CN111616985A

CN111616985A - Oil body washing and protecting product and preparation method thereof

Info

Publication number: CN111616985A
Application number: CN202010037736.1A
Authority: CN
Inventors: 杨晶; 李海燕; 杜林娜; 李校堃; 兰馨馨
Original assignee: Jilin Agricultural University
Current assignee: Jilin Agricultural University
Priority date: 2020-01-14
Filing date: 2020-01-14
Publication date: 2020-09-04
Anticipated expiration: 2040-01-14
Also published as: CN111616985B

Abstract

The invention discloses an oil body washing and caring product and a preparation method thereof, and discloses a washing and caring product which comprises vegetable oil body emulsion, wherein the vegetable oil body emulsion is prepared by the following method: adding xanthan gum into deionized water, stirring uniformly without bubbles to make it fully swell, and slowly adding the vegetable oil suspension under the action of a magnetic stirrer; the vegetable oil body is a vegetable oil body which over-expresses oleosin; the final concentration of the oil body is 10 percent; the concentration of xanthan gum is 0.05-0.5%. The washing and protecting product prepared by the invention can reduce skin oil content, increase moisture, increase skin elasticity, and has good moisture retention and water locking performance and high safety.

Description

Oil body washing and protecting product and preparation method thereof

Technical Field

The invention belongs to the technical field of biotechnology and cosmetics, and particularly relates to an oil body washing and caring product and a preparation method thereof.

Background

The oil body contains highly unsaturated fatty acid, the linoleic acid content is up to more than 80 percent, the solution can be regarded as oil-water (O/W) emulsion, the oil-water emulsion is an important additive in food processing, and the oil-water emulsion is widely applied to food industry, such as conventional cream food, salad dressing, mayonnaise, meat and meat products. The stability of a gel is the most important property of its many physicochemical properties. The functional properties of the product can only be guaranteed if the system stability is reasonably controlled.

The extracted vegetable oil bodies are originally very unstable components in an isolated state. Vegetable oil bodies have components in vitro that are susceptible to mass changes due to isomerization, oxidative degradation, and the like caused by many factors such as air, heat, and metal ions. Therefore, the problem of stability of oil bodies is of great concern. The addition of a gel matrix in the oil-water food industry products plays an essential role, which can cover the oil bodies and then generate repulsive forces to prevent the oil bodies from agglomerating to maintain their stability.

Nowadays, many researchers at home and abroad have begun studying oil body structuring systems by combining vegetable oil bodies with the structural material of gels to form viscoelastic "gel-like" structures. The gel is effective in reducing trans fatty acids and saturated fatty acids. Oil body gels fall into two main categories, namely low molecular weight organogel systems, which are composed mainly of small molecules forming self-assembled or crystalline networks. The gelling agent used is mainly saturated fatty acids or alcohols, beeswax, phytosterols and peptides, or lecithin; another approach is to use hydrophobic biological macromolecules and their derivatives, such as ethyl cellulose, soy protein. The biological macromolecules have very good hydrophilicity, and the molecules are intertwined with each other and form a compact network structure through hydrogen bonds and electrostatic interaction.

At present, chemically synthesized washing and protecting products are all good in comparison, but the contained components are worried about, and although chemical substances contained in the products can clean the skin, the chemical substances can damage the skin and even cause anaphylactic reaction, so that the skin is aged. Along with the development of the times, people pay more and more attention to health, and the national monitoring strength to the environment is increased day by day, so that the preparation method of the skin care product adopting the pure natural non-irritant vegetable oil body raw material is of great significance. The natural raw materials can avoid skin damage, and the natural components of the natural vegetable oil bodies (safflower oil bodies, soybean oil bodies, sunflower oil bodies and the like) can balance sebum, condition skin, nourish and moisturize, and have the effects of resisting bacteria and diminishing inflammation; the addition of the effective components can better clean dirt in the deep part of the skin and deeply clean the skin, and meanwhile, natural components can not cause pollution to the environment, which is a necessary trend for the development of the cosmetic industry in the future.

Disclosure of Invention

The invention aims to provide an oil body washing and protecting product and a preparation method thereof.

A cleaning composition comprising a vegetable oil body emulsion, said vegetable oil body emulsion prepared by the process of: adding xanthan gum into deionized water, stirring uniformly without bubbles to make it fully swell, and slowly adding the vegetable oil suspension under the action of a magnetic stirrer;

the vegetable oil body is a vegetable oil body which over-expresses oleosin;

the final concentration of the oil body is 10 percent;

the concentration of the xanthan gum is 0.05-0.5%.

