CN103343137B - Vegetable oil body skin-care emulsion containing epidermal growth factor active polypeptide - Google Patents
Vegetable oil body skin-care emulsion containing epidermal growth factor active polypeptide Download PDFInfo
- Publication number
- CN103343137B CN103343137B CN201310287157.2A CN201310287157A CN103343137B CN 103343137 B CN103343137 B CN 103343137B CN 201310287157 A CN201310287157 A CN 201310287157A CN 103343137 B CN103343137 B CN 103343137B
- Authority
- CN
- China
- Prior art keywords
- growth factor
- epidermal growth
- oil body
- factor polypeptide
- activities
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
The invention discloses a vegetable oil body skin-care emulsion containing epidermal growth factor active polypeptide. A fusion expression product of oil body protein embedded on the surface of an oil body and an epidermal growth factor can be utilized to be directly used as an active component for developing a skin-care product, so that the processing process for mixing the growth factor and an emulsifier (or protecting agent) can be simplified, and the production cost can be reduced. Furthermore, the bioactivity of the epidermal growth factor protein can be protected, the epidermal growth factor active polypeptide can be positioned on the surface of the oil body through vegetable oil body coating by utilizing the characteristic of the oil body protein, and the epidermal growth factor protein can be uniformly distributed in the skin-care emulsion by an emulsification and homogenization technology, and can be easily volatilized through the transdermal absorption of the oil body. The vegetable oil body skin-care emulsion containing epidermal growth factor active polypeptide is simple in process, remarkable in effect and low in cost.
Description
Technical field
The invention belongs to biological technical field and cosmetic technical field, be specifically related to the vegetable oils containing activities of epidermal growth factor polypeptide and a kind of vegetable oils facial treatment milk containing activities of epidermal growth factor polypeptide.
Background technology
In recent years, biology gene engineering technology tremendous development and had influence on the every aspect of life science, all bring brand-new opportunity to develop also to cosmetics industry, makeup have been improved looks from the beauty treatment of traditional chemistry, plant beauty to biological beauty and gene and have been developed simultaneously.Such as, traditional skin care is only confined to oil film and covers and keep the physical methods such as moisture, and beauty and skin care theory starts the nursing turning to cell levels now, and the makeup therefore containing the biotic factor material of high-affinity arise at the historic moment.Nowadays, increasing medicine and biotechnology expert throw oneself into this research field in the world, and many countries also all aim at this great market of biological cosmetics, exploitation biological beauty product.Somatomedin, hyaluronic acid and the nucleic acid etc. obtained with biotechnology are applied to makeup, these new research trends also make people recognize biological cosmetics will bring the change of essence to makeup quality.
Biological cosmetics refers to the makeup that applied bioengineering technology and goods thereof obtain, its main component biologically active polypeptides major part is cell growth factor, content is atomic in vivo for they, but biological activity is high, biological regulation effect is played to various kinds of cell physiological function and Metabolic activity, affect the growth of broad variety cell, division, differentiation, propagation and migration directly or indirectly, play an important role in beauty and skin care, plastic surgery, burn ulcer and various dermopathic wound repair with healing.Cell growth factor to be modified or after special conservation treatment through stable structure; add in makeup with certain effective concentration, can effectively and skin cells have an effect, promote epithelial cell Nutrition and Metabolism; protection skin, prevents the skin injury because a variety of causes causes.Normal skin care kind adds the function that active cells somatomedin effectively can also promote subcutaneous collagen cell, accelerates the growth of skin collagen cell, makes cell accelerate secretion collagen, thus the effect reaching crease-resistant and delay senility.
Urogastron promotes body epidermic cell, epithelial cell, fibroblastic growth, division and new city metabolism in vivo, promotes microvascular growth, improves the microenvironment of Growth of Cells.Therefore it has good reparation, nursing role to damaged skin, sensitive skin, trauma skin and reconstruction property skin, and particularly to change skin postoperative to popular in current beauty salon, the reparation of Local Damaged skin, can also the generation of prevention of postoperative complication.In addition, because the cytokines such as Urogastron can promote the new city metabolism of the various cell of skin, promote and strengthen the absorption to nutritive substance, the mean age of skin histology can be made to reduce, improve the pigment situation of skin, reach the object of whitening, nti-freckle; Urogastron can also promote the synthesis of oxyproline, impels collagen and collagenase synthesis, secretion Collagen material, hyaluronic acid and glycoprotein, regulate collegen filament, there is skin care, strengthen skin elasticity, reduce wrinkle of skin and the effect preventing skin aging.In addition, Urogastron can also stimulate the formation of granulation tissue and promote the epithelization of granulation tissue, and also adjustable collagen degradation agent upgrades, and collegen filament is arranged in a linear fashion, prevents reticular tissue paraplasm.So there is the effect shortened the wound healing time and reduce cicatrization, to preventing and nursing, so there is the effect shortened the wound healing time and reduce cicatrization, also there is good effect to preventing and nursing acne.Carry out the exploitation of skin care product with the vegetable oils containing activities of epidermal growth factor polypeptide, can effectively make egf protein be assigned in oil body.The skin care product prepared with it can increase cellular metabolism, promote the growth of neonatal cell, treatment chloasma, and minimizing pigmentation, strengthens and maintain the effect of nti-freckle, and effect is better, promotes surface of a wound epithelization, wound repair after promotion shaping and beauty.
Summary of the invention
The object of the invention is to provide vegetable oils specific expression carrier pOBT-EGF.
