CN108588088A

CN108588088A - A kind of drought resisting transcription factor PbrERF109 and preparation method thereof, application and coding protein and application

Info

Publication number: CN108588088A
Application number: CN201810498908.8A
Authority: CN
Inventors: 张绍铃; 胡轼; 黄小三; 赵梁怡; 邢才华; 董慧珍; 高俊芝; 刘月; 李凌; 陶书田
Original assignee: Nanjing Agricultural University
Current assignee: Nanjing Agricultural University
Priority date: 2018-05-23
Filing date: 2018-05-23
Publication date: 2018-09-28
Anticipated expiration: 2038-05-23
Also published as: CN108588088B

Abstract

The present invention provides a kind of drought resisting transcription factor PbrERF109 and preparation method, the protein of application and coding and applications, belong to field of plant genetic, have nucleotide sequence shown in ESQ ID No.1.Drought resisting transcription factor PbrERF109 is transferred in tobacco and Ussurian pear by the present invention, obtained transgenosis overexpression strain drought-resistant ability compared with compareing wild type has very big promotion, the content of hydrogen peroxide and malonaldehyde is intended to lower than wild type in the transgenosis overexpression strain of tobacco, plant activity in vivo oxygen residual is lower, cellular damage smaller, and then improve the drought-resistant ability of tobacco and Ussurian pear plant.

Description

A kind of drought resisting transcription factor PbrERF109 and preparation method thereof, application and coding egg White matter and application

Technical field

The invention belongs to plant genetic engineering fields, and in particular to a kind of drought resisting transcription factor PbrERF109 and its preparation Method, the protein of application and coding and application.

Background technology

Plant is frequently encountered some environment stresses in growth periodic process, including biotic stress stress and abiotic Environment stress, abiotic stress include mainly arid, high temperature, low temperature, heavy metal stress etc., and wherein arid is to influence plant Growth and development, yield and quality and limitation Plant geographics distribution an important factor for one of.It is now clear that plant is in arid It can survive under stress, depend on the adaptive change in internal metabolism and plant forms, including generate a system Row biochemical reactions cope with drought stress, this adaptation process to establish the defense attitude of a system, in many levels The expression of the gene of middle many response drought stresses is by regulation and control (Pastori and Foyer, 2002).People participate in identification Significant progress is had been achieved in the Signal Transduction Components of stress response response.

So far, participate in enhancing plant stress resistance or many key genes of tolerance be verified, and these one As be divided into two types.One kind is to avoid cell from being forced the functional protein composition of injury by directly playing a role, another kind of Be made of the modulin of Regulate signal transduction and gene expression process (Chaves et al., 2003；Shinozaki et al.,2003；Yamaguchi-Shinozaki and Shinozaki,2005；Bartels and Sunkar,2005).In people Study environment stress during, the transfer-gen plant that resistance enhancing is createed by transgenosis is excellent research material (Ward and Schroeder,1994；Klein et al.,2004；Shinozaki and Yamaguchi-Shinozaki, 2007).Some researches show that can significantly improve the resistance of plant by overexpression regulatory factor and functional gene.And work( Can gene and transcription factor constructive expression result can variant (Agarwal et al., 2006), transcription factor is carrying Effect in terms of high stress resistance of plant will be better than functional gene.One transcription factor can be to a series of expression water of downstream genes Show no increases in output raw regulating and controlling effect, to played jointly in a variety of abiotic stress (including arid) resistance (Century et al., 2008；Yang et al.,2011).Therefore, transcription factor genetic transformation is a kind of important channel of plant resistance to environment stress genetic improvement And means.

There are numerous transcription factors in Plant Genome, (Ethylene responsive factors, ethylene are rung ERF Answer the factor) class transcription factor is important member indispensable in regulated and control network, such transcription factor family proteins have AP2/ ERF structural domains, the structural domain are composed of the antiparallel beta sheet structure of an alpha-helix and 3.Alpha-helix passes through Hydrophobic side is interacted with DNA major grooves so that being combined with DNA, and the effect of beta sheet is the promoter member of identifying purpose gene Part, wherein the 14th of second beta sheet and the 19th amino acids residue determine that the combination of ERF class transcription factors is anisotropic (Okamuro et al.,1997).ERF transcription is widely present in plant, for example is had respectively in arabidopsis and rice 147 and 157 genes (Jofuku et al., 1994；Nakano et al.,2006).Since ERF classes transcription factor is only deposited It is in plant, so the research to it is relatively extensive.Existing report indicates, ERF transcription to the seed of plant, Root, leaf and the growth and development of organs such as spend all to have certain effect (Xie et al., 2017).Some ERF albumen, for example, The ERF1 genes (TaPIE1) that cause of disease induces in wheat can respond Ethylene Signal and activate downstream defence and stress-related genes, right Plant necrotrophic rhizoctonia (Rhizoctonia cerealis) is infected plays forward direction with the repellence of cold shut stress The effect (Zhu et al., 2014) of adjusting.Ethylene and ABA signals can be with the GhERF4 genes in inducing cotton, and in cotton (Jin and Liu, 2008) is played a key effect in reply abiotic stress.But not report ERF transcriptions in the prior art The factor can be drought-resistant.

Invention content

In view of this, the purpose of the present invention is to provide a kind of drought resisting transcription factor PbrERF109, the drought resisting transcription because Sub- PbrERF109 can improve the drought-resistant ability of plant.

In order to achieve the above-mentioned object of the invention, the present invention provides following technical scheme：

The present invention provides a kind of drought resisting transcription factor PbrERF109, have nucleotides sequence shown in ESQ ID No.1 Row.

The present invention also provides the protein of the drought resisting transcription factor PbrERF109 codings described in above-mentioned technical proposal to have Amino acid sequence shown in SEQ IDNo.2.

The present invention also provides the preparation methods of the drought resisting transcription factor PbrERF109 described in above-mentioned technical proposal, including Following steps：

Using pears cDNA as masterplate, PCR amplification is carried out with transcription factor primer pair, obtains drought resisting transcription factor PbrERF109；

The transcription factor primer pair includes transcription factor sense primer and transcription factor downstream primer, the transcription factor There is sense primer nucleotide sequence shown in SEQ ID No.3, the transcription factor downstream primer to have SEQ ID No.4 institutes The nucleotide sequence shown.

