcc catcgggcga 120

ggagcttatg ggattgtttg ttcatccata aatcgtgaga ccaacgagaa agtagcaata 180

aagaagatac acaatgtttt tgacaaccgt gttgatgcac taaggacttt gcgggagctg 240

aaacttctcc ggcatctccg ccatgagaat gttattgctt tgaaggatat aatgatgcca 300

gtacacagga ggagttttaa agatgtgtac ttagtttatg aactcatgga tactgacctg 360

catcagataa tcaagtcacc tcagggtctt tccaatgatc actgccaata ttttcttttt 420

cagttgcttc gaggactgaa atatctccat tcagcagaga tactccacag agacctgaaa 480

cctggaaatc tactggttaa tgcaaactgt gatctcaaga tatgtgattt tggtcttgca 540

cgcacaaaca gtagtaaagg tcagtttatg actgagtatg ttgtcacccg ctggtataga 600

gctcctgagt tgctcctttg ctgtgacaac tatggcactt ccattgatgt ttggtctgtt 660

ggttgcatct tcgctgagct acttggtcgg aaacctattt tcccaggaac tgagtgccta 720

aatcagctca agctcattgt caatgttctt ggcaccatga gcgagtctga cttggagttc 780

attgacaacc caaaagctcg cagatatatc aaatccctcc cctacactcc cggtgtgccc 840

ctcgcgagta tgtatccgca tgcacaccct cttgccattg atcttttaca gaagatgctc 900

atatttgatc ctaccaaaag aatcagtgtc accgaggctc ttgagcaccc ttacatgtcc 960

cctctgtatg atccaagtgc aaatcctccc gcgcaagtgc ctatcgatct ggacatagac 1020

gagaacatca gtgcagatat gatcagggaa atgatgtggc acgagatgct ccactaccac 1080

cctgaagttg ttgcagcaat gagtgcccga tga 1113

Claims (8)

1. a kind of rice paddy seed dormant trait modulin, amino acid sequence is as shown in SEQ ID NO.1.

2. a kind of rice paddy seed dormant trait controlling gene OsMPK14, amino acid sequence shown in the SEQ ID NO.1 in polynucleotide Row.

3. rice paddy seed dormant trait controlling gene OsMPK14 according to claim 2, it is characterised in that：The regulation and control base Because OsMPK14 is the cDNA sequence or genomic dna sequence of gene OsMPK14.

4. rice paddy seed dormant trait controlling gene OsMPK14 according to claim 3, it is characterised in that：The regulation and control base Because the nucleotide sequence of OsMPK14 is as shown in SEQ ID NO.2.

5. rice paddy seed dormant trait modulin as described in claim 1 and its encoding gene are improving rice paddy seed dormant trait In application.

6. application according to claim 5, it is characterised in that：The application is by CRISPR/Cas9 systems editor, interference Or OsMPK14 genes are knocked out, the biological function of OsMPK14 genes is reduced or destroyed, obtains anti growing out strain.

7. application according to claim 6, it is characterised in that：Build editor's carrier of the Grain Dormancy controlling gene And rice transformation, offspring is screened, obtains the rice strain that Grain Dormancy is improved.

8. application according to claim 7, it is characterised in that：Specifically comprise the following steps：

1) vector construction is edited：With reference to CRISPR/Cas9 editing techniques, target sequence, structure editor's carrier are selected；

2) it is transferred to using agrobcterium-mediated transformation by carrier is edited in easy Spike sprouting rice varieties；

3) with reference to receptor kind OsMPK14 gene orders, OsMPK14 knockout mutant strains are screened；It breeds the mutant strain and obtains fringe hair The strain that bud resistance is improved.