The washing and caring product is oil emulsion and comprises the following components in parts by mass: 10-55% of recombinant vegetable oil body emulsion, 5-10% of glycerol, 10-20% of carboxyethyl cellulose, 1-5% of PEG800, 5-20% of vitamin C and 0.1-0.5% of essence, wherein the total weight is 100%.

The washing and protecting article is an oil body cold soap which is composed of the following components in parts by mass: 2-20% of recombinant vegetable oil body emulsion, 15-40% of coconut oil, 15-40% of palm oil, 1-10% of castor oil, 2-10% of rose hip oil, 2-10% of olive oil, 2-10% of shea butter, 5-20% of alkali and the balance of distilled water, wherein the total weight is 100%.

The washing article is oil body hand cream which is composed of the following components in parts by mass: 5-40% of recombinant vegetable oil body suspension, 0.05-0.5% of xanthan gum, 5-10% of polyvinylpyrrolidone PVP, 3-8% of triglyceride, 10-20% of cetyl alcohol, 15-25% of cetostearyl alcohol, 15-20% of monoglyceride, 1-10% of xanthan gum, 5-10% of Pasteur Germany, 10-15% of glycerol and the balance of water, wherein the total weight is 100%.

The washing and caring product is oil body foot cream, which is composed of the following components in percentage by mass: 5-40% of recombinant vegetable oil body suspension, 0.05-0.5% of xanthan gum, 15-20% of glycerol, 10-20% of cetyl alcohol, 10-15% of cetostearyl alcohol, 15-20% of monoglyceride and the balance of water, wherein the total weight is 100%.

The invention provides a washing and caring product, which comprises vegetable oil body emulsion, wherein the vegetable oil body emulsion is prepared by the following method: adding xanthan gum into deionized water, stirring uniformly without bubbles to make it fully swell, and slowly adding the vegetable oil suspension under the action of a magnetic stirrer; the vegetable oil body is a vegetable oil body which over-expresses oleosin; the final concentration of the oil body is 10 percent; the concentration of xanthan gum is 0.05-0.5%. The washing and protecting product prepared by the invention can reduce skin oil content, increase moisture, increase skin elasticity, and has good moisture retention and water locking performance and high safety.

Drawings

FIG. 1 appearance of recombinant plant oil bodies;

FIG. 2 is a microstructure comparison of recombinant plant oil bodies and wild oil bodies; A. a wild oil body; B. recombinant plant oil bodies; C. a wild oil body emulsion; D. a wild oil body emulsion;

FIG. 3 is an appearance diagram of a suspension of reconstituted vegetable oil bodies;

FIG. 4 is a particle size detection graph of a suspension of recombinant plant oil bodies;

FIG. 5 is an appearance of a reconstituted vegetable oil body emulsion;

FIG. 6 is a particle size detection chart of the recombinant vegetable oil body emulsion;

FIG. 7 is a diagram of a finished product of the recombinant vegetable oil cold soap;

figure 8 is an appearance of the recombinant vegetable oil body hand cream.

Detailed Description

Example 1 preparation of recombinant vegetable oil bodies

Obtaining of plants overexpressing oleosin

Constructing a pOBT expression vector, and modifying a T-DNA region on the basis of a vector framework pCAMBIA1301, wherein the plasmid also has NcoI and HindIII enzyme cutting sites; flos CarthamioleosinInserting a gene (the base sequence of which is shown in a sequence table SEQ ID NO. 1) into a pOBT expression vector to obtain a recombinant pOTB-Oleosin vector, transfecting agrobacterium tumefaciens competent cells, and performing PCR identification by taking a bacterial liquid as a template; transforming the transfected agrobacterium into safflower by adopting an agrobacterium-mediated method: when the germinated seed has not grown true leaf, transecting the growth point below the cotyledon, contacting the surface wound of the explant with the prepared agrobacterium liquid for infection for 10min, and continuously culturing in a dark box at 25 ℃ for 4 days. Transferring the cotyledon node subjected to dark culture for 4 days onto a bud multiplication culture medium, transferring to an extension culture medium after 1-3 green bud points grow on the wound of the cotyledon node, culturing for about 4 weeks, and hardening and transplanting; after harvesting, T1 generation of safflower plants over-expressing oleosin are obtained.