Preferably, the every 50 μ l of system that the PCR amplification uses include：100ng pears cDNA, 10 μ l Q5Reaction Buffer, 1 μ l 10mM dNTP, 0.5 μ l Taq polymerases, 2.5 μ l, 10 μM of transcription factor sense primers, 10 μM of 2.5 μ l turn Record factor downstream primer, surplus ddH₂O；

The condition of the PCR amplification includes：98 DEG C of pre-degenerations 30 seconds；98 DEG C are denaturalized 10 seconds, and 65 DEG C are annealed 30 seconds, and 72 DEG C are prolonged It stretches 30 seconds, 35 cycles；Extend 2 minutes for 72 DEG C after the completion of cycle.

The present invention also provides the drought resisting transcription factor PbrERF109 or described protein described in above-mentioned technical proposal to carry Application in high plant drought ability.

Preferably, the plant includes tobacco or pears.

Preferably, when the plant is tobacco, the method for the drought-resistant ability for improving tobacco includes the following steps：

The drought resisting transcription factor PbrERF109 and pEASY-T1 cloning vectors are attached, recombinant vector is obtained；

The recombinant vector is transferred in Agrobacterium tumefaciems, recombination Agrobacterium tumefaciems is obtained；

The recombinational agrobacterium is infected into tobacco.

Preferably, the every 5 μ l of total system of the pEASY-T1 cloning vectors connection include：4 μ l drought resisting transcription factors PbrERF109 and 1 μ lpEASY-T1 cloning vectors, the drought resisting transcription factor PbrERF109 and pEASY-T1 cloning vectors Molar ratio is 3:1；

The condition of the connection includes：30min is reacted at 25 DEG C.

Preferably, when the plant is pears, the method for the drought-resistant ability for improving pears includes：Using instantaneous conversion side The drought resisting transcription factor PbrERF109 is transferred in pears by method.

The activity of transfer-gen plant can effectively be enhanced after drought resisting transcription factor PbrERF109 expression provided by the invention Oxygen scavenging capacity, and then the drought-resistant ability of plant can be improved.

Result according to the ... of the embodiment of the present invention is shown：The present invention by drought resisting transcription factor PbrERF109 be transferred to tobacco and In Ussurian pear, obtained transgenosis overexpression strain drought-resistant ability compared with compareing wild type has very big promotion, tobacco to turn The content of hydrogen peroxide and malonaldehyde is intended to lower than wild type in gene overexpression strain, and plant activity in vivo oxygen remains more It is low, cellular damage smaller, and then improve the drought-resistant ability of tobacco and Ussurian pear plant.

Description of the drawings

Fig. 1 is the techniqueflow chart of the present invention；

Fig. 2 is expression of the PbrERF109 genes of the present invention under dehydration, abscisic acid and 4 DEG C of low temperature stress；

Fig. 3 is the PbrERF109 gene subcellular localizations of the present invention, wherein：Fig. 3-A, GFP genes (control) are in light field Imaging under (in figure), ultraviolet (figure is left), figure (right side) are the imaging after the two superposition；Fig. 3-B, PbrERF109 genes exist Light field (in), the imaging under UV light (left side), figure (right side) both is the imaging after being superimposed；

Fig. 4 is the PbrERF109 gene transcriptional activations identification of the present invention, Fig. 4 pGBKT7^TMIt is that the yeast that empty carrier converts exists Growing state on different culture media；pGBKT7^TM- PbrERF109 is the yeast of fusion vector conversion on different culture media Growing state；

Fig. 5 is pCAMBIA1301 plasmid maps；

Fig. 6 is the plant overexpression vector structure flow chart of PbrERF109 genes；

Fig. 7 is PbrERF109 transformation of tobacco and plant regeneration process schematic；

Fig. 8 is a kind of PCR identification schematic diagrames of PbrERF109 gene transgenics plant, and Fig. 8-A utilize PbrERF109 bases Because of T after special primer progress PCR identification tobaccos₁For transfer-gen plant, M：M aker, P：Plasmid pCAMBIA1301- PbrERF109, WT：WT lines, 1,2,3 ..., 7,8：Transgenic line；Fig. 8-B are external sources in Transgenic Tobacco plant The expression analysis of gene PbrERF109, WT are wild type, other to be used as transgenosis system；

Fig. 9 is that embodiment turns PbrERF109 genes strain (OE5 and OE8) and wild type (WT) non-transgenic in the present invention Phenotype and physiological index determining before and after plant (WT) Osmotic treatment, wherein Fig. 9-A are that 30 -day-old of tobacco plant is normally watering 3 days and 20 days phenotypes of Osmotic treatment；Fig. 9 B-E are 30 -day-old of tobacco plants in normal watering 3 days and Osmotic treatment 20 days Survival rate, percentage of water loss, conductivity and chlorophyll content statistics；

Figure 10 is that embodiment turns PbrERF109 genes strain (OE5 and OE8) and wild type (WT) non-transgenic in the present invention H is analyzed in histochemical stain after plant (WT) Osmotic treatment₂O₂And O^2-The measurement result figure of accumulation and mda content；Figure 10, A-B be 30 -day-old of tobacco plant unconverted plant and two transgenic lines after normal watering 3 days and Osmotic treatment 20 days It is active oxygen histochemical stain figure, using diaminobenzidine and nitro tetrazole respectively to H₂O₂(Figure 10-A) and O^2-(figure 10-B) dyed；Figure 10-C：For cell death colored graph after the processing of transgene tobacco drought stress.Figure 10 D are transgenosis cigarettes Mda content measurement chart after careless drought stress processing.

Specific implementation mode

The present invention provides a kind of drought resisting transcription factor PbrERF109, have nucleotides sequence shown in ESQ ID No.1 Row.In the present invention, the drought resisting transcription factor PbrERF109 can improve the drought-resistant ability of plant.In the present invention, described The overall length of drought resisting transcription factor PbrERF109 is 795bp, includes the open reading frame of 795bp, encodes 264 amino acid, waits electricity Point is 5.99, molecular weight 28.9KDa.

