CN104274343A - Recombinant collagen polypeptides containing vegetable oil body skin-care emulsion - Google Patents

Recombinant collagen polypeptides containing vegetable oil body skin-care emulsion Download PDF

Info

Publication number
CN104274343A
CN104274343A CN201310300893.7A CN201310300893A CN104274343A CN 104274343 A CN104274343 A CN 104274343A CN 201310300893 A CN201310300893 A CN 201310300893A CN 104274343 A CN104274343 A CN 104274343A
Authority
CN
China
Prior art keywords
oil body
skin
vegetable oils
polypeptide
col
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201310300893.7A
Other languages
Chinese (zh)
Inventor
杨晶
李校堃
李海燕
王沥浩
王文慧
郭咏昕
王艳芳
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jilin Agricultural University
Original Assignee
Jilin Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jilin Agricultural University filed Critical Jilin Agricultural University
Priority to CN201310300893.7A priority Critical patent/CN104274343A/en
Publication of CN104274343A publication Critical patent/CN104274343A/en
Pending legal-status Critical Current

Links

Landscapes

  • Cosmetics (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention relates to a recombinant collagen polypeptides containing vegetable oil body skin-care emulsion, and more specifically relates to a new formula of an emulsion. The emulsion comprises a water phase component, carboxyethyl cellulose as an emulsifier, a safflower oil body as an oil phase component of a matrix, a Col-containing arabidopsis oil body as a functional component, a coupling agent PEG600, methylparaben and propyl ester as preservatives, and a safflower essence as an essence. According to the invention, through an emulsification technology, the Col-containing arabidopsis oil body and the safflower oil body of the matrix are uniformly distributed in the emulsion, because the specific surface areas of the vegetable oil bodies are relatively large, the emulsion is absorbed by skin more easily, and can form a layer of breathable protective film on the surface of the skin; and in addition, the vegetable oil bodies can be used as natural emulsifiers, so that Col is distributed in the oil bodies, and absorbed by skin more easily, thereby effectively delaying or preventing the aging of the skin and restoring or repairing skin trauma.