A kind of expression vector plasmid
pOBT-eGF, it is prepared by following method:
1) take p1301 as basic framework, its T-DNA district is transformed, except the NOS gene remaining with T-DNA district, all the other genes are all replaced by 35S and Bar gene, with pEGAD plasmid for template, 35S-F upstream primer cggggtaccAtccgtcaacatggtggagcacgacacgcttgtctact and Bar-R downstream primer cggaattcactagttcagatctcggtgacgggcaggaccggacggggcggaacc is utilized to carry out PCR, amplification obtains 35S-Bar gene, before utilizing kpnI and SpeI restriction enzyme site to be inserted into the NOS gene in pCAMBIA1301 carrier T-DNA district, construct the basic plasmid of p1301-35S-Bar-NOS, be abbreviated as pO plasmid,
2) with pstI with NcoI respectively enzyme cut and be connected gene shown in pO plasmid and sequence table SEQ ID NO.2, obtain intermediate carrier pOB;
3) with Hind III and kpnI respectively enzyme cut and be connected gene shown in intermediate carrier pOB and sequence table SEQ ID NO.3, obtain plant specific expression carrier pOBT;
4) with NcoI and Hind III respectively enzyme cut and connect gene shown in plant specific expression carrier pOBT and sequence table SEQ ID NO.5, obtain expression vector plasmid pOBT-EGF
.
Another object of the present invention is to provide a kind of vegetable oils containing activities of epidermal growth factor polypeptide.
A vegetable oils containing activities of epidermal growth factor polypeptide, it is inserted in plant expression vector by the gene of its base sequence as shown in sequence table SEQ ID NO.5, and the expression vector plasmid of acquisition, is converted in oil crops, results Extraction oil of seed body;
Described expression vector plasmid is expression vector plasmid pOBT-EGF;
Described oil crops are Arabidopis thaliana.
Another object of the present invention is to provide a kind of vegetable oils facial treatment milk containing activities of epidermal growth factor polypeptide and preparation method thereof.
A kind of facial treatment milk containing activities of epidermal growth factor polypeptide, it comprises the weight percent of following component: 5%-25% safflower oil bodies, 10% glycerine, 10%-25% carboxyethyl cellulose, 1.5%-6% PEG600,0.05%-0.5% sanitas, 1%-10% contains Arabidopis thaliana oil body and the 5%-20% vitamins C of egf protein, and surplus is deionized water;
Be preferably: 10% safflower oil bodies, 10% glycerine, 10% carboxyethyl cellulose, 3% PEG600,0.25% sanitas, 0.5% essence, 6% containing the Arabidopis thaliana oil body of egf protein, 5% vitamins C.
Described sanitas is Tegosept M and propylben mixed solution.
A preparation method for vegetable oils facial treatment milk containing activities of epidermal growth factor polypeptide, comprise the following steps: by said ratio, first just water joins in safflower oil bodies, mixes; Then add glycerine and emulsifying agent carboxyethyl cellulose step by step, coupler PEG600, stirs, and high-shear is emulsified at 1000rpm-30000rpm, emulsification 10-20min in clarifixator; Add sanitas, a kind of vegetable oils and vitamins C containing activities of epidermal growth factor polypeptide after stirring again, stir.
The present invention is that the fusion expressed product of the oil body protein and Urogastron that utilization is embedded in oil body surface can directly as the exploitation of activeconstituents for skin care product; simplify the complete processing that somatomedin mixes with emulsifying agent (or protective material), reduce production cost.The biological activity of egf protein can be protected simultaneously; activities of epidermal growth factor polypeptide is utilized the characteristic of oil body protein; wrapped up by vegetable oils; be positioned at oil body surface; by emulsifying homogeneous technology; egf protein can be made to be evenly distributed in very much in facial treatment milk, by the Transdermal absorption effect of oil body, to make it easily play a role.Present invention process is simple, and effect is remarkable, and cost reduces.
Accompanying drawing explanation
Fig. 1 oil body expresses the carrier schematic diagram of Urogastron EGF gene
Fig. 2 safflower oil bodies microgram
Fig. 3 contains the audio-visual picture of the Arabidopis thaliana oil body of Urogastron EGF albumen
Fig. 4 contains the Activity determination of the Arabidopis thaliana oil body of Urogastron EGF albumen
Fig. 5 contains the emulsion audio-visual picture of EGF vegetable oils
Embodiment
embodiment 1 egf protein is expressed in vegetable oils
The nucleotide sequence of Preference to the Urogastron EGF found from GENBANK according to vegetable codon is transformed, and rare amino acid codon less for content in plant is replaced to the codon of favorite plant.Degeneracy according to codon eliminates restriction enzyme site used in this experiment, sends to Shanghai Sheng Gong biotechnology company limited and carries out synthetic recombinant human epidermal growth factor gene (SEQ ID NO.1).
embodiment 2: clone's phaseolus vulgaris seeds specific promoter and terminator
Clone's Kidney bean promotor and terminator gene, in order to clone seed-specific expression promoter and terminator from bean gene group sequence, utilize primer, the polymerase chain reaction (PCR) of employing standard, from bean gene group DNA, amplification obtains the DNA fragmentation of 1548bp and 1220bp, the fragment of amplification, through digestion with restriction enzyme, is cloned in pUC57 cloning vector, saves backup.Through order-checking, its base sequence is as shown in sequence table SEQ ID NO.2 and SEQ ID NO.3.