In the present invention, the drought resisting transcription factor PbrERF109 has nucleotide sequence shown in ESQ ID No.1, Particular sequence is as follows：

atgcccttccatgcgaatcggatacaacaggagcaggagcactgcatcatggtctccgccctcaagcacgtaatctc cggtggaagcatcagtgggcccacacctcagccaatgccggcggtctacaatgccacgtcatccgtctcgacgagcg gcacccagttggcagcgggccaaccagcacaacaggacaactacttctcgccatcgttgccgaatcaaaacaggaac cagcaactgagtttgggaaccgggtttgtcgggatgaatgcgccaactacgaggaagagcaagaacaagtacagggg cgtcaggcagaggccgtgggggaaatgggcggcggagattcgagacccacgacgggcggcgagggtgtggctaggga cgttcgagacggcggaggacgcggccagggcttacgacaaggccgccgtcgagttccgcggaaataaggcaaagctc aatttcccatcggacccgggcggtcacattgtcacgactaacgacagttctagtagtggaactagtgctaatgccag tattaatccaggattaattaataagcaaaagcaaaagaatattagcgaaattggggtcatggagaaggaggaggaga aggttgatcaggtcaaactcaaccaggcgacgcagccggagaatatgcaactgggggtggtggcgaccgcggagagc agcgttggtcatgaggaggatgaccagttcttgttgtgggacaatggctggctccgagatggtgaagatgacgactt aatggcatggttatccacgaactag。

In the present invention, the preparation method of the drought resisting transcription factor PbrERF109, includes the following steps：

In the present invention, the preparation method of the pears cDNA preferably includes：RNA is extracted from birch-leaf pear blade, by what is obtained RNA reverse transcriptions obtain cDNA.The present invention is not particularly limited the method for the extraction RNA, normal using those skilled in the art The method of rule extraction plant RNA.

In the present invention, the transcription factor PbrERF109 preferably derives from birch-leaf pear (Pyrus Bretschneideri), primer pair is designed according to the open reading frame of gene PbrERF109.In the present invention In, the transcription factor sense primer has nucleotide sequence shown in SEQ ID No.3, specific as follows：

5 '-GAAGATCTTATGCCCTTCCATGCGAATCGGATA-3 '；

The transcription factor downstream primer has nucleotide sequence shown in SEQ ID No.4, specific as follows shown：

5 '-GGGTNACCCCTAGTTCGTGGATAACCA-3 '.

In the present invention, the every 50 μ l of system that the PCR amplification uses are preferably included：100ng pears cDNA, 10 μ l Q5Reaction Buffer, 1 μ l 10mM dNTP, 0.5 μ l Taq polymerases, 2.5 μ l, 10 μM of transcription factor sense primers, 2.5 10 μM of μ l transcription factor downstream primers, surplus ddH₂O.In the present invention, the Q5Reaction Buffe and Taq are poly- NEB company of the preferred purchase of synthase in the place of production in the U.S..

In the present invention, the enzyme activity of the Taq polymerase is preferably 1U.

In the present invention, the condition of the PCR amplification preferably includes：98 DEG C of pre-degenerations 30 seconds；98 DEG C are denaturalized 10 seconds, 65 DEG C Annealing 30 seconds, 72 DEG C extend 30 seconds, 35 cycles；Extend 2 minutes for 72 DEG C after the completion of cycle.

The drought resisting transcription factor PbrERF109 or the protein obtained the present invention also provides above-mentioned technical proposal exists Improve the application in plant drought ability.In the present invention, the specific mode for improving plant drought ability is that structure turns base Because of plant, the drought resisting transcription factor PbrERF109 is transferred in plant.

In the present invention, the plant preferably includes tobacco or pears, and the pears are preferably Ussurian pear.

In the present invention, when the plant is tobacco, the method for the drought-resistant ability for improving tobacco is that structure turns base Because of tobacco, following steps are specifically included：

The recombinational agrobacterium is infected into tobacco.

In the present invention, the every 5 μ l of total system of the pEASY-T1 cloning vectors connection are preferably included：4 μ l drought resistings are transcribed Factor PbrERF109 and 1 μ lpEASY-T1 cloning vectors, the drought resisting transcription factor PbrERF109 and pEASY-T1 clones carry The molar ratio of body is preferably 3:1.

In the present invention, the condition of the connection preferably includes：30min is reacted at 25 DEG C.

The present invention is not particularly limited the type of the carrier, is routinely selected using those skilled in the art, In embodiments of the present invention, the carrier is pEASY-T1.

The method that the present invention is transferred to the recombinant vector acquisition recombination Agrobacterium tumefaciems in Agrobacterium tumefaciems is not special It limits, the method that carrier is routinely transferred to Agrobacterium tumefaciems using those skilled in the art.

The method that the present invention infects the recombinational agrobacterium tobacco is not particularly limited, normal using those skilled in the art The method that rule recombinational agrobacterium infects tobacco.

In the present invention, when the plant is pears, the method for the drought-resistant ability for improving pears includes：Turned using instantaneous The drought resisting transcription factor PbrERF109 is transferred in pears by change method.

The present invention is not particularly limited the transient transformation methods of the use, is routinely selected using those skilled in the art Transient transformation methods.

The present invention also provides the protein of the drought resisting transcription factor PbrERF109 codings described in above-mentioned technical proposal to have Amino acid sequence shown in SEQ ID No.2, particular sequence are as follows：