Description

A kind of vegetable oils facial treatment milk containing recombined collagen polypeptide
Technical field
The invention belongs to cosmetics manufacturing technology field, especially relate to a kind of facial treatment milk of vegetable oils of recombined collagen polypeptide.
Background technology
Collagen is a kind of fibrin in organism, is mainly present in the tissues such as skin, bone, cartilage and tendon, accounts for 25% ~ 33% of human body or other animal body total protein contents.Collagen protein is widely used in biomedical materials field because of its excellent biological characteristics.Therefore, how to carry out high-purity, the extraction with bioactive collagen of high yield is the problem that vast researcher is paid close attention to always.The type of collagen protein is many, has had been found that 26 kinds, and be distributed in the tissue such as skin, tendon, wherein, in skin, the collagen protein of about 85% belongs to IV type, and IV Collagen Type VI is that content studies the most thorough collagen at most, accounts for about 90% of organism collagen total amount.IV Collagen Type VI is generally white, transparent, branchiess fibril, the heterogeneous collagen (Heterotypic Collagen) be made up of two identical α 1 (IV) chains and α 2 (IV) chain.338 (Gly-X-Y) repetitive sequences are contained in the helical region of α 1 (IV) and α 2 (IV) peptide chain, and X is often proline, and Y is often hydroxyproline or hydroxylysine.Therefore, glycine accounts for 1/3, and proline and hydroxyproline account for more than 1/5, also has a large amount of hydroxylysines and alanine.In α chain, the existence of pyrrole ring makes N-C key not rotate freely, and form left hand helix, pitch is 0.87nn, often turns around and about has 3.3 amino acid residues.Article three, α chain relies on side-chain residue to be connected, and minimum amino acids Glycine residue is positioned at inside triple helix, and pitch is 96nm, and often circle has 36 amino acid residues, defines the distinctive triple helix structure of procollagen (tropo collagen) molecule.
Collagen protein all has biological function in a lot, comprise: (1) collagen protein can protect skin, improve the elasticity of skin, collagen protein plays an important role in the regeneration of adjustment epidermal renewal, and collagen protein can promote cell adhesion and cell proliferation; (2) collagen protein has anthemorrhagic performance; (3) collagen protein has very low immunogenicity; (4) collagen protein depending on and stent material as Growth of Cells, can induce the propagation such as epithelial cell, break up and divide a word with a hyphen at the end of a line; (5) collagen protein is the skeleton of extracellular matrix, its distinctive triple-helix structure, no matter make it be absorbed as the neoblastic skeleton of formation, or is assimilated by host, all shows good biocompatibility.
The multiformity of collagen structure and functional characteristics and complexity, determine its critical role in a lot of fields and good application prospect.
(1) application in food
Collagen protein inherently can as a kind of food, and edible collagen protein generally derives from the corium of animal, tendon and ossein, and its outward appearance is generally white, and mouthfeel is soft, and taste is light, easy to digest.But in most cases collagen protein can be used as functional mass or nutritional labeling in food.
(2) application in cosmetics
Collagen protein has moisture-keeping function, repairs the effects such as skin, whitening and moist hair, makes these beautification functions of collagen protein, has been widely used in cosmetics.
(3) application in biomedical sector
Low challeng, biocompatibility, anastalsis and biodegradable are the advantage place of collagen protein as biomedical material.In recent years, the state such as Great Britain and America adopts injectivity collagen to carry out the various damages of reduction facial soft tissue.The collagen injection agent of China's development has been widely used in the boundary that improves looks, and at delay skin aging, rebuilding in impaired skin etc. and achieve good effect, is a kind of desirable medical material.
(4) application in paper industry
Application as raw material: containing a large amount of carboxyl, amino, hydroxyl in collagen fiber molecule, and also containing great amount of hydroxy group and a small amount of carboxyl in cellulose, many active groups and active site is contained just because of in these two kinds of natural polymers, method by chemistry or physics makes composite, moulds packaging material, wallpaper, paper for daily use, light-shielding sheet, agricultural byproducts packaging material, biological collagen wrapping paper, composite biodegradable material etc. for the manufacture of book-binding leather, film.
Utilize plant bioreactor to produce pharmaceutical protein, more and more receive the concern of people in recent years, oil body protein is memebrane protein main in oil body.Oil body protein is the hydrophobin of alkalescence, and three parts form oil body protein: the C end of lipophilic and N end, and middle hydrophobic region, it enters into oil body inside by immobilized artificial membrane.N end and C end are then embedded in oil body surface, are exposed in Cytoplasm.Oil body protein has surfactant, makes it can not be combined with oil body.This non binding of oil body is very suitable as emulsifying agent.Emulsifying agent can reduce the interfacial tension between immiscible liquid, makes it to become emulsion.Oil body emulsifying agent extracts from natural oilseed, and the structure of oil body protein and its specificity, make oil body be widely used in biotechnology, and such as it can as emulsifying agent, carries and fixing recombiant protein etc.It can also be applied to purification, refolding and fixing recombiant protein, on oil body surface, destination protein and oil body protein are combined by two kinds of modes usually, are respectively to express in oil body with oil body protein fusion and be connected with oil body protein as affinity tag by part.The present invention is according to vegetable oils characteristic, recombined collagen polypeptide gene is made to be connected to N end or the C end of oil body protein gene, gene fusion construct, makes destination protein specific expressed in vegetable oils, utilizes the characteristic that oil body lipophilic is hydrophobic, after seed is pulverized, through different extracting solution extracting, reclaim oil phase, both fusion rotein and other components intracellular can be separated, simplify purification procedures, reduce purification cost and production cost.