Second, detecting the gene level and protein level of the over-expressed oleosin plant seed

Extracting safflower genome DNA of over-expressed oleosin, and respectively carrying out the following steps by using specific primers:

F:3’-5’:ATGGGTACGGTTGAAACGACA

R:3’-5’:AGCTCCGACAACCGACCAA

carrying out PCR detection to amplify a target band with the size consistent with that of the oleosin protein, and preliminarily determining that the target band is inserted into a plant genome; extracting the recombinant oil body to carry out SDS-PAGE detection, and finally obtaining the T3 generation safflower seed over-expressing oleosin.

Preparation of recombinant vegetable oil body

Taking 20g T3-generation safflower seeds over-expressing oleosin, cleaning for 2-3 times, absorbing water and drying in the air; crushing for 10s by using an ultrahigh-speed crusher; adding 200 mL PBS buffer solution, grinding by a juicer, coarsely filtering by gauze, placing the filtrate in a 50 mL centrifuge tube, and performing ultracentrifuge at 4 ℃ for 12000 r/min for 15 min; resuspending the solid matter on the upper layer with PBS buffer solution, stirring with a glass rod until no particles exist, and repeating the process once at 4 ℃ and 12000 r/min for 15min in an ultracentrifuge; resuspending the solid matter on the upper layer with PBS buffer solution, stirring with a glass rod until no particles exist, and repeating for 2 times at 4 deg.C and 12000 r/min for 15min in an ultracentrifuge; the obtained upper white solid is the recombinant plant oil body (over-expression oleosin oil body), and is stored at 4 ℃ for later use.

Example 2 preparation of recombinant vegetable oil bodies

Obtaining of plants overexpressing oleosin

Constructing a pOBT expression vector, and modifying a T-DNA region on the basis of a vector framework pCAMBIA1301, wherein the plasmid also has NcoI and HindIII enzyme cutting sites; subjecting Arabidopsis thaliana tooleosinInserting a gene (the base sequence of which is shown in a sequence table SEQ ID NO. 2) into a pOBT expression vector to obtain a recombinant pOTB-Oleosin vector, transfecting agrobacterium tumefaciens competent cells, and performing PCR identification by taking a bacterial liquid as a template; transforming the transfected agrobacterium with the method of Flora Dip into an arabidopsis explant: when the arabidopsis thaliana is in a state of white flower and clamp, the arabidopsis thaliana is inverted and infected in the prepared agrobacterium liquid for 8-15min, dark culture is carried out for 2-3 days, and after seed collection, resistance screening is carried out to obtain T1 generation over-expression oleosin arabidopsis thaliana plants.

Extracting the arabidopsis genome DNA of over-expressed oleosin, and respectively carrying out the following steps by using specific primers:

F:3’-5’:ATGGCGGATACAGC TAGAGGAA

R:3’-5’:CACCGGGTGGAGTAGTGTGCTGG；

carrying out PCR detection, amplifying a target band with the size consistent with that of the oleosin protein, and preliminarily determining that the target band is inserted into an arabidopsis plant genome; and extracting the recombinant oil body, and detecting by SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) to finally obtain T3 generation of Arabidopsis seeds over-expressing oleosin.

Preparation of recombinant vegetable oil body

Taking 20g T3 generation Arabidopsis seeds over-expressing oleosin, cleaning for 2-3 times, absorbing water and drying in the air; adding 200 mL of PBS buffer solution, grinding by using a mortar, coarsely filtering by using gauze, placing filtrate in a 50 mL centrifuge tube, and performing ultracentrifuge at 4 ℃ for 12000 r/min for 15 min; resuspending the solid matter on the upper layer with PBS buffer solution, stirring with a glass rod until no particles exist, and repeating the process once at 4 ℃ and 12000 r/min for 15min in an ultracentrifuge; resuspending the solid matter on the upper layer with PBS buffer solution, stirring with a glass rod until no particles exist, and repeating for 2 times at 4 deg.C and 12000 r/min for 15min in an ultracentrifuge; the obtained upper white solid is the recombinant plant oil body (over-expression oleosin oil body), and is stored at 4 ℃ for later use.

Example 3 preparation of recombinant oil body suspensions

Adjusting the pH value of the PBS buffer solution to 6-9 by using 1 moL of HCl or NaOH, wherein the ion concentration is 10mM, adding the recombinant vegetable oil body into the PBS buffer solution, fully and uniformly stirring the solution by using a magnetic stirrer without particles, and preparing a recombinant oil body suspension, wherein the concentration of the recombinant oil body suspension is 10%, and the appearance of the recombinant oil body suspension is shown in figure 3; the particle size of the recombinant oil body suspension is 400-900nm, and the particle size of the wild-type oil body suspension is 700-1500nm (Table 1, figure 4).