Met Pro Phe His Ala Asn Arg Ile Gln Gln Glu Gln Glu His Cys Ile Met Val Ser Ala Leu Lys His Val Ile Ser Gly Gly Ser Ile Ser Gly Pro Thr Pro Gln Pro Met Pro Ala Val Tyr Asn Ala Thr Ser Ser Val Ser Thr Ser Gly Thr Gln Leu Ala Ala Gly Gln Pro Ala Gln GlnAsp Asn Tyr Phe Ser Pro Ser Leu Pro Asn Gln Asn Arg Asn Gln Gln Leu Ser Leu Gly Thr Gly Phe Val Gly Met Asn Ala Pro Thr Thr Arg Lys Ser Lys Asn Lys Tyr Arg Gly Val Arg Gln Arg Pro Trp Gly Lys Trp Ala Ala Glu Ile Arg Asp Pro Arg Arg Ala Ala Arg Val Trp Leu Gly Thr Phe Glu Thr Ala Glu Asp Ala Ala Arg Ala Tyr Asp Lys AlaAla Val Glu Phe Arg Gly Asn Lys Ala Lys Leu Asn Phe Pro Ser Asp Pro Gly Gly His Ile Val Thr Thr Asn Asp Ser Ser Ser Ser Gly Thr Ser Ala Asn Ala Ser Ile Asn Pro Gly Leu Ile Asn Lys Gln Lys Gln Lys Asn Ile Ser Glu Ile Gly Val Met Glu Lys Glu Glu Glu Lys Val Asp Gln Val Lys Leu Asn Gln Ala Thr Gln Pro Glu Asn Met Gln Leu Gly Val ValAla Thr Ala Glu Ser Ser Val Gly His Glu Glu Asp Asp Gln Phe Leu Leu Trp Asp Asn Gly Trp Leu Arg Asp Gly Glu Asp Asp Asp Leu Met Ala Trp Leu Ser Thr Asn。

With reference to embodiment to a kind of drought resisting transcription factor PbrERF109 provided by the invention and preparation method thereof, answer With with coding protein and application be described in detail, but they cannot be interpreted as the limit to the scope of the present invention It is fixed.

Embodiment 1

PbrERF109 gene diffusions are analyzed

Under arid dehydration cDNA is obtained from birch-leaf pear blade extracting RNA, reverse transcription.The present invention is obtaining the cNDA Afterwards, using the cDNA of acquisition as template, and drought resisting transcription factor PbrERF109 is obtained using idiosyncratic transcription factor primer pair, Particular sequence is as shown in SEQ ID No.1.

RNA extractions use Plant Total RNA Isolation Kit Plus (Foregene, RE-05022), according to The operational manual operation that the kit provides.The synthesis of first chain cDNA First S cript Strand cDNA Synthesis SuperMix (Transgene, AE301-02) reverse transcription reagent box (is grasped according to the specification that the kit provides Make).

The primer pair of amplification drought resisting transcription factor PbrERF109 is：Forward primer：PbrERF109Fo rward, 5 '- GAAGATCTTATGCCCTTCCATGCGAATCGGATA-3 ' (SEQ ID No.3)；Reverse primer：PbrERF109 Reverse, 5 '-GGGTNACCCCTAGTTCG TGGATAACCA-3 ' (SEQ ID No.4).

The reaction system of 50 μ l includes 100ng cDNA, 10 5 × buffer solutions of μ l (Q5Reaction B uffer), 1 μ l 10mM dNTP, 0.5 μ l 1U Taq polymerases (Q5High-Fidelity DNA Polymerase) (buffer prior and Taq Polymerase is purchased from NEB companies, the U.S.), the enzyme activity of each above-mentioned forward and reverse primers of 10 μM of 2.5 μ l, Taq polymerase is 1U.PCR is anti- It should be completed by following procedure on Veriti Thermal Cycler (Applide Biosystem) amplification instrument：98 DEG C of pre-degenerations 30 seconds；98 DEG C are denaturalized 10 seconds, and 65 DEG C are annealed 30 seconds, and 72 DEG C extend 30 seconds, 35 cycles；Extend 2 minutes for 72 DEG C after the completion of cycle. A single PCR bands product is generated, after 1% agarose gel electrophoresis, is usedDNA gel QIAquick Gel Extraction Kit (being purchased from Axygen companies, the U.S.) recycling specific band, extraction step are referred to explanation.

The DNA solution of recovery purifying is attached and reacts with pEASY-T1 carriers (being purchased from Quan Shi King Companies), by specification It operates, the molar ratio that PbrERF109 genes and pEASY-T1 carriers are inserted into coupled reaction system is 3:1 connection reaction total volume It is 5 μ l, including the PCR product of 4 μ l purifying, 1 μ l carrier Ts, 25 DEG C connect 30 minutes.

5 μ l connection products are taken, using thermal shock method (reference《Molecular cloning experiment handbook》The third edition, Science Press, 2002) bacillus coli DH 5 alpha, the screening positive clone in the LB solid plates containing 50mg/L kanamycins, picking 8 are converted Cloning and sequencing (is completed) by one of Nanjing bio tech ltd, and sequencing result shows that the present invention clones PbrERF109 genes Overall length is 795bp, is the target gene that the present invention needs by being sequenced, comparing determination, sequence, will as shown in SEQ ID No.1 This unnamed gene is PbrERF109, it include the coding reading frame of 795bp, 264 amino acid of coding, isoelectric point 5.99, Predicted molecular weight is 28.9KDa.BLASTX analyzes the sequence and known ERF1 09 (all documents and database delivered) Sequence homology.The amino acid sequence of the PbrERF109 genes of derivation and the apple (MdERF109, XP_008338309) of prediction Although sequence homology is up to 85%, the Unknown Function of this gene of apple MdERF109.Multiple Sequence Alignment result shows Pbr ERF109 has one section of conserved domain, AP2/ERF structural domains.SMART predicted amino acids PbrERF109 has 1 transcriptional activation region.

Whether arid, abscisic acid (ABA), low-temperature treatment are responded for analysis PbrERF109 genes, using glimmering in real time Fluorescent Quantitative PCR (forward primer PbrERF109-F1：5 '-AGCCGGAGAATATGCAACTG-3 ' (SEQ ID No.5)；Reversely Primer PbrERF109-R1：5 '-TGTCCCACAACAAGAACTGG-3 ' (SEQ ID No.6)) gene is observed in the different sides of body Compel the expression quantity situation under processing, to which which kind of clear stress is the strongest to gene PbrERF109 inductions.It is carried using CTAB methods RNA, the synthesis of the first chains of cDNA is taken to be carried out with reference to the operation manual of TOYOBO reverse transcription reagent box.In the reaction system of 20 μ l Have：10 μ l 2 × Mix, 0.1 μ l cDNA, 5 μ l primers (using Tublin as internal control primer, length 208), 4.9 μ l water.It is quantitative The program of PCR is as follows：