In recent years, biology gene engineering technology tremendous development and had influence on the every aspect of life sciences, all bring brand-new opportunity to develop also to cosmetics industry, cosmetics have been improved looks from the beauty treatment of traditional chemistry, plant beauty to biological beauty and gene and have been developed simultaneously.Such as, traditional skin nursing is only confined to oil film and covers and keep the physical methods such as moisture, and beauty and skin care theory starts the nursing turning to cellular level now, and the cosmetics therefore containing the biotic factor material of high-affinity arise at the historic moment.Nowadays, increasing medicine and biotechnology expert throw oneself into this research field in the world, and many countries also all aim at this great market of biological cosmetics, exploitation biological beauty product.Somatomedin, hyaluronic acid and the nucleic acid etc. obtained with biotechnology are applied to cosmetics, these new research trends also make people recognize biological cosmetics will bring the change of essence to cosmetics quality.
Biological cosmetics refers to the cosmetics that applied bioengineering technology and goods thereof obtain, its main component biologically active polypeptide major part is cell growth factor, content is atomic in vivo for they, but biological activity is high, biological regulation effect is played to various kinds of cell physiological function and metabolic activity, affect the growth of polytype cell, division, differentiation, propagation and migration directly or indirectly, play an important role in beauty and skin care, plastic surgery, burn ulcer and various dermopathic wound repair with healing.Collagen protein to be modified or after special conservation treatment through stable structure; add in cosmetics with certain valid density, can effectively and Skin Cell have an effect, promote epithelial cell Nutrition and Metabolism; protection skin, prevents the skin injury because a variety of causes causes.Normal skin protection kind adds the function that competent cell somatomedin effectively can also promote subcutaneous collagen cell, accelerates the growth of skin collagen cell, makes cell accelerate secretion collagen, thus reaches crease-resistant and the effect of slow down aging.
Summary of the invention
The object of the invention is to provide a kind of vegetable oils facial treatment milk containing recombined collagen polypeptide, gives full play to the oil body Transdermal absorption effect of recombined collagen polypeptide.
This facial treatment milk provided by the invention is achieved by the following technical programs: a kind of facial treatment milk containing recombined collagen polypeptide (Col) active polypeptide, be made up of the raw material of following weight portion: oiliness raw material 20% (wherein glycerol 10%), emulsifying agent 10%, coupling agent 3%, antiseptic 0.25%, essence 2%, nourishing additive agent 8%, vitamin C 5% all the other be deionized water.
The present invention prepares a kind of preparation method containing recombined collagen polypeptide (Col) facial treatment milk, comprises the following steps and is prepared: first extracted by vegetable oils, then join in oil body by water, mix homogeneously; Then add glycerol and emulsifying agent carboxyethyl cellulose step by step, coupling agent PEG600, stirs, and high shear is emulsified at 1000rpm-30000rpm, emulsifying 10-20min in homogenizer; Finally, add the mixed liquor of antiseptic methyl hydroxybenzoate and propylparaben and nourishing additive agent after stirring again and contain the vegetable oils of recombined collagen polypeptide and vitamin C and Stigma Croci essence, after stirring product of the present invention.
The present invention is that the fusion expressed product of the oil body protein and recombined collagen polypeptide that utilization is embedded in oil body surface can directly as the exploitation of active component for skin care item; simplify the processing technique that somatomedin mixes with emulsifying agent (or protective agent), reduce production cost.The biological activity of recombined collagen polypeptide protein can be protected simultaneously; recombined collagen polypeptide active polypeptide is utilized the characteristic of oil body protein; wrapped up by vegetable oils; be positioned at oil body surface; by emulsifying homogeneous technology; recombined collagen polypeptide protein can be made to be evenly distributed in very much in facial treatment milk, by the Transdermal absorption effect of oil body, to make it easily play a role.Present invention process is simple, and effect is remarkable, and cost reduces, so technical scheme of the present invention is the technical scheme of high-quality.
Accompanying drawing explanation
Fig. 1 oil body expresses the carrier schematic diagram (oil body expresses the carrier schematic diagram of recombined collagen polypeptide gene) of Col gene
Fig. 2 safflower oil bodies microgram
Fig. 3 contains the audio-visual picture (audio-visual picture of the arabidopsis oil body containing recombined collagen polypeptide) of the arabidopsis oil body of Col albumen
Fig. 4 contains the Activity determination (Activity determination of the arabidopsis oil body containing recombined collagen polypeptide) of the arabidopsis oil body of Col albumen
Fig. 5 contains the emulsion audio-visual picture (audio-visual picture containing recombined collagen polypeptide facial treatment milk) of Col vegetable oils