Example 4 preparation of a reconstituted oil body emulsion

Selecting proper stabilizing agents from various stabilizing agents such as carbomer, sodium carboxymethylcellulose, Tween-80, Tween-20, xanthan gum, glucan and the like; weighing a proper amount of stabilizer, adding deionized water, stirring uniformly without bubbles, and fully swelling. Slowly adding the vegetable oil body suspension under a magnetic stirrer to finally prepare the recombinant vegetable oil body emulsion, wherein the concentration range of the stabilizer is 0.3 percent, and the final concentration of the oil body is 10 percent; by measuring the microstructure, particle size and potential indexes, xanthan gum is finally determined as the optimal stabilizer (table 2), and the appearance of the recombinant vegetable oil body emulsion is shown in figure 5.

Example 5 detection of stability of the reconstituted oil body emulsion

1) Respectively placing the prepared vegetable oil emulsion (xanthan gum as stabilizer) in a constant temperature water bath, and performing constant temperature treatment at 30 deg.C, 60 deg.C and 90 deg.C for 30min and high ultrasonic treatment at 50w-250w for 30min, 60min and 90 min; the determination of microstructure, particle size and potential indexes shows that the vegetable oil body emulsion has good stability to temperature and ultrasound.

2) Alkali resistance experiment: the vegetable oil emulsion (xanthan gum is used as a stabilizer) is still milk white oil emulsion after 5 percent of sodium hydroxide is added, and the appearance is unchanged.

EXAMPLE 6 preparation of reconstituted oil body skin Care emulsion

Weighing 10-55% of recombinant vegetable oil body emulsion (a recombinant oil body suspension is added with xanthan gum), 5-10% of glycerol, 10-20% of carboxyethyl cellulose, 1-5% of PEG800, 5-20% of vitamin C and 0.1-0.5% of essence according to the mass percentage of the raw materials, wherein the percentage content of all the components is 100% finally; adding glycerol, carboxyethyl cellulose, PEG800 and vitamin C into a stirring cup, and emulsifying for 30min under the shearing force of 1000-12000 rpm; then adding 10-55% of the recombinant vegetable oil body emulsion into the mixture, stirring the mixture evenly, finally adding 0.1-0.5% of essence into the mixture, mixing the mixture evenly and bottling the mixture.

EXAMPLE 7 preparation of vegetable oil Cold soap

According to the mass ratio of the raw materials, 15-40% of coconut oil, 15-40% of palm oil, 0-10% of castor oil, 2-10% of rosehip oil, 2-10% of olive oil, 2-10% of shea butter, 5-20% of alkali and 20-30% of distilled water, wherein the percentage content of all the components is 100% finally; adding coconut oil, palm oil, castor oil, rose hip oil, olive oil and shea butter into a stirring cup, fully and uniformly mixing, pouring an alkali solution which is prepared in advance and is recovered to 45 +/-5 ℃, placing the mixture into a water bath at 45 +/-5 ℃, heating and stirring for 3-4 hours until the soap liquid is uniform, adding 2-20% of recombinant vegetable oil body suspension into the mixture, mixing, pouring the mixture into a mold, and drying for 1-2 days to obtain a primary hand soap product; demoulding the obtained handmade soap, saponifying in shade and ventilation for 8-12 weeks, trimming soap, and packaging to obtain the final product handmade soap (figure 6). The skin indices of 10 volunteers who used the cold soap before and after use were measured, and the results are shown in Table 5.

EXAMPLE 8 preparation of Cold soap from vegetable oil bodies

2-20% of recombined vegetable oil body emulsion, 15-40% of coconut oil, 15-40% of palm oil, 1-10% of castor oil, 2-10% of rosehip oil, 2-10% of olive oil, 2-10% of shea butter, 5-20% of alkali and the balance of distilled water by mass proportion, wherein the percentage content of all the components is 100% finally;

adding coconut oil, palm oil, castor oil, rose hip oil, olive oil and shea butter into a stirring cup according to a certain proportion, fully and uniformly mixing, pouring an alkali solution which is prepared in advance and is recovered to 45 +/-5 ℃, and placing in a water bath at 45 +/-5 ℃ to heat and stir for 3-4 hours until a soap solution is uniform; adding 2-20% of the recombined vegetable oil body emulsion (the recombined oil body suspension is added with xanthan gum) of the total mass of the soap liquid, mixing, pouring into a mould and drying for 1-2 days to obtain an initial product of the handmade soap; and (3) demolding the obtained handmade soap primary product, continuously saponifying for 8-12 weeks in a shady and ventilated place, repairing the soap, and packaging to obtain the finished handmade soap. The skin indices of 10 volunteers who used the cold soap before and after use were measured, and the results are shown in Table 6.