Kidney bean promoter primer
Primer5F: GAATTCATTGTACTCCCAG
Primer5R：AGTAGAGTAGTATTGAATATGAG
Kidney bean terminator primer
tem5F: AATAAGTATGAACTAAAATGC
tem5R: TTAGTTGGTAGGGTGCTAGGAA
embodiment 3: build plant specific expression carrier pOBT
The cloning vector of pUC57-Kidney bean promotor restriction enzyme pstI and NcoI is digested, reclaim object fragment Kidney bean promoter sequence, digest basic plasmid pO(with p1301 with pstI and NcoI is basic framework simultaneously, its T-DNA district is transformed, except the NOS gene remaining with T-DNA district, all the other genes are all replaced by 35S and Bar gene, with pEGAD plasmid for template, 35S-F upstream primer 47bp cggggtaccAtccgtcaacatggtggagcacgacacgcttgtctact and Bar-R downstream primer 54bp cggaattcactagttcagatctcggtgacgggcaggaccggacggggcggaacc is utilized to carry out PCR, amplification obtains 35S-Bar gene, before utilizing kpnI and SpeI restriction enzyme site to be inserted into the NOS gene in pCAMBIA1301 carrier T-DNA district, construct the basic plasmid of p1301-35S-Bar-NOS, be abbreviated as pO plasmid), the Kidney bean promotor fusion gene of oil body protein and Urogastron (be used for start) is connected with basic plasmid pO, transformation of E. coli, obtain pOB intermediate carrier, cloning vector HindIII and kpnI of pUC57-terminator is digested, reclaim object fragment Kidney bean terminator, simultaneously with these two enzymic digestion pOB intermediate carriers, the pOB carrier after being cut with enzyme by terminator is connected, transformation of E. coli, obtains plant specific expression carrier pOBT.
embodiment 4: the clone of Arabidopis thaliana oil body protein gene
Get Arabidopis thaliana seed, extract DNA genome, with primer:
1：CCATGGCGGATACAGCTAGAGG
2：CACCGGGTGGAGTAGTGTGCTGG
Carry out amplification Arabidopis thaliana oil body protein gene, through order-checking, its base sequence is as shown in sequence table SEQ ID NO.4; The fragment of amplification, through restriction enzyme (NcoI enzyme and EcoRI enzyme) digestion, is cloned in pUC57 cloning vector, saves backup.
embodiment 5: build the vegetable oils specific expression carrier pOBT-EGF containing Arabidopis thaliana oil body protein and Urogastron fusion gene
The Arabidopis thaliana oil body protein gene obtained with clone and recombinant human epidermal growth factor gene are for template, and design fusion gene primer, by fusion DNA vaccine technology, obtain oleosin-EGF fusion gene, through order-checking, its base sequence is as shown in sequence table SEQ ID NO.5.Fusion gene restriction enzyme NcoI and HindIII is carried out enzyme cut, carry out enzyme with these two enzymes to pOBT carrier simultaneously and cut, the pOBT carrier after then being cut with enzyme by fusion gene is connected, transformation of E. coli, produces pOBT-EGF plant oil-body expression vector.
Arabidopis thaliana oil body protein and Urogastron fusion gene primer
1：CCATGGCGGATACAGCTAGAGG
2：GAGTCTGAATTCATAGTAGTGTGCTGGCC
3：GGCCAGCACACTACTATGAATTCAGACTCTG
4：TTATCTCAGTTCCCACCACTTCAGG
the genetic transformation that embodiment 6:Flora dip method is carried out
First, infecting waters wildtype Arabidopsis thaliana and butch flax plant the day before yesterday irrigates; Agrobacterium tumefaciens attachment is seeded to 50ml to contain in the YEP liquid nutrient medium of three anti-(100 μ g/ml Rif, 50 μ g/ml Str and 50 μ g/ml Kan), carries out preculture (180rpm/min, 28 DEG C); Get pre-incubated Agrobacterium 7ml to join in the YEP liquid nutrient medium resisted containing three, carry out enlarged culturing, until OD5900=1.0 ~ 1.2; Agrobacterium bacterium liquid is moved on in centrifuge tube, and 20 DEG C, the centrifugal 20min of 4000rpm, collects thalline, removes three anti-substratum.With the resuspended thalline of Floral-Dip Buffer, its OD590 is made to reach 0.8 ~ 0.9.The bud cut kind of a pod before conversion, bloom and show money or valuables one carries unintentionally.Plug the bamboo let of suitably height in alms bowl body surrounding, turn to support the alms bowl body carrying out infecting around.The stem of Arabidopis thaliana and blade base are immersed in resuspended Agrobacterium bacterium liquid, leave standstill 7 minutes, then inhale and abandon too much bacterium liquid.Keep flat the alms bowl body after conversion, spend the night with moisturizings such as plastics films, within second day, can slightly reveal a crack, within the 3rd day, normally place.One Zhou Houke carries out secondary infection.After seed maturity, the pod that jaundice is ripe can be plucked every other day, results seed.
embodiment 7: the transgenic line that screening expression amount is high
Transgenic line in greenhouse or land for growing field crops through growth with grow, then blossom and have seeds, form transgenosis T1 for seed, after T1 is for seed harvest, every strain transfer-gen plant gets 200-1000mg, the fusion rotein of extract oil body protein and Urogastron in extracting solution, detects the expression amount of recombinant human epidermal growth factor through Enzyme-multiplied immune technique, filter out the transgenic line of high expression level, the strain expression amount of high expression level reaches 54.06ng/ml.
embodiment 8: the oil body preparation containing activities of epidermal growth factor polypeptide
The oil body containing egf protein is extracted from the transgenosis oil crop seeds by using containing egf protein, save backup, concrete grammar is as follows: (1) gets 0.1mg transgenic seed, puts into mortar, add 1ml PBS, fully grind with pestle.Until solution turned cloudy, cannot see kind of a grain.Put into whizzer 10000rpm, 4 DEG C, centrifugal 10min; (2) centrifugal rear solution is divided into three layers, and namely top layer is white oil layer, middle layer liquid, and bottom sediment.Upper strata oil body fraction and liquid portion are mixed, whole sucking-off, note not sucking-off bottom sediment, the liquid rotating of sucking-off is moved in another centrifuge tube, adds PBS, centrifugal 10000rpm, 4 DEG C, 10min, repeat 1,2 steps, 3 ~ 4 times.(3) liquid of the centrifugal rear sucking-off of repetition 1,2 step is added the PBS mixing of 500 μ l, 4 DEG C in centrifuges, 10000rpm, centrifugal 10min.(4) be divided into two-layer after now centrifugal, be upper strata oil fraction and lower floor's liquid portion, by lower floor's liquid sucking-off, discard.Repeat 3,4 steps again, 3 ~ 4 times.