specific embodiment
Embodiment 1 recombined collagen polypeptide is expressed in vegetable oils
The nucleotide sequence of Preference to the recombined collagen peptide C ol found from GENBANK according to vegetable codon is transformed, and rare amino acid codon less for content in plant is replaced to the codon of favorite plant.Degeneracy according to codon eliminates restriction enzyme site used in this experiment, sends to Shanghai Sheng Gong biological engineering company limited and carries out synthetic restructuring recombined collagen polypeptide gene (SEQ ID NO.1).
Embodiment 2 clones phaseolus vulgaris seeds specific promoter and terminator
Clone's Kidney bean promoter and terminator gene, in order to clone seed-specific expression promoter and terminator from bean gene group sequence, utilize primer, the polymerase chain reaction (PCR) of employing standard, from bean gene group DNA, amplification obtains the DNA fragmentation of 1548bp and 1220bp, the fragment of amplification, through digestion with restriction enzyme, is cloned in pUC57 cloning vehicle, saves backup.Through order-checking, its base sequence is as shown in sequence table SEQ ID NO.2 and SEQ ID NO.3.
Kidney bean promoter primer
Primer5F:GAATTCATTGTACTCCCAG
Primer5R:AGTAGAGTAGTATTGAATATGAG
Kidney bean terminator primer
tem5F:AATAAGTATGAACTAAAATGC
tem5R:TTAGTTGGTAGGGTGCTAGGAA
Embodiment 3 builds plant specific expression carrier pOBT
The cloning vehicle of pUC57-Kidney bean promoter restricted enzyme pstI and NcoI is digested, reclaim object fragment Kidney bean promoter sequence, digest basic plasmid pO with pstI and NcoI (take p1301 as basic framework simultaneously, its T-DNA district is transformed, except the NOS gene remaining with T-DNA district, all the other genes are all replaced by 35S and Bar gene, with pEGAD plasmid for template, 35S-F forward primer 47bp cggggtaccAtccgtcaacatggtggagcacgacacgcttgtctact and Bar-R downstream primer 54bp cggaattcactagttcagatctcggtgacgggcaggaccggacggggcggaacc is utilized to carry out PCR, amplification obtains 35S-Bar gene, before utilizing kpnI and SpeI restriction enzyme site to be inserted into the NOS gene in pCAMBIAl301 carrier T-DNA district, construct the basic plasmid of p1301-35S-Bar-NOS, be abbreviated as pO plasmid), the Kidney bean promoter fusion gene of oil body protein and recombined collagen polypeptide (be used for start) is connected with basic plasmid pO, transformation of E. coli, obtain pOB intermediate carrier, cloning vehicle HindIII and kpnI of pUC57-terminator is digested, reclaim object fragment Kidney bean terminator, simultaneously with these two enzymic digestion pOB intermediate carriers, terminator is connected with the pOB carrier after enzyme action, transformation of E. coli, obtains plant specific expression carrier pOBT.
The clone of embodiment 4 arabidopsis oil body protein gene
Get arabidopsis seed, extract DNA genome, with primer:
1:CCATGGCGGATACAGCTAGAGG
2:CACCGGGTGGAGTAGTGTGCTGG
Carry out amplification arabidopsis oil body protein gene, through order-checking, its base sequence is as shown in sequence table SEQ ID NO.4; The fragment of amplification, through restricted enzyme (NcoI enzyme and EcoRI enzyme) digestion, is cloned in pUC57 cloning vehicle, saves backup.
Embodiment 5 builds the vegetable oils specific expression carrier pOBT-Col containing arabidopsis oil body protein and recombined collagen peptide fusion gene
To clone the arabidopsis oil body protein gene obtained and recombined collagen polypeptide gene of recombinating for template, design fusion gene primer, by fusion DNA vaccine technology, obtains oleosin-Col fusion gene, through order-checking, its base sequence is as shown in sequence table SEQ ID NO.5.Fusion gene restricted enzyme NcoI and HindIII is carried out enzyme action, with these two enzymes, enzyme action is carried out to pOBT carrier simultaneously, then fusion gene is connected with the pOBT carrier after enzyme action, transformation of E. coli, produce pOBT-Col plant oil-body expression vector.
Arabidopsis oil body protein and recombined collagen peptide fusion gene primer
1:CCATGGCGGATACAGCTAGAGG
2:CACCGGGTGGAGTAGTGTGCTGG
3:CCAGCACACTACTCCACCCGGT
4:CCCAAGCTTCCACCGGC
The genetic transformation that embodiment 6Flora dip method is carried out
First, infecting waters wildtype Arabidopsis thaliana and butch flax plant the previous day irrigates; Agrobacterium tumefaciens attachment is seeded to 50ml to contain in the YEP fluid medium of three anti-(100 μ g/ml Rif, 50 μ g/ml Str and 50 μ g/ml Kan), carries out preculture (180rpm/min, 28 DEG C); Get pre-incubated Agrobacterium 7ml to join in the YEP fluid medium resisted containing three, carry out amplification culture, until OD5900=1.0 ~ 1.2; Agrobacterium bacterium liquid is moved on in centrifuge tube, and 20 DEG C, the centrifugal 20min of 4000rpm, collects thalline, removes three anti-culture medium.With the resuspended thalline of Flora-DipBuffer, its OD590 is made to reach 0.8 ~ 0.9.The bud cut kind of a pod before conversion, bloom and show money or valuables one carries unintentionally.Plug the bamboo let of suitably height in alms bowl body surrounding, turn to support the alms bowl body carrying out infecting around.The stem of arabidopsis and blade base are immersed in resuspended Agrobacterium bacterium liquid, leave standstill 7 minutes, then inhale and abandon too much bacterium liquid.Keep flat the alms bowl body after conversion, spend the night with moisturizings such as plastic sheetings, within second day, can slightly reveal a crack, within the 3rd day, normally place.One Zhou Houke carries out secondary infection.After seed maturity, the pod that jaundice is ripe can be plucked every other day, results seed.
Embodiment 7 screens the high transgenic line of expression
Transgenic line in greenhouse or land for growing field crops through growth with grow, then blossom and have seeds, form transgenic T1 for seed, after T1 is for seed harvest, every strain transfer-gen plant gets 200-1000mg, the fusion rotein of extract oil body protein and recombined collagen polypeptide in extracting solution, detects the expression of restructuring recombined collagen polypeptide through Enzyme-multiplied immune technique, filter out the transgenic line of high expressed, the strain expression of high expressed reaches 3586.85pg/ml.