1 quantitative PCR program of table

When being carried out dehydrating to plant, as shown in Figure 2 A, the transcriptional levels of PbrERF109 genes is in plant by de- Transcriptional level is gradually increasing after water process, reaches highest when 0.5h, nearly 4 times when being untreated, is shown The dehydration of PbrERF109 gene pairs has strong response.When carrying out abscisic acid processing to plant, as shown in Figure 2 B, PbrERF109 The transcriptional level of gene transcriptional level after plant is handled by abscisic acid is gradually increasing, and is reached highest when 1h, is not When processing more than 3 times, showing PbrERF109 gene pairs abscisic acids has strong response.When to plant 4 DEG C of low-temperature treatments of progress When, as shown in Figure 2 C, the transcriptional level 6h of PbrERF109 genes has slow raising, is then gradually lowered to 72h, finally exists 144h gradually rises again.It is not changed significantly from 6h to 72h, is untreated more than 1 times, illustrate 4 DEG C of PbrERF109 gene pairs Low temperature responds unobvious.The result shows that arid dehydration can induce the gene expression, show that it is an arid answer candidate Gene.

Embodiment 2

PbrERF109 genes subcellular localization, transcriptional activation analysis

Since PbrERF109 genes are a transcription factors, the present invention studies PbrERF109 using tobacco mesophyll cell The subcellular localization of gene.The entire ORF reading frames of PbrERF109 genes are amplified using RT-PCR, and in its amplimer two End adds two restriction enzyme sites of XbaI and BamHI.Its amplimer is (forward primer PbrERF109-F2：5 '-TCTAGAATGCCCTTCCATGCGAATCGGATA-3 ' (SEQ ID No.11)；Reverse primer PbrERF109-R2：5 '-GGATCCCCTAGTTCGTGGATAACCA-3 ' (SEQ ID No.12)), amplified production is subjected to digestion first.In the present invention Described in the temperature of the drought-induced transcription factor PbrERF109 double digestions of pears be 37 DEG C, time of double digestion is 12h；Double digestion System total volume is 20 μ l, includes 10 μ l, 10 × G bufferings of purified product of the PCR of the drought-induced transcription factor PbrERF109 of pears Liquid 2 each 1 μ l of μ l, XbaI and BamHI, 6 μ l of distilled water.XbaI and BamHI double digestion pCAMBIA1302, recovery product are used simultaneously And connect, to obtain pCAMBIA1302-PbrERF109-GFP recombinant vectors, and it is transferred to Agrobacterium EHA105.Agriculture bar Bacterium infects tobacco mesophyll cell and carries out as follows：(1) Agrobacterium monoclonal is inoculated in 5ml LB/ on picking fresh culture Kan/Rif fluid nutrient mediums (kanamycins containing 50mg/L and 50mg/L rifampins), 28 DEG C cultivate 1-2 days, 220rpm/ minutes, Activate bacterium solution；(2) activation bacterium solution is taken, 50:1 is inoculated into (kanamycins containing 50mg/L in 50ml LB/Kan/Rif fluid nutrient mediums With 50mg/L rifampins), 28 DEG C are cultivated 8~12 hours, 220rpm/ minutes, bacterium solution OD600 are detected during culture and is arrived between 0.6 Between 0.8；(3) bacterium solution is transferred in 50ml centrifuge tubes, 4000rpm/ minutes, centrifuges 5 minutes, removes supernatant；(4) it is added Thalline is resuspended in 10ml cleaning solutions (10mM MES+10mM MgCl2), 4000rpm/ minutes, centrifuges 5 minutes, removes supernatant, then use 5ml Cleaning solution is repeated once, and is eventually adding 3ml cleaning solutions, is fully inhaled and is beaten mixing；(5) absorption resuspended bacterium solution, 19:1 is added cleaning solution In, measure OD₆₀₀；(6) injection combines for 5ml/, adjusts the final concentration OD of two kinds of bacterium solutions₆₀₀About 0.6, finally use cleaning solution It complements to 5ml, is added 5 μ l acetosyringones (acetosyringone, AS), after mixing, room temperature 2-3 hour is waited for and being noted It penetrates；(7) liquid will be infected to be packed into syringe (5ml), a combination injection 2-3 piece leaf, blade, which randomly selects, is distributed in different plants In strain, frame takes the blade being of moderate size, and pressing syringe will be in liquid injection to tobacco leaf lower epidermis；(8) after injecting, Tobacco is positioned at 25 DEG C and is cultivated, 48-72 hours；(9) respectively to the blade injector 4 ' of the two, 6- diamidino -2- phenyl Yin Diindyl carries out nuclear targeting, then uses laser confocal microscope (Zeiss LSM 710, Germany) visual report assignment of genes gene mapping feelings Condition, the results showed that, there is fluorescence in entire cell when control vector converts, as a result sees Fig. 3 A, and the cell of recombinant vector conversion Middle fluorescence can only be detected in the pigmented section of nucleus specific dye DAPI, as a result see Fig. 3 B, illustrate that PbrERF109 is one Nuclear locating sequence.

Embodiment 3

Plant Transformation overexpression vector is built

According to the enzyme on the coding region sequence of the multiple cloning sites (Fig. 5) of pCAMBIA1301 carriers and PbrERF109 genes Enzyme site is analyzed, and selects BglII and BsteII as restriction endonuclease.First by using the clone of PbrE RF109 genes as template into (amplimer is to forward primer for row PCR amplification：PbrERF109Forward, 5 '- GAAGATCTTATGCCCTTCCATGCGAATCGGATA-3 ' (SEQ ID No.3)；Reverse primer：PbrERF109Reverse, 5 '-GGGTNACCCCTAGTTCGTGGATAACCA-3 ' (SEQ ID No.4)), then by PCR product together with PCAMBIA1301 carriers carry out digestion at 37 DEG C together, and recycling is purified after 2~3h of digestion.It is added in coupled reaction system The ratio of the amount of the substance of PbrERF109 genes and carrier pCAMBIA1301 is 3:1, reaction total volume is 10 μ l.Wherein contain Have：10 × buffer, 1 μ l, T4DNA ligases, 1 μ l, the PbrWRKY53 gene 4ul of double digestion recycling, double digestion recycling 2 μ l of pCAMBIA1301 support products, 2 μ l of distilled water react 14-16h at 16 DEG C and obtain connection product.Connection product conversion is big Enterobacteria bacterial strain DH5 α, are screened in the LB solid plates containing 50mg/L kanamycins, select monoclonal PCR tests positives Afterwards extracting plasmid carry out digestion, be sequenced determine sequence it is errorless after, i.e., pCAMBIA1301-PbrERF109 construction of recombinant vector at Work(.Recombinant vector is imported in Agrobacterium tumefaciems GV3101 using freeze-thaw method and protects bacterium.Plant overexpression vector The structure flow of ' pCAMBIA1301-PbrERF109 ' is as shown in Figure 6.