the assay of embodiment 9 oil body Concentrations of Epidermal Growth Factor albumen
Transgenic line in greenhouse or land for growing field crops through growth with grow, then blossom and have seeds, form transgenosis T1 for seed, after T1 is for seed harvest, every strain transfer-gen plant gets 200-1000mg, the fusion rotein of extract oil body protein and egf protein in extracting solution, adopt ELISA method, operate according to ELISA kit (gold medal bio tech ltd, Changchun hundred) specification sheets, detect the expression amount of oil body Concentrations of Epidermal Growth Factor albumen, as calculated, the expression amount of Arabidopis thaliana oil body Concentrations of Epidermal Growth Factor is 54.06ng/ml.
the Activity determination of embodiment 10 oil body Concentrations of Epidermal Growth Factor albumen
1, collect logarithmic phase cell NIH3T3 cell and use cell counting count board counting, in 96 hole flat undersides, every hole adds 100ul enchylema, and cell count is about 6000.
2., 37 DEG C, 5%CO2 cultivates 24h, puts basis of microscopic observation cell monolayer and is paved with at the bottom of hole.Now, gently pour out the perfect medium in 96 orifice plates, every hole adds the starvation media of 100ul.
3., 5%CO2, cultivate 24 hours for 37 DEG C, if 7 gradient dosings, every hole 100ul, if 2 multiple holes.Use sterling albumen bFGF as positive control, wildtype Arabidopsis thaliana seed oil bodies is as negative control simultaneously.
4,5%CO2, cultivate 48 hours for 37 DEG C, every hole adds the MTT solution that 25ul concentration is 0.5%,
5,5%CO2,37 DEG C of continuation stop cultivating after cultivating 4h, abandon nutrient solution.
6, every hole adds 120ulDMSO, low-speed oscillation 10min, and purple crystal fully dissolves rear enzyme-linked immunosorbent assay instrument and measures under 570nm wavelength.The results are shown in Figure 4.
the extraction of embodiment 11 safflower oil bodies
(1) get 200 ~ 1000mg wild-type Semen Carthami, put into mortar, add 1ml Buffer A, fully grind with pestle.Until solution turned cloudy, cannot see kind of a grain.Put into whizzer 12000rpm, 4 DEG C, centrifugal 30min;
(2) centrifugal rear solution is divided into three layers, and namely top layer is white oil layer, middle layer liquid, and bottom sediment.Upper strata oil body fraction and liquid portion are mixed, whole sucking-off, note not sucking-off bottom sediment, the liquid rotating of sucking-off is moved in another centrifuge tube, adds BufferB, centrifugal 18000rpm, 4 DEG C, 10min, repeat 1,2 steps, 3 ~ 4 times.
(3) the Buffer C liquid of the centrifugal rear sucking-off of repetition 1,2 step being added 500 μ l mixes, 4 DEG C in centrifuges, 18000rpm, centrifugal 10min.
(4) be divided into two-layer after now centrifugal, be upper strata oil fraction and lower floor's liquid portion, by lower floor's liquid sucking-off, discard.Repeat 3,4 steps again, 3 ~ 4 times.
Buffer A：0.6M Sucrose，0.5M NaCl，0.05M Tris-HCl(pH=7.0)；
Buffer B：0.4M Sucrose，0.5M NaCl，0.05M Tris-HCl(pH=7.0)；
Buffer C：20 mM Na
2HPO
4，20 mM NaCl(pH=7.0)。
embodiment 12 facial treatment milk recipe determination
A kind of facial treatment milk containing activities of epidermal growth factor polypeptide, be made up of the raw material of following weight part: 5%-25% wetting Agent for Printing Inks (safflower oil bodies), 10% glycerine, 10%-25% emulsifying agent (carboxyethyl cellulose), 1.5%-6% coupler (PEG600), 0.05%-0.5% sanitas (Tegosept M and propylben mixed solution), 1%-10% nutritional additive (the Arabidopis thaliana oil body containing egf protein) and 5%-20% vitamins C, appropriate amount of essence, all the other are deionized water, the present invention devises orthogonal experiment, by stability experiment and Activity determination, determine that best emulsion formulations is 10% oiliness raw material (safflower oil bodies), 10% glycerine, 10% emulsifying agent (carboxyethyl cellulose), 3% coupler (PEG600), 0.25% sanitas (Tegosept M and propylben mixed solution), 0.5% essence, 6% nutritional additive (the Arabidopis thaliana oil body containing egf protein), 5% vitamins C.
embodiment 13 facial treatment milk preparation method
The present invention prepares a kind of preparation method containing activities of epidermal growth factor polypeptide facial treatment milk, comprises the following steps and is prepared: first extracted by vegetable oils, then join in oil body by water, mix; Then add glycerine and emulsifying agent carboxyethyl cellulose step by step, coupler PEG600, stirs, and high-shear is emulsified at 1000rpm-30000rpm, emulsification 10-20min in clarifixator; Finally, add the mixed solution of sanitas Tegosept M and propylben and nutritional additive after stirring again and contain the vegetable oils of activities of epidermal growth factor polypeptide and vitamins C and Stigma Croci essence, after stirring product of the present invention.
embodiment 14 facial treatment milk stability experiment
(1) in 40 DEG C of electro-heating standing-temperature cultivators, place 30-50 days, observe after recovering room temperature, demixing phenomenon, does not have good stability;
Within (2) 24 hours, frequent variations back and forth between 0 DEG C-50 DEG C, repeatable operation 15-30 days like this, observes after recovering room temperature, does not have demixing phenomenon, have good stability;
(3) in the electro-heating standing-temperature cultivator of-5 DEG C of refrigerators and 40 DEG C, respectively put 1 day, repeatable operation 5-7 days like this, observe after recovering room temperature, do not occur demixing phenomenon, have good stability;
(4) in the electro-heating standing-temperature cultivator of 40 DEG C, place 5-7 days, then in 0 DEG C of-5 DEG C of refrigerator, place 5-7 days, the electro-heating standing-temperature cultivator next putting into 40 DEG C-50 DEG C is again placed 30 days, observes, have good stability after recovering room temperature.