Prepared by the oil body of embodiment 8 containing recombined collagen polypeptide
The oil body containing recombined collagen polypeptide protein is extracted from the transgenic oil crop seeds containing recombined collagen polypeptide protein, save backup, concrete grammar is as follows: (1) gets 0.1mg transgenic seed, puts into mortar, add lml PBS, fully grind with pestle.Until solution turned cloudy, cannot see kind of a grain.Put into centrifuge 10000rpm, 4 DEG C, centrifugal 10min; (2) centrifugal rear solution is divided into three layers, and namely top layer is white oil layer, intermediate layer liquid, and bottom sediment.By upper strata oil body fraction and liquid part mix homogeneously, whole sucking-off, notes not sucking-off bottom sediment, is moved in another centrifuge tube by the liquid rotating of sucking-off, add PBS, centrifugal 10000rpm, 4 DEG C, 10min, repeat 1,2 steps, 3 ~ 4 times.(3) liquid of the centrifugal rear sucking-off of repetition 1,2 step is added the PBS mixing of 500 μ l, 4 DEG C in centrifuges, 10000rpm, centrifugal 10min.(4) be divided into two-layer after now centrifugal, for upper strata oil fraction and subnatant body divide, by lower floor's liquid sucking-off, discard.Repeat 3,4 steps again, 3 ~ 4 times.
The assay of recombined collagen polypeptide in embodiment 9 oil body
Transgenic line in greenhouse or land for growing field crops through growth with grow, then blossom and have seeds, form transgenic T1 for seed, after T1 is for seed harvest, every strain transfer-gen plant gets 200-1000mg, the fusion rotein of extract oil body protein and recombined collagen polypeptide in extracting solution, adopt ELISA method, operate according to ELISA kit (gold medal bio tech ltd, Changchun hundred) description, detect the expression of recombined collagen polypeptide in oil body, as calculated, in arabidopsis oil body, the expression of recombined collagen polypeptide is 3586.85pg/ml.
The Activity determination of recombined collagen polypeptide in embodiment 10 oil body
1, collect logarithmic (log) phase cell NIH3T3 cell and use cell counting count board counting, in 96 hole flat undersides, every hole adds 100ul Cell sap, and cell number is about 6000.
2., 37 DEG C, 5%CO2 cultivates 24h, puts basis of microscopic observation cell monolayer and is paved with at the bottom of hole.Now, gently pour out the complete medium in 96 orifice plates, every hole adds the starvation media of 100ul.
3., 5%CO2, cultivate 24 hours for 37 DEG C, if 7 gradient dosings, every hole 100ul, if 2 multiple holes.Use sterling albumen bFGF as positive control, wildtype Arabidopsis thaliana seed oil bodies is as negative control simultaneously.
4,5%CO2, cultivate 48 hours for 37 DEG C, every hole adds the MTT solution that 25ul concentration is 0.5%,
5,5%CO2,37 DEG C of continuation stop cultivating after cultivating 4h, abandon culture fluid.
6, every hole adds 120ulDMSO, low-speed oscillation 10min, and purple crystal fully dissolves rear enzyme-linked immunosorbent assay instrument and measures under 570nm wavelength.The results are shown in Figure 4.
The extraction of embodiment 11 safflower oil bodies
(1) get 200 ~ 1000mg wild type Semen Carthami, put into mortar, add 1ml Buffer A, fully grind with pestle.Until solution turned cloudy, cannot see kind of a grain.Put into centrifuge 12000rpm, 4 DEG C, centrifugal 30min;
(2) centrifugal rear solution is divided into three layers, and namely top layer is white oil layer, intermediate layer liquid, and bottom sediment.By upper strata oil body fraction and liquid part mix homogeneously, whole sucking-off, notes not sucking-off bottom sediment, is moved in another centrifuge tube by the liquid rotating of sucking-off, add BufferB, centrifugal 18000rpm, 4 DEG C, 10min, repeat 1,2 steps, 3 ~ 4 times.
(3) liquid of the centrifugal rear sucking-off of repetition 1,2 step is added the BufferC mixing of 500 μ l, 4 DEG C in centrifuges, 18000rpm, centrifugal 10min.
(4) be divided into two-layer after now centrifugal, for upper strata oil fraction and subnatant body divide, by lower floor's liquid sucking-off, discard.Repeat 3,4 steps again, 3 ~ 4 times.
Buffer?A:0.6M?Sucrose,0.5M?NaCl,0.05M?Tris-HCl(pH=7.0);
Buffer?B:0.4M?Sucrose,0.5M?NaCl,0.05M?Tris-HCl(pH=7.0);
Buffer?C:20mM?Na 2HPO 4,20mM?NaCl(pH=7.0)。
Embodiment 12 facial treatment milk recipe determination
A kind of facial treatment milk containing recombined collagen polypeptide, be made up of the raw material of following weight portion: 5%-25% wetting agent (safflower oil bodies), 10% glycerol, 10%-25% emulsifying agent (carboxyethyl cellulose), 1.5%-8% coupling agent (PEG600), 0.05%-0.5% antiseptic (methyl hydroxybenzoate and propylparaben mixed liquor), 1%-10% nourishing additive agent (the arabidopsis oil body containing recombined collagen polypeptide protein) and 5%-20% vitamin C, appropriate amount of essence, all the other are deionized water, the present invention devises orthogonal experiment, by stability experiment and Activity determination, determine that best emulsion formulations is 10% oiliness raw material (safflower oil bodies), 10% glycerol, 10% emulsifying agent (carboxyethyl cellulose), 3% coupling agent (PEG600), 0.25% antiseptic (methyl hydroxybenzoate and propylparaben mixed liquor), 0.5% essence, 8% nourishing additive agent (the arabidopsis oil body containing recombined collagen polypeptide protein), 5% vitamin C.
Embodiment 13 facial treatment milk preparation method
The present invention prepares a kind of preparation method containing recombined collagen polypeptide facial treatment milk, comprises the following steps and is prepared: first extracted by vegetable oils, then join in oil body by water, mix homogeneously; Then add glycerol and emulsifying agent carboxyethyl cellulose step by step, coupling agent PEG600, stirs, and high shear is emulsified at 1000rpm-30000rpm, emulsifying 10-20min in homogenizer; Finally, add the mixed liquor of antiseptic methyl hydroxybenzoate and propylparaben and nourishing additive agent after stirring again and contain the vegetable oils of recombined collagen polypeptide and vitamin C and Stigma Croci essence, after stirring product of the present invention.