Embodiment 4

Tobacco genetic transformation

Steps are as follows for Agrobacterium tumefaciens mediated tobacco genetic transformation：

1. Agrobacterium is cultivated：The Agrobacterium bacterium solution for taking fresh activation, in the kanamycins and 50mg/L for being added to 50mg/L Rifampin LB solid plates on cross, after 2 days with sterilizing pipette tips scraping tablet on bacterium colony, be put into liquid MS, 28C °, 200 revs/min of shaken cultivations, wait for that bacterial concentration reaches OD₆₀₀Terminate to cultivate when=0.4~0.6, is subsequently used for disseminating；

2. dip dyeing：The wild-type tobacco blade for taking the non-transgenosis of health, is cut into rectangular, and size is about 0.5 centimeter It is put into tweezers in cultured GV3101 Agrobacteriums bacterium solution by length and width, is flooded immersion 10 minutes or so, is put in during culture 28 DEG C, 200rpm shaking tables constantly vibrate；

3. co-culturing：The blade after being disseminated in MS is gently taken out with tweezers, and table is blotted with the filter paper Jing Guo aseptic process Then the extra bacterium solution in face grips blade (leaf surface is upward) and is positioned on symbiotic culture medium, 25 DEG C of dark treatments are small for culture 72 When；

4. screening and culturing：It takes out and passes through light culture blade, gripping blade, which is put into prepared cephalosporin solution, to be soaked Bubble rinses one time, is then rinsed 4 times to the blade with sterile water, surface residual moisture is blotted with aseptic filter paper, finally again leaf Piece (leaf surface is downward) is positioned in the MS culture mediums containing 20mg/L hygromycin and 500mg/L cephalosporins；

5. culture of rootage：Tobacco leaf can grow adventitious bud on screening and culturing medium, wait for that eye estimate adventitious bud is about to 1 Centimetre when, after adventitious bud is cut, be used in combination tweezers be carefully placed into containing 20mg/L hygromycin, 500mg/L cephalosporins and On the MS culture mediums of 0.5mg/L 6-BA；

6. tobacco transplantation of seedlings：When observing the transgene tobacco seedling growing way to a certain extent, it is gripped into stem with tweezers, from It is pulled out in root media, is rinsed with water the MS culture mediums of clean transgene tobacco seedling root, and be mixed with the sterile of vermiculite It is transplanted in Nutrition Soil and clean cave basin, to obtain turning PbrERF109 genetic tobacco plant.

Embodiment 5

Pears instantaneous conversion

The preparation of the Ussurian pear strain of the drought-induced transcription factor PbrERF109 of instantaneous conversion pears, the specific method is as follows：

1. the Ussurian pear (Pyrus ussuriensis) of growth 5 weeks or so is used for Agrobacterium in choosing in the controlled environment chamber It infects.

2. in LB culture mediums (rifampicin+50mg/L of kanamycin+100mg/L containing 50mg/L gentamycin) GV3101 Agrobacterium of the scribing line culture with purposeful plasmid, picking Agrobacterium colonies were cultivated for 28 DEG C in 5mL LB culture mediums Night.

3. after measuring Agrobacterium bacterium solution OD600 values, 3000rpm centrifuges 10min and collects bacterium solution, abandons supernatant.With acetyl fourth Ketone musk (acetosyringone) solution [10mM MES (pH 5.6)+10mM MgCl2+200uM acetosyringone] is outstanding Floating, it is about 1.5 or so to adjust to OD600, is stored at room temperature 3h.

4. the Agrobacterium containing purposeful plasmid to be used for the injection of Ussurian pear blade.

5. with 1mL syringes (removing syringe needle), injected at the Pear leaves back side, the blade that label was injected well.

6. the pears plant injected is put back to phjytotron culture 6-7 days, you can observe the result of instantaneous conversion.

Embodiment 6

The Molecular Identification of transfer-gen plant

1, leaf DNA is extracted

It takes appropriate transgenic tobacco plant blade to be put into 1.5ml centrifuge tubes, liquid nitrogen is added, is fully ground into powder Shape；The DNA extracting solution cetyl triethyl group bromines of 700 μ l, 65 DEG C of preheatings are added in the centrifuge tube of grind into powder immediately Change ammonium, extract recipe：100mM Tris-HCl (PH8.0), 1.5M NaCl, 50mM EDTA (PH=8.0), 1% polyethylene Pyrrolidones, 2%CTAB；The blade powder for being mixed with extracting solution is put into 65 DEG C of water-bath warm bath 90 minutes, every 15 minutes Take out reverse mixing；After warm bath, 10000g room temperature centrifuges 10 minutes, takes supernatant, and 600 μ l chloroforms are added, and overturns mixing, room temperature Stand 5 minutes；10000g is centrifuged 15 minutes, takes supernatant, the absolute ethyl alcohol of 2 times of volumes precooling, 34 μ l 5M NaCl solutions, top After mixing, it is put into -20 DEG C of refrigerators and stands 30 minutes；10000g is centrifuged 10 minutes, takes supernatant, and it is heavy to be washed with 75% ethyl alcohol of 1ml It forms sediment 3 times, blank pipe centrifuges one minute, dries up alcohol, until DNA is in colorless and transparent, adds appropriate aseptic double-distilled water, is positioned over 37 DEG C 40min is dissolved in incubator, the agarose gel electrophoresis in 1% detects.