By above-mentioned experimental observation, oiliness raw material 10%, glycerine 10%, emulsifying agent 10%, coupler 3%, sanitas 0.25%, essence 0.5%, nutritional additive 6%, vitamins C 5%, the stability of this emulsion formulations is better.
embodiment 15 facial treatment milk effect containing Urogastron oil body
First carry out anti-oxidation efficacy detection to facial treatment milk, select the scavenging(action) of pyrogallol method detection to ultra-oxygen anion free radical, crystal violet method detects the scavenging(action) to light free radical, and DPH method detects the scavenging(action) to total free radical.
Then white-skinned face function is detected, adopt tyrosine inhibiting AChE, get 4 test tubes and be numbered C 1, C2, T1, T2 respectively, in each pipe, corresponding reagent is added according to the order of table 1, C1, T1 first put into 37 DEG C of water-bath 10min before adding tyrosine oxidase, and then added tyrosine oxidase, then C1, C2, T1, T2 were jointly put into and jointly put into 37 DEG C of water-bath 10min, take out measure the absorbance of each pipe of C1, C2, T1, T2 at 475nm place respectively, do three times parallel.
Above-mentioned this method is adopted to measure the clearance rate of the ultra-oxygen anion free radical of the skin care product of following different ingredients, Scavenging action to hydroxyl free radical, total free radical scavenging activity, tyrosinase inhibition rate.
Composition 1(the present invention): oiliness raw material (safflower oil bodies) 10%, glycerine 10%, emulsifying agent (carboxyethyl cellulose) 10%, coupler (PEG600) 3%, sanitas (Tegosept M and propylben mixed solution) 0.25%, essence (Stigma Croci essence) 0.5%, nutritional additive (the Arabidopis thaliana oil body containing 324.36ng egf protein) 6%, vitamins C 5%;
Composition 2: oiliness raw material (safflower oil bodies) 10%, glycerine 10%, emulsifying agent (carboxyethyl cellulose) 10%, coupler (PEG600) 3%, sanitas (Tegosept M and propylben mixed solution) 0.25%, essence (Stigma Croci essence) 0.5%, vitamins C 5%;
Composition 3: oiliness raw material (glycerine) 20%, emulsifying agent (carboxyethyl cellulose) 10%, coupler (PEG600) 3%, sanitas (Tegosept M and propylben mixed solution) 0.25%, essence (Stigma Croci essence) 0.5%, nutritional additive (the Arabidopis thaliana oil body containing 324.36ng egf protein) 6%, vitamins C 5%;
Composition 4: oiliness raw material (glycerine) 20%, emulsifying agent (carboxyethyl cellulose) 10%, coupler (PEG600) 3%, sanitas (Tegosept M and propylben mixed solution) 0.25%, essence (Stigma Croci essence) 0.5%, nutritional additive (324.36ngEGF lyophilized powder) 6%, vitamins C 5%;
Compare the clearance rate of skin care product to ultra-oxygen anion free radical of these four kinds of compositing formulas, Scavenging action to hydroxyl free radical, total free radical scavenging activity, tyrosinase inhibition rate, result is as follows.
the percutaneous absorption rate of embodiment 16 containing epithelical cell growth factor oil body skin care product
First be placed in acceptance pool by magnetic stick, then the rat skin in vitro of preparation is lain in acceptance pool upper end, release pond clip upwards, is then fixed in acceptance pool by stratum corneum side.Get and detect medicine 0.2ml uniform application on keratoderma, inject acceptance pool with syringe by stopple coupon acceptable solution, emptying air, makes skin another side and acceptable solution close contact.The electrode of low frequency electromagnetic composite pulse instrument is fixed on the mouse epidermis face of instrument group and short group thoroughly.Constant speed stirs, respectively at 1,2,4,8,16h extracts acceptable solution 1.0ml, then adds the fresh acceptable solution of 1.0ml.In experiment, the volume of diffusion cell used is 7.0ml, and sampling amount is 1.0ml, and infiltrating area is 2.92cm
2, according to oil body content and the EGF content of each compositing formula in the transdermal acceptable solution recorded, add up infiltration capacity (Q) according to following formulae discovery:
<110> Jilin Agriculture University