Embodiment 14 facial treatment milk stability experiment
(1) in 40 DEG C of electro-heating standing-temperature cultivators, place 30-50 days, observe after recovering room temperature, lamination, does not have good stability;
Within (2) 24 hours, frequent variations back and forth between 0 DEG C-50 DEG C, repeatable operation 15-30 days like this, observes after recovering room temperature, does not have lamination, have good stability;
(3) in the electro-heating standing-temperature cultivator of-5 DEG C of refrigerators and 40 DEG C, respectively put 1 day, repeatable operation 5-7 days like this, observe after recovering room temperature, do not occur lamination, have good stability;
(4) in the electro-heating standing-temperature cultivator of 40 DEG C, place 5-7 days, then in 0 DEG C of-5 DEG C of refrigerator, place 5-7 days, the electro-heating standing-temperature cultivator next putting into 40 DEG C-50 DEG C is again placed 30 days, observes, have good stability after recovering room temperature.
By above-mentioned laboratory observation, oiliness raw material 10%, glycerol 10%, emulsifying agent 10%, coupling agent 3%, antiseptic 0.25%, essence 0.5%, nourishing additive agent 8%, vitamin C 5%, the stability of this emulsion formulations is better.
Embodiment 15 facial treatment milk effect containing recombined collagen polypeptide oil body
First carry out anti-oxidation efficacy detection to facial treatment milk, select the scavenging action of pyrogallol method detection to ultra-oxygen anion free radical, crystal violet method detects the scavenging action to light free radical, and DPH method detects the scavenging action to total free radical.
Then white-skinned face function is detected, adopt tyrosine inhibiting AChE, get 4 test tubes and be numbered C1, C2, T1, T2 respectively, in each pipe, corresponding reagent is added according to the order of table 1, C1, T1 first put into 37 DEG C of water-bath 10min before adding tryrosinase, and then added tryrosinase, then C1, C2, T1, T2 were jointly put into and jointly put into 37 DEG C of water-bath 10min, take out measure the absorbance of each pipe of C1, C2, T1, T2 at 475nm place respectively, do three times parallel.
Above-mentioned this method is adopted to measure the clearance rate of the ultra-oxygen anion free radical of the skin care item of following different formulations, Scavenging action to hydroxyl free radical, total free radical scavenging activity, tyrosinase inhibition rate.
Composition 1 (the present invention): oiliness raw material (safflower oil bodies) 10%, glycerol 10%, emulsifying agent (carboxyethyl cellulose) 10%, coupling agent (PEG600) 3%, antiseptic (methyl hydroxybenzoate and propylparaben mixed liquor) 0.25%, essence (Stigma Croci essence) 0.5%, nourishing additive agent (the arabidopsis oil body containing 28694.8pg recombined collagen polypeptide) 8%, vitamin C 5%;
Composition 2: oiliness raw material (safflower oil bodies) 10%, glycerol 10%, emulsifying agent (carboxyethyl cellulose) 10%, coupling agent (PEG600) 3%, antiseptic (methyl hydroxybenzoate and propylparaben mixed liquor) 0.25%, essence (Stigma Croci essence) 0.5%, vitamin C 5%;
Composition 3: oiliness raw material (glycerol) 20%, emulsifying agent (carboxyethyl cellulose) 10%, coupling agent (PEG600) 3%, antiseptic (methyl hydroxybenzoate and propylparaben mixed liquor) 0.25%, essence (Stigma Croci essence) 0.5%, nourishing additive agent (the arabidopsis oil body containing 23005.12pg recombined collagen polypeptide) 8%, vitamin C 5%;
Composition 4: oiliness raw material (glycerol) 20%, emulsifying agent (carboxyethyl cellulose) 10%, coupling agent (PEG600) 3%, antiseptic (methyl hydroxybenzoate and propylparaben mixed liquor) 0.25%, essence (Stigma Croci essence) 0.5%, nourishing additive agent (28694.8pgCol sterling) 8%, vitamin C 5%;
Compare the clearance rate of skin care item to ultra-oxygen anion free radical of these four kinds of compositing formulas, Scavenging action to hydroxyl free radical, total free radical scavenging activity, tyrosinase inhibition rate, result is as follows.
Table 1 reactant liquor composition and volume
The antioxidation of table 2 different formulations compares with white-skinned face function
The percutaneous absorption rate of embodiment 16 containing recombined collagen polypeptide oil body facial treatment milk
First be placed in acceptance pool by magnetic stick, then the rat skin in vitro of preparation is lain in acceptance pool upper end, release pond clip upwards, is then fixed in acceptance pool by stratum corneum side.Get and detect medicine 0.2ml uniform application on keratodermatitis, inject acceptance pool with syringe by probe tube acceptable solution, emptying air, makes skin another side and acceptable solution close contact.The electrode of low frequency electromagnetic composite pulse instrument is fixed on the Corium Mus surface of instrument group and short group thoroughly.Constant speed stirs, respectively at 1,2,4,8,16h extracts acceptable solution 1.0ml, then adds the fresh acceptable solution of 1.0ml.In experiment, the volume of diffusion cell used is 7.0ml, and sampling amount is 1.0ml, and infiltrating area is 2.92cm 2, according to oil body content and the Col content of each compositing formula in the transdermal acceptable solution recorded, add up infiltration capacity (Q) according to following formulae discovery:
Q = Cn × 7.0 + Σ i = 1 n - 1 Ci × 1.0 S μg
In formula, the drug level that the Cn: the n-th sample point records; The drug level that Ci: the i-th sample point records; S: infiltrating area.The accumulative infiltration capacity of the mesaconitine obtained according to formulae discovery
The accumulative infiltration capacity of table 3 different formulations composition