The cold soap is prepared from pure natural vegetable oil body raw materials, has the effects of efficiently cleaning, moistening skin, improving skin quality, resisting bacteria and diminishing inflammation, is mild, does not stimulate, is natural, has no pollution, is suitable for both men and women, and is suitable for people of all ages. The vegetable oil body components enable the product of the invention to have the effects of moisturizing, locking water, cleaning and the like (see table 7).

Example 9 preparation of recombinant vegetable oil body hand cream

The mass fractions of the substances are respectively as follows: 5-40% of recombinant vegetable oil body suspension, 0.05-0.5% of xanthan gum, 5-10% of polyvinylpyrrolidone PVP, 3-8% of triglyceride, 10-20% of cetyl alcohol, 15-25% of cetostearyl alcohol, 15-20% of monoglyceride, 1-10% of xanthan gum, 5-10% of Pasteur Germany, 10-15% of glycerol and the balance of water, wherein the total weight is 100%;

the method comprises the following specific steps:

1) weighing 5-10% of polyvinylpyrrolidone (PVP), 3-8% of triglyceride, 10-20% of cetyl alcohol, 15-25% of cetostearyl alcohol, 15-20% of monoglyceride, 1-10% of xanthan gum, 5-10% of German Basff and 10-15% of glycerol, adding water, carrying out water bath at 75 ℃, and stirring with a glass rod until all solid particles are dissolved; 2) dissolving xanthan gum in 0.05 mol/L phosphate buffer solution with pH of 7.0, heating to 60 ℃, magnetically stirring for 2h, absorbing water, swelling, mixing with the recombinant vegetable oil suspension, and stirring for 2h to form recombinant vegetable oil emulsion;

3) mixing the liquid obtained in the step 1) and the liquid obtained in the step 2), stirring, and carrying out intermittent emulsification for 30min by using an emulsifier until the emulsion is milky white and uniform in color and no particles exist; adding a small amount of pure natural plant essential oil, stirring, mixing, and subpackaging to obtain the recombinant plant oil body hand cream; the skin indexes before and after the application of the hand cream were measured by selecting 10 volunteers, and the results are shown in table 8, wherein the oil content of hands of the volunteers is reduced and the water content is increased after the volunteers use the hand cream.

Example 10 preparation of recombinant plant oil body foot cream

The mass fractions of the substances are respectively as follows: 5-40% of recombinant vegetable oil body suspension, 0.05-0.5% of xanthan gum, 15-20% of glycerol, 10-20% of cetyl alcohol, 10-15% of cetostearyl alcohol, 15-20% of monoglyceride and the balance of water, wherein the total weight is 100%;

the method comprises the following specific steps:

1) weighing 15-20% of glycerol, 10-20% of cetyl alcohol, 10-15% of cetostearyl alcohol and 15-20% of monoglyceride, adding 420mL of water into a base hand cream matrix substance, carrying out water bath at 75 ℃, and stirring with a glass rod until solid particles are completely dissolved;

2) dissolving xanthan gum in 0.05 mol/L phosphate buffer solution with pH of 7.0, heating to 60 ℃, magnetically stirring for 2h, absorbing water, swelling, mixing with the recombinant vegetable oil suspension, and stirring for 2h to form recombinant vegetable oil emulsion;

3) mixing the liquids obtained in the steps 1) and 2), stirring, intermittently emulsifying for 30min by using an emulsifier, and subpackaging. The results of measuring the skin indexes before and after the application of the foot cream by 10 volunteers are shown in Table 9, in which the oil content of the foot cream is increased, the skin elasticity is enhanced, and the moisture content is increased.

。

Sequence listing

<110> Jilin university of agriculture

<120> oil body washing and protecting product and preparation method thereof

<160>2

<170>SIPOSequenceListing 1.0

<210>1

<211>447

<212>DNA

<213> safflower (Carthamus tinctorius L.)