The vegetable oils facial treatment milk of <120> mono-kind containing activities of epidermal growth factor polypeptide
<160> 1
<210> 1
<211> 165
<212> DNA
<213> is artificial
<400> 1
atgaattcag actctgaatg tcctctgtcc cacgatggtt actgtttaca cgatggtgtg 60
tgtatgtaca ttgaagctct ggacaagtac gcttgtaact gtgtcgtcgg ttacatcggt 120
gagagatgtc agtacagaga cctgaagtgg tgggaactga gataa 165
<210> 2
<211> 1548
<212> DNA
<213> is artificial
<400> 2
gaattcattg tactcccagt atcattatag tgaaagtttt ggctctctcg ccggtggttt 60
tttacctcta tttaaagggg ttttccacct aaaaattctg gtatcattct cactttactt 120
gttactttaa tttctcataa tctttggttg aaattatcac gcttccgcac acgatatccc 180
tacaaattta ttatttgtta aacattttca aaccgcataa aattttatga agtcccgtct 240
atctttaatg tagtctaaca ttttcatatt gaaatatata atttacttaa ttttagcgtt 300
ggtagaaagc ataatgattt attcttattc ttcttcatat aaatgtttaa tatacaatat 360
aaacaaattc tttaccttaa gaaggatttc ccattttata ttttaaaaat atatttatca 420
aatatttttc aaccacgtaa atctcataat aataagttgt ttcaaaagta ataaaattta 480
actccataat ttttttattc gactgatctt aaagcaacac ccagtgacac aactagccat 540
ttttttcttt gaataaaaaa atccaattat cattgtattt tttttataca atgaaaattt 600
caccaaacaa tcatttgtgg tatttctgaa gcaagtcatg ttatgcaaaa ttctataatt 660
cccatttgac actacggaag taactgaaga tctgctttta catgcgagac acatcttcta 720
aagtaatttt aataatagtt actatattca agatttcata tatcaaatac tcaatattac 780
ttctaaaaaa ttaattagat ataattaaaa tattactttt ttaattttaa gtttaattgt 840
tgaatttgtg actattgatt tattattcta ctatgtttaa attgttttat agatagttta 900
aagtaaatat aagtaatgta gtagagtgtt agagtgttac cctaaaccat aaactataag 960
atttatggtg gactaatttt catatatttc ttattgcttt taccttttct tggtatgtaa 1020
gtccgtaact ggaattactg tgggttgcca tggcactctg tggtcttttg gttcatgcat 1080
ggatgcttgc gcaagaaaaa gacaaagaac aaagaaaaaa gacaaaacag agagacaaaa 1140
cgcaatcaca caaccaactc aaattagtca ctggctgatc aagatcgccg cgtccatgta 1200
tgtctaaatg ccatgcaaag caacacgtgc ttaacatgca ctttaaatgg ctcacccatc 1260
tcaacccaca cacaaacaca ttgccttttt cttcatcatc accacaacca cctgtatata 1320
ttcattctct tccgccacct caatttcttc acttcaacac acgtcaacct gcatatgcgt 1380
gtcatcccat gcccaaatct ccatgcatgt tccaaccacc ttctctctta tataatacct 1440
ataaatacct ctaatatcac tcacttcttt catcatccat ccatccagag tactactact 1500
ctactactat aataccccaa cccaactcat attcaatact actctact 1548
<210> 3
<211> 1220
<212> DNA
<213> is artificial
<400> 3
aataagtatg aactaaaatg catgtaggtg taagagctca tggagagcat ggaatattgt 60
atccgaccat gtaacagtat aataactgag ctccatctca cttcttctat gaataaacaa 120
aggatgttat gatatattaa cactctatct atgcacctta ttgttctatg ataaatttcc 180
tcttattatt ataaatcatc tgaatcgtga cggcttatgg aatgcttcaa atagtacaaa 240
aacaaatgtg tactataaga ctttctaaac aattctaact ttagcattgt gaacgagaca 300
taagtgttaa gaagacataa caattataat ggaagaagtt tgtctccatt tatatattat 360
atattaccca cttatgtatt atattaggat gttaaggaga cataacaatt ataaagagag 420
aagtttgtat ccatttatat attatatact acccatttat atattatact tatccactta 480
tttaatgtct ttataaggtt tgatccatga tatttctaat attttagttg atatgtatat 540
gaaagggtac tatttgaact ctcttactct gtataaaggt tggatcatcc ttaaagtggg 600
tctatttaat tttattgctt cttacagata aaaaaaaaat tatgagttgg tttgataaaa 660
tattgaagga tttaaaataa taataaataa taaataacat ataatatatg tatataaatt 720
tattataata taacatttat ctataaaaaa gtaaatattg tcataaatct atacaatcgt 780
ttagccttgc tggacgactc tcaattattt aaacgagagt aaacatattt gactttttgg 840
ttatttaaca aattattatt taacactata tgaaattttt tttttttatc ggcaaggaaa 900
taaaattaaa ttaggaggga caatggtgtg tcccaatcct tatacaacca acttccacag 960
gaaggtcagg tcggggacaa caaaaaaaca ggcaagggaa attttttaat ttgggttgtc 1020
ttgtttgctg cataatttat gcagtaaaac actacacata acccttttag cagtagagca 1080
atggttgacc gtgtgcttag cttcttttat tttatttttt tatcagcaaa gaataaataa 1140
aataaaatga gacacttcag ggatgtttca acccttatac aaaaccccaa aaacaagttt 1200
cctagcaccc taccaactaa 1220
<210> 4
<211> 762
<212> DNA
<213> is artificial
<400> 4
atggcggata cagctagagg aacccatcac gatatcatcg gcagagacca gtacccgatg 60
atgggccgag accgagacca gtaccagatg tccggacgag gatctgacta ctccaagtct 120
aggcagattg ctaaagctgc aactgctgtc acagctggtg gttccctcct tgttctctcc 180
agccttaccc ttgttggaac tgtcatagct ttgactgttg caacacctct gctcgttatc 240
ttcagcccaa tccttgtccc ggctctcatc acagttgcac tcctcatcac cggttttctt 300
tcctctggag ggtttggcat tgccgctata accgttttct cttggattta caagtaagca 360
cacatttatc atcttacttc ataattttgt gcaatatgtg catgcatgtg ttgagccagt 420