Claims (5)

1. the vegetable oils containing recombined collagen polypeptide, it is characterized in that: utilize recombinant DNA technology to construct the vegetable oils specific expression vector pOBT-Col containing Col gene, be converted in oil crop, transgene receptor plant is obtained through Screening and Identification, through cultivating results transgenic seed, from transgenic seed, separation and Extraction contains the vegetable oils of recombined collagen polypeptide.
2. the vegetable oils facial treatment milk containing recombined collagen polypeptide (Col) active polypeptide, is characterized in that: it comprises each composition of following weight percents
3. facial treatment milk according to claim 2, is characterized in that: wetting agent is safflower oil bodies and glycerol, and nourishing additive agent is arabidopsis oil body and the vitamin C of restructuring collagen protein polypeptide active polypeptide.
4. facial treatment milk according to claim 2, is characterized in that: described antiseptic is the mixture of methyl hydroxybenzoate and propylparaben, and coupling agent is PEG600, and emulsifying agent is carboxyethyl cellulose, and essence is Stigma Croci essence.
5. facial treatment milk according to claim 2, it is characterized in that: be prepared according to following steps: first vegetable oils is extracted, then water is joined in oil body, mix homogeneously: then add glycerol and emulsifying agent carboxyethyl cellulose step by step, coupling agent PEG600, stir, high shear is emulsified at 1000rpm-30000rpm, emulsifying 10-20min in homogenizer; Finally, after stirring, add the mixed liquor of antiseptic methyl hydroxybenzoate and propylparaben and the vegetable oils of nourishing additive agent recombined collagen polypeptide active polypeptide and Stigma Croci essence again, after stirring product of the present invention.
CN201310300893.7A 2013-07-09 2013-07-09 Recombinant collagen polypeptides containing vegetable oil body skin-care emulsion Pending CN104274343A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201310300893.7A CN104274343A (en) 2013-07-09 2013-07-09 Recombinant collagen polypeptides containing vegetable oil body skin-care emulsion