2, the overexpression of Semiquatitative RT-PCR assay detection PbrERF109 genes

This research uses the expression of foreign gene PbrERF109 in semi-quantitative RT-PCR analysis transgenosis pears and tobacco plant Amount, the RNA extractions of transgenic line blade are with cDNA synthetic methods with embodiment 1.Sxemiquantitative the primer is PbrERF109 bases Because of special primer (forward primer PbrERF109-F1：5 '-AGCCGGAGAATATGCAACTG-3 ' (SEQ ID No.5)；Instead To primer PbrERF109-R1：5 '-TGTCCCACAACAAGAACTGG-3 ' (SEQ ID No.6)).Response procedures are 94 DEG C Pre-degeneration 3 minutes；94 DEG C are denaturalized 30 seconds, and 58 DEG C are annealed 30 seconds, and 72 DEG C extend 30 seconds, 30 cycles；Prolong for 72 DEG C after the completion of cycle It stretches 5 minutes.Foreign gene of transgenic tobacco expression quantity uses Semi quantitative PCR analysis, transgene tobacco analysis to be made of Ubiqutin Internal reference, primer sequence are：Forward primer Ubiqutin-F：5 '-TGGCGGACGGGTGAGTAACGCG-3 ' (SEQ ID No.7)；Reverse primer Ubiqutin-R：5 '-GCTGGTCCGGTGGGATACCCTCC-3 ' (SEQ ID No.8).Transgenosis Pears analysis is internal reference, forward primer Tublin-F with Tublin：5 '-TGGGCTTTGCTCCTCTTAC-3 ' (SEQ ID No.9)；Reverse primer Tublin-R：5 '-CCTTCGTGCTCATCTTACC-3 ' (SEQ ID No.10).The result shows that The expression quantity of PbrERF109 genes in transgenic line is higher than wild type, selects 5 and 8 that brightness is high, i.e. expression quantity is high Two overexpression strains name OE5 and OE8 as individual transgenic line, then respectively as the maternal plant of sowing.

Embodiment 7

The evaluation of resistance of transfer-gen plant

With batch unconverted plant of tobacco (WT) received and turn PbrERF109 overexpression systems (OE5, OE8) by WT, OE5 and OE8 It is transplanted to after being grown 15 days on MS growth mediums after being grown 20 days in basin, the plant of normal growth does not have difference, but dry After drought processing processing 20 days, WT plant wilting degree is serious, and OE5 and OE8 plant remain to normal growth, show transfer-gen plant Drought-resistant ability it is obviously stronger than wild type (Fig. 9 A).Count survival rate, the results showed that, the survival rate of two transgenosis systems is obviously high In wild type (Fig. 9 B).Fig. 9 (C, D) indicates the percentage of water loss and conductivity of plant after measurement Osmotic treatment respectively, and as a result display turns The rate-of-loss of coolant and conductivity of gene plant are significantly lower than wild type.Fig. 9 E are Osmotic treatment chlorophyll surveys after 20 days at room temperature The extraction of fixed and chlorophyll.The studies above shows to turn the tobacco plant drought-resistant ability of PbrERF109 genes than unconverted plant (WT) It is remarkably reinforced.

In transgenic line, conductivity is relatively low and survival rate height shows that they may have and have stronger anti-ROS than WT Ability.So by identifying that the accumulation of ROS in plant just necessitates.With DAB and NBT histochemical staining methods to plant Blade is dyed, and detection hydrogen peroxide (H is respectively intended to₂O₂) and superoxide anion (O^2-) content.Such as Figure 10 (A, B) arids Stress is after 20 days, and the blade dyed with DAB, the leaf area that brown occurs in wild strain type is obviously bigger than transgenic line, And darker, the blade dyed with NBT, blue deeper, area bigger of the WT strain than transgenic line.Likewise, The content of malonaldehyde (MDA) and cell death degree are intended to than wild in the transgenosis overexpression strain as shown in Figure 10 (C, D) Type wants low, cellular damage smaller.These evidences show the activity that transgenosis system is accumulated in vivo after by drought stress Oxygen residual quantity is few compared with control series, and then shows that the PbrERF109 genes of overexpression can effectively enhance the work of transfer-gen plant Property oxygen scavenging capacity, to improve the drought resistance of plant.

In order to assess resistance of the PbrERF109 transgenosis pears overexpression to arid, in the case of normal growth, control and super table There is no apparent difference up to being form, after Osmotic treatment 20 days, it is found that wild type wilts more serious and is in water than transgenosis system Stain shape；Restore watering growth 7 days, two of transgenosis are to restore fast and compare extreme portions and cannot restore normal growth and become withered Huang, and terminal bud is dead.The studies above the result shows that, the drought-resistant ability of transgenosis system is stronger than wild type.

It can be obtained by above example, drought resisting transcription factor PbrERF109 is transferred to tobacco and Ussurian pear by the present invention In, obtained transgenosis overexpression strain drought-resistant ability compared with compareing wild type has very big promotion, the transgenosis of tobacco super The content of hydrogen peroxide and malonaldehyde is intended to lower than wild type in expression strain, and plant activity in vivo oxygen remains lower, cell Smaller is damaged, and then improves the drought-resistant ability of tobacco and Ussurian pear plant.

The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also answered It is considered as protection scope of the present invention.

Sequence table

<110>Agricultural University Of Nanjing

<120>A kind of drought resisting transcription factor PbrERF109 and preparation method thereof, application and coding protein and application

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 795

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 1

atgcccttcc atgcgaatcg gatacaacag gagcaggagc actgcatcat ggtctccgcc 60

ctcaagcacg taatctccgg tggaagcatc agtgggccca cacctcagcc aatgccggcg 120

gtctacaatg ccacgtcatc cgtctcgacg agcggcaccc agttggcagc gggccaacca 180

gcacaacagg acaactactt ctcgccatcg ttgccgaatc aaaacaggaa ccagcaactg 240

agtttgggaa ccgggtttgt cgggatgaat gcgccaacta cgaggaagag caagaacaag 300

tacaggggcg tcaggcagag gccgtggggg aaatgggcgg cggagattcg agacccacga 360

cgggcggcga gggtgtggct agggacgttc gagacggcgg aggacgcggc cagggcttac 420

gacaaggccg ccgtcgagtt ccgcggaaat aaggcaaagc tcaatttccc atcggacccg 480

ggcggtcaca ttgtcacgac taacgacagt tctagtagtg gaactagtgc taatgccagt 540

attaatccag gattaattaa taagcaaaag caaaagaata ttagcgaaat tggggtcatg 600

gagaaggagg aggagaaggt tgatcaggtc aaactcaacc aggcgacgca gccggagaat 660

atgcaactgg gggtggtggc gaccgcggag agcagcgttg gtcatgagga ggatgaccag 720

ttcttgttgt gggacaatgg ctggctccga gatggtgaag atgacgactt aatggcatgg 780

ttatccacga actag 795

<210> 2

<211> 264

<212> PRT

<213>Artificial sequence (Artificial Sequence)