agctttggat caattttttt ggtcgaataa caaatgtaac aataagaaat tgcaaattct 480
agggaacatt tggttaacta aatacgaaat ttgacctagc tagcttgaat gtgtctgtgt 540
atatcatcta tataggtaaa atgcttggta tgatacctat tgattgtgaa taggtacgca 600
acgggagagc acccacaggg atcagacaag ttggacagtg caaggatgaa gttgggaagc 660
aaagctcagg atctgaaaga cagagctcag tactacggac agcaacatac tggtggggaa 720
catgaccgtg accgtactcg tggtggccag cacactactt aa 762
<210> 5
<211> 924
<212> DNA
<213> is artificial
<400> 5
atggcggata cagctagagg aacccatcac gatatcatcg gcagagacca gtacccgatg 60
atgggccgag accgagacca gtaccagatg tccggacgag gatctgacta ctccaagtct 120
aggcagattg ctaaagctgc aactgctgtc acagctggtg gttccctcct tgttctctcc 180
agccttaccc ttgttggaac tgtcatagct ttgactgttg caacacctct gctcgttatc 240
ttcagcccaa tccttgtccc ggctctcatc acagttgcac tcctcatcac cggttttctt 300
tcctctggag ggtttggcat tgccgctata accgttttct cttggattta caagtaagca 360
cacatttatc atcttacttc ataattttgt gcaatatgtg catgcatgtg ttgagccagt 420
agctttggat caattttttt ggtcgaataa caaatgtaac aataagaaat tgcaaattct 480
agggaacatt tggttaacta aatacgaaat ttgacctagc tagcttgaat gtgtctgtgt 540
atatcatcta tataggtaaa atgcttggta tgatacctat tgattgtgaa taggtacgca 600
acgggagagc acccacaggg atcagacaag ttggacagtg caaggatgaa gttgggaagc 660
aaagctcagg atctgaaaga cagagctcag tactacggac agcaacatac tggtggggaa 720
catgaccgtg accgtactcg tggtggccag cacactacta tgaattcaga ctctgaatgt 780
cctctgtccc acgatggtta ctgtttacac gatggtgtgt gtatgtacat tgaagctctg 840
gacaagtacg cttgtaactg tgtcgtcggt tacatcggtg agagatgtca gtacagagac 900
ctgaagtggt gggaactgag ataa 924
Claims (7)
1. an expression vector plasmid
pOBT-eGF, it is prepared by following method:
1) take p1301 as basic framework, its T-DNA district is transformed, except the NOS gene remaining with T-DNA district, all the other genes are all replaced by 35S and Bar gene: with pEGAD plasmid for template, 35S-F upstream primer CGGGGTACCATCCGTCAACATGGTGGAGCACGACACGCTTGTCTACT and Bar-R downstream primer CGGAATTCACTAGTTCAGATCTCGGTGACGGGCAGGACCGGACGGGGCGGAACC is utilized to carry out PCR, amplification obtains 35S-Bar gene, before utilizing kpnI and SpeI restriction enzyme site to be inserted into the NOS gene in pCAMBIA1301 carrier T-DNA district, construct the basic plasmid of p1301-35S-Bar-NOS, be abbreviated as pO plasmid,
2) with pstI with NcoI respectively enzyme cut and be connected gene shown in pO plasmid and sequence table SEQ ID NO.2, obtain intermediate carrier pOB;
3) with Hind III and kpnI respectively enzyme cut and be connected gene shown in intermediate carrier pOB and sequence table SEQ ID NO.3, obtain plant specific expression carrier pOBT;
4) with NcoI and Hind III respectively enzyme cut and connect gene shown in plant specific expression carrier pOBT and sequence table SEQ ID NO.5, obtain expression vector plasmid pOBT-EGF
.
2. the vegetable oils containing activities of epidermal growth factor polypeptide, it is converted in oil crops by a kind of expression vector plasmid pOBT-EGF according to claim 1, results Extraction oil of seed body.
3. a kind of vegetable oils containing activities of epidermal growth factor polypeptide according to claim 2, is characterized in that: described oil crops are Arabidopis thaliana.
4. the facial treatment milk containing activities of epidermal growth factor polypeptide, it comprises the weight percent of following component: 5%-25% safflower oil bodies, 10% glycerine, 10%-25% carboxyethyl cellulose, 1.5%-6% PEG600,0.05%-0.5% sanitas, the Arabidopis thaliana oil body containing activities of epidermal growth factor polypeptide in 1%-10% claim 2 and 5%-20% vitamins C, surplus is deionized water.
5. a kind of facial treatment milk containing activities of epidermal growth factor polypeptide according to claim 4, it is characterized in that: 10% safflower oil bodies, 10% glycerine, 10% carboxyethyl cellulose, 3% PEG600,0.25% sanitas, 0.5% essence, 6% containing the Arabidopis thaliana oil body of activities of epidermal growth factor polypeptide, 5% vitamins C.
6. a kind of facial treatment milk containing activities of epidermal growth factor polypeptide according to claim 4 or 5, is characterized in that: described sanitas is Tegosept M and propylben mixed solution.