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201310300893.7A CN104274343A (en) 2013-07-09 2013-07-09 Recombinant collagen polypeptides containing vegetable oil body skin-care emulsion

Publications (1)

Publication Number Publication Date
CN104274343A true CN104274343A (en) 2015-01-14

Family

ID=52250014

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201310300893.7A Pending CN104274343A (en) 2013-07-09 2013-07-09 Recombinant collagen polypeptides containing vegetable oil body skin-care emulsion

Country Status (1)

Country Link
CN (1) CN104274343A (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107460037A (en) * 2017-09-30 2017-12-12 陈芹芳 High calcium camellia oil and its production technology
CN108096082A (en) * 2017-12-28 2018-06-01 纽莱福泰姆网络服务(北京)有限公司 A kind of promotion microcirculation skin-protecting face nursing lotion and preparation process
CN111264634A (en) * 2020-01-14 2020-06-12 吉林农业大学 Vegetable oil body emulsion and application
CN111616985A (en) * 2020-01-14 2020-09-04 吉林农业大学 Oil body washing and protecting product and preparation method thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101129305A (en) * 2007-07-05 2008-02-27 浙江大学 Water-soluble fibroin face pack for beauty treatment
CN102125509A (en) * 2010-01-19 2011-07-20 上海华银日用品有限公司 Olive nourishing and tonic oil and preparation method thereof
CN103276002A (en) * 2013-05-31 2013-09-04 吉林农业大学 Oil body containing oil body protein and collagen fusion protein

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101129305A (en) * 2007-07-05 2008-02-27 浙江大学 Water-soluble fibroin face pack for beauty treatment
CN102125509A (en) * 2010-01-19 2011-07-20 上海华银日用品有限公司 Olive nourishing and tonic oil and preparation method thereof
CN103276002A (en) * 2013-05-31 2013-09-04 吉林农业大学 Oil body containing oil body protein and collagen fusion protein

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
杨晶等: "植物生物反应器的研究进展", 《生物工程学报》 *
王建新主编: "《化妆品植物原料大全》", 30 June 2012, 中国纺织出版社 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107460037A (en) * 2017-09-30 2017-12-12 陈芹芳 High calcium camellia oil and its production technology
CN108096082A (en) * 2017-12-28 2018-06-01 纽莱福泰姆网络服务(北京)有限公司 A kind of promotion microcirculation skin-protecting face nursing lotion and preparation process
CN111264634A (en) * 2020-01-14 2020-06-12 吉林农业大学 Vegetable oil body emulsion and application
CN111616985A (en) * 2020-01-14 2020-09-04 吉林农业大学 Oil body washing and protecting product and preparation method thereof
CN111264634B (en) * 2020-01-14 2023-03-28 吉林农业大学 Vegetable oil body emulsion and application
CN111616985B (en) * 2020-01-14 2023-06-02 吉林农业大学 Oil body washing and protecting product and preparation method thereof

Similar Documents

Publication Publication Date Title
CN103102407A (en) Genetic recombinant human-like collagen
CN102020716A (en) Gene recombination human collagen fusion peptide segment, preparation method and application thereof
CN104274343A (en) Recombinant collagen polypeptides containing vegetable oil body skin-care emulsion
CN106943338A (en) Personalized beauty care skin care item and preparation method thereof
KR20110032587A (en) Fgf10-derived peptides and uses thereof
CN114525284B (en) Red skin longan anthocyanin biosynthesis regulatory gene DlMYB1-HP and application thereof
JP5654666B2 (en) Method for producing fermented natural products
CN103333915B (en) A kind of vegetable oils facial treatment milk containing Prostatropin active polypeptide
CN103343138B (en) A kind of vegetable oils facial treatment milk containing acid fibroblast growth factor active polypeptide
CN103343137B (en) Vegetable oil body skin-care emulsion containing epidermal growth factor active polypeptide
CN103276002B (en) Oil body containing oil body protein and collagen fusion protein
CN101299991A (en) Fibroblast activator, method for activation of fibroblast, collagen synthesis promoter, method for promotion of collagen synthesis, skin aging-preventing agent, and method for prevention of aging of t
CN101851620B (en) Method for producing FGFs by utilizing edible medicinal fungus
CN103320466B (en) Vegetable oil body skin care lotion containing vascular endothelial growth factor active peptides
CN110408627A (en) Anti reversion relative protein matter and its encoding gene and application
CN104274336A (en) Skin care emulsion serving as vegetable oil body and containing active peptides of coenzyme Q10
CN109566806A (en) It is a kind of for promoting the sargassum fusifome extracting solution of selenium-enriched vine tea health-care effect
CN108949730A (en) A kind of preparation method and applications recombinating allosteric clostridiopetidase A
CN109207499A (en) Key gene IbPAL1 and application in sweet potato chlorogenic acid route of synthesis
CN115521371A (en) Recombinant humanized type III collagen, preparation method and application
CN112545915A (en) Facial mask with excellent moisturizing and repairing effects
CN110066810A (en) A kind of Chinese tamarisk plasma membrane Na+/H+Antiporter gene and its application
CN103319609A (en) Human basic fibroblast growth factor (hbFGF) fusion gene and application thereof
CN105177037B (en) Utilize double oil body protein fusion technological expression collagens
CN108570100A (en) Cotton fiber stretches transcription factor GhbHLH18 and its application of long-term expression

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20150114