<400> 2

Met Pro Phe His Ala Asn Arg Ile Gln Gln Glu Gln Glu His Cys Ile

1 5 10 15

Met Val Ser Ala Leu Lys His Val Ile Ser Gly Gly Ser Ile Ser Gly

20 25 30

Pro Thr Pro Gln Pro Met Pro Ala Val Tyr Asn Ala Thr Ser Ser Val

35 40 45

Ser Thr Ser Gly Thr Gln Leu Ala Ala Gly Gln Pro Ala Gln Gln Asp

50 55 60

Asn Tyr Phe Ser Pro Ser Leu Pro Asn Gln Asn Arg Asn Gln Gln Leu

65 70 75 80

Ser Leu Gly Thr Gly Phe Val Gly Met Asn Ala Pro Thr Thr Arg Lys

85 90 95

Ser Lys Asn Lys Tyr Arg Gly Val Arg Gln Arg Pro Trp Gly Lys Trp

100 105 110

Ala Ala Glu Ile Arg Asp Pro Arg Arg Ala Ala Arg Val Trp Leu Gly

115 120 125

Thr Phe Glu Thr Ala Glu Asp Ala Ala Arg Ala Tyr Asp Lys Ala Ala

130 135 140

Val Glu Phe Arg Gly Asn Lys Ala Lys Leu Asn Phe Pro Ser Asp Pro

145 150 155 160

Gly Gly His Ile Val Thr Thr Asn Asp Ser Ser Ser Ser Gly Thr Ser

165 170 175

Ala Asn Ala Ser Ile Asn Pro Gly Leu Ile Asn Lys Gln Lys Gln Lys

180 185 190

Asn Ile Ser Glu Ile Gly Val Met Glu Lys Glu Glu Glu Lys Val Asp

195 200 205

Gln Val Lys Leu Asn Gln Ala Thr Gln Pro Glu Asn Met Gln Leu Gly

210 215 220

Val Val Ala Thr Ala Glu Ser Ser Val Gly His Glu Glu Asp Asp Gln

225 230 235 240

Phe Leu Leu Trp Asp Asn Gly Trp Leu Arg Asp Gly Glu Asp Asp Asp

245 250 255

Leu Met Ala Trp Leu Ser Thr Asn

260

<210> 3

<211> 33

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 3

gaagatctta tgcccttcca tgcgaatcgg ata 33

<210> 4

<211> 27

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 4

gggtnacccc tagttcgtgg ataacca 27

<210> 5

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 5

agccggagaa tatgcaactg 20

<210> 6

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 6

tgtcccacaa caagaactgg 20

<210> 7

<211> 22

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 7

tggcggacgg gtgagtaacg cg 22

<210> 8

<211> 23

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 8

gctggtccgg tgggataccc tcc 23

<210> 9

<211> 19

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 9

tgggctttgc tcctcttac 19

<210> 10

<211> 19

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 10

ccttcgtgct catcttacc 19

<210> 11

<211> 30

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 11

tctagaatgc ccttccatgc gaatcggata 30

<210> 12

<211> 25

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 12

ggatccccta gttcgtggat aacca 25

Claims

1. a kind of drought resisting transcription factor PbrERF109 has nucleotide sequence shown in ESQ ID No.1.

2. the protein of drought resisting transcription factor PbrERF109 codings described in claim 1 has ammonia shown in SEQ ID No.2 Base acid sequence.

3. the preparation method of drought resisting transcription factor PbrERF109 described in claim 1, includes the following steps：

The transcription factor primer pair includes transcription factor sense primer and transcription factor downstream primer, the transcription factor upstream There is primer nucleotide sequence shown in SEQ ID No.3, the transcription factor downstream primer to have shown in SEQ ID No.4 Nucleotide sequence.

4. preparation method according to claim 3, which is characterized in that the every 50 μ l of system that the PCR amplification uses include： 100ng pears cDNA, 10 μ l Q5 Reaction Buffer, 1 μ l 10mM dNTP, 0.5 μ l Taq polymerases, 10 μM of 2.5 μ l Transcription factor sense primer, 2.5 μ l, 10 μM of transcription factor downstream primers, surplus ddH₂O；

The condition of the PCR amplification includes：98 DEG C of pre-degenerations 30 seconds；98 DEG C are denaturalized 10 seconds, and 65 DEG C are annealed 30 seconds, and 72 DEG C extend 30 Second, 35 cycles；Extend 2 minutes for 72 DEG C after the completion of cycle.

5. the preparation side described in drought resisting transcription factor PbrERF109 described in claim 1 or claim 3~5 any one The protein described in drought resisting transcription factor PbrERF109 or claim 2 that method is prepared is in improving plant drought ability Application.

6. application according to claim 5, which is characterized in that the plant includes tobacco or pears.

7. application according to claim 6, which is characterized in that described to improve the anti-of tobacco when the plant is tobacco The method of non-irrigated ability includes the following steps：

The recombinational agrobacterium is infected into tobacco.

8. application according to claim 7, which is characterized in that every 5 μ of total system of the pEASY-T1 cloning vectors connection L includes：4 μ l drought resisting transcription factor PbrERF109 and 1 μ lpEASY-T1 cloning vectors, the drought resisting transcription factor PbrERF109 Molar ratio with carrier is 3:1；

The condition of the connection includes：30min is reacted at 25 DEG C.

9. application according to claim 5, which is characterized in that when the plant is pears, the drought resisting energy for improving pears The method of power includes：The drought resisting transcription factor PbrERF109 is transferred in pears using transient transformation methods.