<400>1

atgggtacgg ttgaaacgac attcgacacg atggatcgac gacgagtgga tcaaatcact 60

ggcgagacga tgctactcgc gaccttagtc gccatagctg ttgccggacc actgatggtc 120

ctgatggtta tcagtttttg taccacattg acactgtttc tagtcagtgc tccacttttc 180

ataatcttcg gccctttgct gttgggtgcc ggttttgtgc tcacgatggt gttggtgggg 240

ttcggtatgg ccgccatgat ggcgatggcg gggcttgcta cgttgggatg ggttttcaga 300

tcgcttagag gcgacactgg gaaggtgatc agagacatgg tcgtggagtt gggggacagg 360

gttaaagatg ccaaaagcaa ttgggctatt catttgaatc agaaggtgca taatatgccg 420

gaaaattggt cggttgtcgg agcttag 447

<210>2

<211>731

<212>DNA

<213> Columbia type Arabidopsis thaliana (Arabidopsis thaliana)

<400>2

atggcggata cagctagagg aacccatcac gatatcatcg gcagagacca gtacccgatg 60

atgggccgag accgagacca gtaccagatg tccggacgag gatctgacta ctccaagtct 120

aggcagattg ctaaagctgc aactgctgtc acagctggtg gttccctcct tgttctctcc 180

agccttaccc ttgttggaac tgtcatagct ttgactgttg caacacctct gctcgttatc 240

ttcagcccaa tccttgtccc ggctctcatc acagttgcac tcctcatcac cggttttctt 300

tcctctggag ggtttggcat tgccgctata accgttttct cttggattta caagtaagca 360

cacatttatc atcttacttc ataattttgt gcaatatgtg catgcatgtg ttgagccagt 420

agctttggat caattttttt ggtcgaataa caaatgtaac aataagaaat tgcaaattct 480

agggaacatt tggttaacta aatacgaaat ttgacctagc tagcttgaat gtgtctgtgt 540

atatcatcta tataggtaaa atgcttggta tgatacctat tgattgtgaa taggtacgca 600

acgggagagc acccacaggg atcagacaag ttggacagtg caaggatgaa gttgggaagc 660

aaagctcagg atctgaaaga cagagctcag tactacggac agcaacatac tggtggggaa 720

catgaccgtg a 731

Claims

1. A washing and caring article is characterized in that: the vegetable oil body emulsion is prepared by the following method: adding xanthan gum into deionized water, stirring uniformly without bubbles to make it fully swell, and slowly adding the vegetable oil suspension under the action of a magnetic stirrer.

2. The cleaning article of claim 1 wherein said vegetable oil bodies are oleosin overexpressing vegetable oil bodies.

3. A cleaning article according to claim 2 wherein said final oil body concentration is 10%.

4. A cleaning article according to claim 1, 2 or 3 wherein the concentration of xanthan gum is from 0.05 to 0.5%.

5. The washing product of claim 4, wherein the washing product is an oil emulsion comprising the following components in parts by weight: 10-55% of recombinant vegetable oil body emulsion, 5-10% of glycerol, 10-20% of carboxyethyl cellulose, 1-5% of PEG800, 5-20% of vitamin C and 0.1-0.5% of essence, wherein the total weight is 100%.

6. The washing product of claim 4, wherein the washing product is an oil cold soap comprising the following components in parts by weight: 2-20% of recombinant vegetable oil body emulsion, 15-40% of coconut oil, 15-40% of palm oil, 1-10% of castor oil, 2-10% of rose hip oil, 2-10% of olive oil, 2-10% of shea butter, 5-20% of alkali and the balance of distilled water, wherein the total weight is 100%.

7. The washing product as claimed in claim 4, wherein the washing product is an oily hand cream which comprises the following components in parts by mass: 5-40% of recombinant vegetable oil body suspension, 0.05-0.5% of xanthan gum, 5-10% of polyvinylpyrrolidone PVP, 3-8% of triglyceride, 10-20% of cetyl alcohol, 15-25% of cetostearyl alcohol, 15-20% of monoglyceride, 1-10% of xanthan gum, 5-10% of Pasteur Germany, 10-15% of glycerol and the balance of water, wherein the total weight is 100%.

8. The washing and care product as claimed in claim 4, wherein the washing and care product is oil body foot cream which is composed of the following components in parts by mass: 5-40% of recombinant vegetable oil body suspension, 0.05-0.5% of xanthan gum, 15-20% of glycerol, 10-20% of cetyl alcohol, 10-15% of cetostearyl alcohol, 15-20% of monoglyceride and the balance of water, wherein the total weight is 100%.