7. the preparation method of the vegetable oils facial treatment milk containing activities of epidermal growth factor polypeptide, comprise the following steps: by a kind of facial treatment milk containing activities of epidermal growth factor polypeptide according to claim 4, the weight percent of described component, first water is joined in safflower oil bodies, mix; Then add glycerine and carboxyethyl cellulose step by step, coupler PEG600, stirs, and high-shear is emulsified at 1000rpm-30000rpm, emulsification 10-20min in clarifixator; Add sanitas, a kind of vegetable oils and vitamins C containing activities of epidermal growth factor polypeptide after stirring again, stir.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310287157.2A CN103343137B (en) | 2013-07-10 | 2013-07-10 | Vegetable oil body skin-care emulsion containing epidermal growth factor active polypeptide |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310287157.2A CN103343137B (en) | 2013-07-10 | 2013-07-10 | Vegetable oil body skin-care emulsion containing epidermal growth factor active polypeptide |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103343137A CN103343137A (en) | 2013-10-09 |
| CN103343137B true CN103343137B (en) | 2015-05-20 |
Family
ID=49277964
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310287157.2A Expired - Fee Related CN103343137B (en) | 2013-07-10 | 2013-07-10 | Vegetable oil body skin-care emulsion containing epidermal growth factor active polypeptide |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103343137B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103705415B (en) * | 2013-12-13 | 2015-10-28 | 华南理工大学 | A kind of epidermis of the mesoporous silicon containing carrying epidermal growth factor repairs breast and preparation method thereof |
| CN111269303A (en) * | 2020-02-14 | 2020-06-12 | 中国农业大学 | Protein IbEGF and related biological material and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101080492A (en) * | 2004-10-06 | 2007-11-28 | 赛姆生物系统遗传公司 | Methods for the modulation of oleosin expression in plants |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| MXPA03005548A (en) * | 2000-12-19 | 2004-04-20 | Sembiosys Genetics Inc | Methods for the production of multimeric proteins, and related compositions. |
| CN1986818B (en) * | 2006-12-25 | 2010-09-08 | 吉林农业大学 | Plant oil-body expression vector and process of expressing human epidermal growth factor with plant oil-body |
-
2013
- 2013-07-10 CN CN201310287157.2A patent/CN103343137B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101080492A (en) * | 2004-10-06 | 2007-11-28 | 赛姆生物系统遗传公司 | Methods for the modulation of oleosin expression in plants |
Non-Patent Citations (2)
| Title |
|---|
| VEGF基因油体表达系统构建及对拟南芥的遗传转化;李洪志等;《食品科学》;20101231;第31卷(第9期);144-149 * |
| 杨晶等.植物油体作为生物反应器的应用.《自主创新与持续增长第十一届中国科协年会论文集(3)》.2009,1899-1903. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103343137A (en) | 2013-10-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1824774B (en) | Culturing method of auxilliary bud less tobacco after topping | |
| CN104195098A (en) | Dendrobium officinale stem cell and isolated culture method thereof | |
| CN104603272A (en) | Cell capable of producing adeno-associated virus vector | |
| CN106279429A (en) | The stroma cell derivative factor being combined with collagen specificity and application thereof | |
| CN112724217B (en) | Sweet wormwood MYB transcription factor AaMYB108 and application thereof | |
| CN112251421B (en) | EZH2 variable shear body and application thereof | |
| CN111876394A (en) | Application of ascorbic acid oxidase RIP5 in regulation and control of drought resistance of rice | |
| CN103343137B (en) | Vegetable oil body skin-care emulsion containing epidermal growth factor active polypeptide | |
| CN103333915B (en) | A kind of vegetable oils facial treatment milk containing Prostatropin active polypeptide | |
| CN104274343A (en) | Recombinant collagen polypeptides containing vegetable oil body skin-care emulsion | |
| CN114525284B (en) | Red skin longan anthocyanin biosynthesis regulatory gene DlMYB1-HP and application thereof | |
| CN110777120B (en) | Application of TGFBI as marker for regulating and controlling mesenchymal stem cell adipogenic differentiation | |
| CN103343138B (en) | A kind of vegetable oils facial treatment milk containing acid fibroblast growth factor active polypeptide | |
| CN104342441B (en) | Plant non-endosperm expression promoter SAFE S1 and acquiring method thereof | |
| CN103320466B (en) | Vegetable oil body skin care lotion containing vascular endothelial growth factor active peptides | |
| CN103276002B (en) | Oil body containing oil body protein and collagen fusion protein | |
| CN106244598B (en) | Radix Notoginseng Dirigent albuminoid gene PnDIR1 and application | |
| CN107119020A (en) | A kind of hepatic injury targeting mescenchymal stem cell based on miR 9 and preparation method and application | |
| CN103468737B (en) | A kind of vegetable oils containing keratinocyte growth factor KGF2 | |
| CN101851620B (en) | Method for producing FGFs by utilizing edible medicinal fungus | |
| CN104274336A (en) | Skin care emulsion serving as vegetable oil body and containing active peptides of coenzyme Q10 | |
| CN102747038B (en) | NOX4 knock-down A375 stably-transfected cell line and construction method thereof | |
| CN108588088A (en) | A kind of drought resisting transcription factor PbrERF109 and preparation method thereof, application and coding protein and application | |
| CN104388435A (en) | Construction and application of goat adiponectin gene eukaryotic expression vector | |
| CN115028700A (en) | Transcription factor for regulating and controlling formation of colors of melastoma plants as well as coding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Li Haiyan Inventor after: Qiang Weidong Inventor after: Zou Deyi Inventor after: Li Xiaokun Inventor after: Yang Jing Inventor after: Guan Lili Inventor after: Du Linna Inventor after: Guo Yongcuan Inventor after: Wang Yanfang Inventor after: Wang Fawei Inventor after: Wang Qingman Inventor before: Li Haiyan Inventor before: Dong Yuanyuan Inventor before: Liu Xiuming Inventor before: Wang Nan Inventor before: Yao Na Inventor before: Zhang Panli Inventor before: Li Xiaokun Inventor before: Yang Jing Inventor before: Guan Lili Inventor before: Jiang Chao Inventor before: Guo Yongcuan Inventor before: Wang Fawei Inventor before: Du Linna Inventor before: Wang Yanfang |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: INVENTOR; FROM: LI HAIYAN LI XIAOKUN YANG JING GUAN LILI JIANG CHAO GUO YONGXIN WANG FAWEI DU LINNA WANG YANFANG DONG YUANYUAN LIU XIUMING WANG NAN YAO NA ZHANG PANLI TO: LI HAIYAN LI XIAOKUN YANG JING GUAN LILI DU LINNA GUO YONGXIN WANG YANFANG WANG FAWEI WANG QINGMAN QIANG WEIDONG ZOU DEYI |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150520 Termination date: 20170710 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |