CN103276002B - Oil body containing oil body protein and collagen fusion protein - Google Patents
Oil body containing oil body protein and collagen fusion protein Download PDFInfo
- Publication number
- CN103276002B CN103276002B CN201310212250.7A CN201310212250A CN103276002B CN 103276002 B CN103276002 B CN 103276002B CN 201310212250 A CN201310212250 A CN 201310212250A CN 103276002 B CN103276002 B CN 103276002B
- Authority
- CN
- China
- Prior art keywords
- oil body
- collagen
- protein
- gene
- fusion protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The invention discloses an oil body containing oil body protein and collagen fusion protein. By a recombinant DNA (deoxyribonucleic acid) technology, Arabidopsis oil body protein and a recombinant collagen gene are fused together, a fusion gene expression plasmid expression vector pOBTcol is established and converted into oil crops, the fusion protein is expressed, and the oil body containing the oil body protein and the collagen fusion protein is obtained; the purposes of simple operation, low cost and high expression quantity are achieved; the oil body containing the oil body protein and the recombinant collagen peptide fusion protein has higher collagen activity, and can be directly used for production of medicaments for external use and cosmetics, thus, the production cost is reduced, the processes of collagen peptide purification and mixing of collagen peptide and an emulgator (or a protective agent) are eliminated, and the oil body and the fusion protein are integrated to protect the recombinant collagen better.
Description
Technical field
The invention belongs to biology field, be specifically related to Arabidopis thaliana oil body protein and recombined collagen fusion rotein and the oil body containing this fusion rotein.
Background technology
Collagen is a kind of scleroproein in organism, is mainly present in the tissues such as skin, bone, cartilage and tendon, accounts for 25% ~ 33% of human body or other animal body total protein contents.Collagen protein is widely used in biomedical materials field because of its excellent biological characteristics.Therefore, how to carry out high purity, the extraction of high yield have bioactive collagen protein be always numerous investigators pay close attention to problem.The type of collagen protein is more, has had been found that 26 kinds, and be distributed in the tissue such as skin, tendon, wherein, in skin, the collagen protein of about 85% belongs to IV type, and IV Collagen Type VI is that content studies the most thorough collagen at most, accounts for about 90% of organism collagen total amount.IV Collagen Type VI is generally white, transparent, branchiess protofibril, the heterogeneous collagen (Heterotypic Collagen) be made up of two identical α 1 (IV) chains and α 2 (IV) chain.338 (Gly-X-Y) tumor-necrosis factor glycoproteinss are contained in the helical region of α 1 (IV) and α 2 (IV) peptide chain, and X is often proline(Pro), and Y is often oxyproline or hydroxylysine.Therefore, glycine accounts for 1/3, and proline(Pro) and oxyproline account for more than 1/5, also has a large amount of hydroxylysines and L-Ala.In α chain, the existence of pyrrole ring makes N-C key not rotate freely, and form left hand helix, pitch is 0.87 nm, often turns around and about has 3.3 amino-acid residues.Article three, α chain relies on side-chain residue to be connected, and minimum amino acids Glycine residue is positioned at inside triple helix, and pitch is 96nm, and often circle has 36 amino-acid residues, defines the distinctive triple helix structure of tropocollagen (tropo collagen) molecule.
Collagen protein all has biological function in a lot, comprising: (1) collagen protein can protect skin, improves the elasticity of skin, and collagen protein plays an important role in the regeneration of adjustment epidermal renewal, and collagen protein can promote cell adhesion and cell proliferation; (2) collagen protein has anthemorrhagic performance; (3) collagen protein has very low immunogenicity; (4) collagen protein depending on and stent material as Growth of Cells, can induce the propagation such as epithelial cell, break up and divide a word with a hyphen at the end of a line; (5) collagen protein is made up of the collegen filament of triple-helix structure.As the skeleton of extracellular matrix, there is the features such as easy absorption, easily assimilation, therefore there is good biocompatibility.
The diversity of collagen structure and functional characteristics and complicacy, determine its critical role in a lot of fields and good application prospect.
(1) application in food
Collagen protein inherently can as a kind of food, and edible collagen protein generally derives from the corium of animal, tendon and osso-albumin, and its outward appearance is generally white, and mouthfeel is soft, and taste is light, easy to digest.But in most cases collagen protein can be used as functional mass or nutritive ingredient in food.
(2) application in makeup
Collagen protein has moisture-keeping function, repairs the effects such as skin, whitening and moist hair, makes these beautification functions of collagen protein, has been widely used in makeup.
(3) application in biomedical sector
Low challeng, biocompatibility, anastalsis and biodegradable are the advantage place of collagen protein as biomedical material.In recent years, the state such as Great Britain and America adopts injectivity collagen to carry out the various damages of reduction facial soft tissue.The collagen injection agent of China's development has been widely used in the boundary that improves looks, and at delay skin aging, rebuilding in impaired skin etc. and achieve good effect, is a kind of desirable medical material.
(4) application in paper industry
Application as raw material: containing a large amount of carboxyl, amino, hydroxyl in collegen filament molecule, and also containing great amount of hydroxy group and a small amount of carboxyl in Mierocrystalline cellulose, many active groups and reactive site is contained just because of in these two kinds of natural polymers, method by chemistry or physics makes matrix material, moulds wrapping material, wallpaper, paper for daily use, light-shielding sheet, agricultural byproducts wrapping material, biological collagen wrapping paper, composite biodegradable material etc. for the manufacture of book-binding leather, film.
Oil body is as emulsifying agent.Be widely used in production food, feed, medicine, personal care product and Industrial products etc.Compared with the emulsifying agent from mineral, environmental protection and renewable more.Oil body protein is membranin main in oil body.There is 2-4 hypotype in oil body protein.They can present different phenotypes in Seed development, and change along with the sprouting of seed.Oil body protein is the hydrophobin of alkalescence, and three parts form oil body protein: the C end of lipophilic and N end, and middle hydrophobic region, it enters into oil body inside by immobilized artificial membrane.N end and C end are then embedded in oil body surface, are exposed in tenuigenin.The structure of oil body protein and its specificity, make oil body be widely used in biotechnology.
Summary of the invention
The object of this invention is to provide a kind of Arabidopis thaliana oil body protein and the fusion gene of recombined collagen peptide and the albumen of expression thereof.
A kind of antigen-4 fusion protein gene, it is formed by Arabidopis thaliana oil body protein and recombined collagen gene fusion, and its base sequence is as shown in sequence table SEQ ID NO.5;
A kind of fusion rotein, it is the albumen of being expressed by said gene;
A kind of expression vector
pOBTcol, it is prepared by following method:
1) take p1301 as basic framework, utilize kpnI and SpeI restriction enzyme site, by 35S-Bar gene, before T-DNA district NOS gene, obtain the basic plasmid of p1301-35S-Bar-NOS, be called for short: pO;
2) with pstI with NcoI respectively enzyme cut and be connected gene shown in pO plasmid and sequence table SEQ ID NO.2, obtain intermediate carrier pOB;
3) with Hind III and kpnI respectively enzyme cut and be connected gene shown in intermediate carrier pOB and sequence table SEQ ID NO.3, obtain plant specific expression carrier pOBT;
4) with NcoI and Hind III respectively enzyme cut and connect gene shown in plant specific expression carrier pOBT and sequence table SEQ ID NO.5, obtain expression vector
pOBTcol.
The oil body of eleoplast albumen and collagen fusion protein, it is prepared by following method: insert in plant expression vector by the gene of its base sequence as shown in sequence table SEQ ID NO.5, the expression plasmid obtained, is converted in oil crops, results Extraction oil of seed body.
Described expression plasmid is a kind of expression vector
pOBTcol.
The invention provides the oil body of eleoplast albumen and collagen fusion protein, the present inventor has transformed recombined collagen gene according to favorite plant, utilize recombinant DNA technology by Arabidopis thaliana oil body protein and recombined collagen gene fusion, inserting with p1301 is the plant specific expression carrier pOBT that basic framework is transformed, Arabidopis thaliana oil body protein and recombined collagen fusion gene expression plasmid expression vector pOBTcol, be converted in oil crops, have expressed fusion rotein, obtain the oil body of eleoplast albumen and collagen fusion protein, thus fusion protein expression is improved greatly.Oil body containing oil body protein and recombined collagen peptide fusion protein, has higher collagen protein active, eliminates the purification process of collagen protein, and the complete processing that collagen peptide mixes with emulsifying agent (or protective material), reduces production cost.The exploitation of external preparation and makeup thereof can be directly applied to; oil body and fusion rotein are integrated; recombined collagen peptide can be protected better; the effect that similar PEG modifies; directly the oil body containing recombined collagen peptide is applied in the product such as makeup, hair nursing; meanwhile, directly can also carry recombined collagen peptide and directly act on affected part, better play the effect of externally applied medicine.Oil body can also as emulsifying agent, and the oil body containing recombined collagen peptide may be used for treating the composition in tetter class medicine and oral medicine, promotes the absorption of recombined collagen peptide.
By the method for present method Restruction collagen peptide, there is simple to operate, with low cost, expression amount high; In purification phase, because oil body protein and the coupling of recombined collagen peptide phase are expressed, thus can be gone out by the method for different concns gradient centrifugation more than 95% foreign protein, purification fusion rotein.
Accompanying drawing explanation
The nucleic acid electrophoresis figure of Fig. 1 Kidney bean promotor;
The nucleic acid electrophoresis figure of Fig. 2 Kidney bean terminator;
Fig. 3 plant oil-body expression vector builds pOBT schematic diagram;
Fig. 4 contains the plant oil-body expression vector pOBTcol schematic diagram of recombined collagen gene;
The SDS-PAGE of Fig. 5 recombined collagen peptide detects figure.
Embodiment
embodiment 1: the synthesis of recombined collagen peptide gene col
First transform according to the nucleotide sequence of Preference to the collagen peptide found from GENBANK of vegetable codon, rare amino acid codon less for content in plant is replaced to the codon of favorite plant.Degeneracy according to codon eliminates restriction enzyme site used in this experiment, sends to Shanghai Sheng Gong biotechnology company limited and carries out synthetic recombined collagen peptide gene (SEQ ID NO.1).
embodiment 2: clone's phaseolus vulgaris seeds specific promoter and terminator
In order to clone seed-specific expression promoter and terminator from bean gene group sequence, utilize primer, the polymerase chain reaction (PCR) of employing standard, from bean gene group DNA, amplification obtains the DNA fragmentation (as Fig. 1 and Fig. 2) of 1548bp and 1220bp, the fragment of amplification is through digestion with restriction enzyme, be cloned in pUC57 cloning vector, save backup.Through order-checking, its base sequence is as shown in sequence table SEQ ID NO.2 and 3.
Kidney bean promoter primer
Primer5F: GAATTCATTGTACTCCCAG
Primer5R:AGTAGAGTAGTATTGAATATGAG
Kidney bean terminator primer
tem5F: AATAAGTATGAACTAAAATGC
tem5R: TTAGTTGGTAGGGTGCTAGGAA
embodiment 3: build plant specific expression carrier pOBT
The cloning vector of pUC57-Kidney bean promotor restriction enzyme pstI and NcoI is digested, reclaim object fragment Kidney bean promoter sequence, digest basic plasmid pO(with p1301 with pstI and NcoI is basic framework simultaneously, its T-DNA district is transformed, except the NOS gene remaining with T-DNA district, all the other genes are all replaced by 35S and Bar gene, with pEGAD plasmid for template, 35S-F upstream primer 47bp cggggtaccAtccgtcaacatggtggagcacgacacgcttgtctact and Bar-R downstream primer 54bp cggaattcactagttcagatctcggtgacgggcaggaccggacggggcggaacc is utilized to carry out PCR, amplification obtains 35S-Bar gene, before utilizing kpnI and SpeI restriction enzyme site to be inserted into the NOS gene in pCAMBIA1301 carrier T-DNA district, construct the basic plasmid of p1301-35S-Bar-NOS, be abbreviated as pO plasmid, ), the Kidney bean promotor fusion gene of oil body protein and collagen protein (be used for start) is connected with basic plasmid pO, transformation of E. coli, obtain pOB intermediate carrier, cloning vector HindIII and kpnI of pUC57-terminator is digested, reclaim object fragment Kidney bean terminator, simultaneously with these two enzymic digestion pOB intermediate carriers, the pOB carrier after being cut with enzyme by terminator is connected, transformation of E. coli, obtains plant specific expression carrier pOBT(and sees Fig. 4).
embodiment 4: the clone of Arabidopis thaliana oil body protein gene
Get Arabidopis thaliana seed, extract DNA genome, with primer:
1:CCATGGCGGATACAGCTAGAGG
2:CACCGGGTGGAGTAGTGTGCTGG
Carry out amplification Arabidopis thaliana oil body protein gene, through order-checking, its base sequence is as shown in sequence table SEQ ID NO.4; The fragment of amplification, through restriction enzyme (NcoI enzyme and EcoRI enzyme) digestion, is cloned in pUC57 cloning vector, saves backup.
embodiment 5: build the vegetable oils specific expression carrier pOBTcol containing Arabidopis thaliana oil body protein and recombined collagen peptide fusion gene
The Arabidopis thaliana oil body protein gene obtained with clone and recombinant collagen egg peptidyl are because template, and design fusion gene primer, by fusion DNA vaccine technology, obtain oleosin-col fusion gene, through order-checking, its base sequence is as shown in sequence table SEQ ID NO.5.Fusion gene restriction enzyme NcoI and HindIII is carried out enzyme cut, carry out enzyme with these two enzymes to pOBT carrier simultaneously and cut, the pOBT carrier after then being cut with enzyme by fusion gene is connected, transformation of E. coli, produces pOBTcol plant oil-body expression vector.
Arabidopis thaliana oil body protein and col fusion gene primer
1:CCATGGCGGATACAGCTAGAGG
2:CACCGGGTGGAGTAGTGTGCTGG
3:CCAGCACACTACTCCACCCGGT
4:CCCAAGCTTCCACCGGC
embodiment 6:pOBTcol Plastid transformation Agrobacterium EHA105
(1) get 100 μ L Agrobacterium EHA105 competent cells to be placed in ice bath 10min to make it melt for subsequent use.(2) 1 μ L is got
pOBTcolplasmid joins in Agrobacterium competent cell, blows and beats gently with liquid-transfering gun, makes it mix all
Even, ice bath 30 minutes.(3) be placed on freezing 5min in liquid nitrogen after ice bath immediately, take out at once and put into 37 DEG C of thermal shock 5min.(4) add 1mL and do not contain resistance YEP liquid nutrient medium in centrifuge tube, 28 DEG C, 180rpm/min shakes bacterium 4h.(5) use whizzer 5000rpm, centrifugal 5min, abandons supernatant, and it is resuspended to add 100 μ LYEP substratum.
(6) re-suspension liquid is coated containing three anti-(100 μ g/mLRif Str, 50 μ g/mLKan and 50 μ g/mL)) YEP solid medium flat board in, cultivate 2 ~ 3 days in 28 DEG C of thermostat containers.
Utilize the method handle
pOBTcolbe transformed in Agrobacterium competence, picking list bacterium colony carries out liquid concussion and cultivates, and screens transformant through row bacterium liquid PCR, is containing goal gene through being accredited as positive bacterium liquid
pOBTcolagrobacterium engineering bacterial strain.With 70% glycerine conservation positive strain ,-80 DEG C of Refrigerator stores.
the genetic transformation that embodiment 7:Flori dip method is carried out
First, infecting waters wildtype Arabidopsis thaliana and butch flax plant the day before yesterday irrigates; Agrobacterium tumefaciens attachment is seeded to 50ml to contain in the YEP liquid nutrient medium of three anti-(100 μ g/ml Rif, 50 μ g/ml Str and 50 μ g/ml Kan), carries out preculture (180rpm/min, 28 DEG C); Get pre-incubated Agrobacterium 7ml to join in the YEP liquid nutrient medium resisted containing three, carry out enlarged culturing, until OD5900=1.0 ~ 1.2; Agrobacterium bacterium liquid is moved on in centrifuge tube, and 20 DEG C, the centrifugal 20min of 4000rpm, collects thalline, removes three anti-substratum.With the resuspended thalline of Floral-Dip Buffer, its OD590 is made to reach 0.8 ~ 0.9.The bud cut kind of a pod before conversion, bloom and show money or valuables one carries unintentionally.Plug the bamboo let of suitably height in alms bowl body surrounding, turn to support the alms bowl body carrying out infecting around.The stem of Arabidopis thaliana and blade base are immersed in resuspended Agrobacterium bacterium liquid, leave standstill 7 minutes, then inhale and abandon too much bacterium liquid.Keep flat the alms bowl body after conversion, spend the night with moisturizings such as plastics films, within second day, can slightly reveal a crack, within the 3rd day, normally place.One Zhou Houke carries out secondary infection.After seed maturity, the pod that jaundice is ripe can be plucked every other day, results seed.
embodiment 8: Agrobacterium-mediated genetic transformation
Getting 1 μ g pOBTcol plasmid DNA joins in 100 microlitre EHA105 competent cells, mixes ice bath gently and places 5min; Then 37 DEG C of water-bath incubation 5min are gone to rapidly after being placed in the freezing 5min of liquid nitrogen, add 1mlLB liquid nutrient medium, 180rpm shaking culture 4h on 28 DEG C of shaking tables, get in LB solid culture that appropriate bacterium liquid is applied to containing Streptomycin sulphate and kantlex, put 28 DEG C and cultivate 24h, detect positive single bacterium colony through resistance screening, PCR.
From flat board, picking contains the single bacterium colony of Agrobacterium of pOBTcol plasmid, be inoculated in 5mlLB liquid nutrient medium, shaking culture is spent the night, getting 100 microlitre bacterium liquid is inoculated in 50mlLB liquid nutrient medium, 28 DEG C, 180rpm shaking culture is 0.8 to OD600, then centrifugal resuspended, suspension OD=0.6.
The plant cotyledon joints such as safflower, rape, soybean, peanut are infected 10min in re-suspension liquid, be placed on the substratum containing suitable hormone and cultivate, then forward in the screening culture medium containing 0.5%basta and 250mg/L cephamycin and cultivate, after about 30d, visible resistant buds occurs, be elongated to after 2cm until resistant buds, proceed in root media.
embodiment 9: the PCR of transfer-gen plant detects
Extracting the genomic dna of transfer-gen plant, take genome as template, with Arabidopis thaliana oil body protein and col fusion gene primer:
1:CCATGGCGGATACAGCTAGAGG
4:CCCAAGCTTCCACCGGC
Amplification Arabidopis thaliana oil body protein and col gene fusion gene fragment, amplify the object band of expection.
embodiment 10: the transgenic line that screening expression amount is high
Transgenic line in greenhouse or land for growing field crops through growth with grow, then blossom and have seeds, form transgenosis T1 for seed, after T1 is for seed harvest, every strain transfer-gen plant gets 200-1000mg, the fusion rotein of extract oil body protein and col in extracting solution, adopt ELISA method, according to the operation of collagen-type IV ElISA test kit (Bai Li bio tech ltd, Shanghai) specification sheets, detect the expression amount of recombined collagen peptide, take p13900Rcol as contrast, filter out the transgenic line of high expression level.Result shows, the pOBTcol recombinant vectors that the present invention builds through the safflower of agrobacterium mediation converted, rape, soybean, peanut plant and p13900Rcol through agrobacterium mediation converted plant compared with, expression amount significantly improves, as shown in the table.
pOBTcol (pg/ml) | p13900Rcol (pg/ml) | |
Safflower | 2366.7±30.4 | 2213.4±29.7 |
Rape | 2422.8±29.7 | 2197.8±28.9 |
Soybean | 2198.3±28.1 | 2016.5±30.3 |
Peanut | 2226.9±29.5 | 2086.1±27.5 |
embodiment 11: the transgenic seed oil body containing oleosin-col fusion rotein extracts and SDS-PAGE detects
(1) get 200 ~ 1000mg transgenic seed, put into mortar, add 1ml Buffer A, fully grind with pestle.Until solution turned cloudy, cannot see kind of a grain.Put into whizzer 12000rpm, 4 DEG C, centrifugal 10min;
(2) centrifugal rear solution is divided into three layers, and namely top layer is white oil layer, middle layer liquid, and bottom sediment.Upper strata oil body fraction and liquid portion are mixed, whole sucking-off, note not sucking-off bottom sediment, the liquid rotating of sucking-off is moved in another centrifuge tube, adds Buffer A, centrifugal 12000rpm, 4 DEG C, 10min, repeat 1,2 steps, 3 ~ 4 times.
(3) the Buffer B liquid of the centrifugal rear sucking-off of repetition 1,2 step being added 500 μ l mixes, 4 DEG C in centrifuges, 12000rpm, centrifugal 10min.
(4) be divided into two-layer after now centrifugal, be upper strata oil fraction and lower floor's liquid portion, by lower floor's liquid sucking-off, discard.Repeat 3,4 steps again, 3 ~ 4 times.
(5) toward in the EP pipe containing oil fraction, add 40 μ l Buffer B and 10 μ l sample-loading buffers, be mixed, in boiling water, boil 10min, get 15 μ l with 12% SDS-PAGE identify, see Fig. 5.There is specific band at 26kDa right position in transfer-gen plant as can be seen from Fig. 5, and wild-type does not have band at this place.Further demonstrate Oleosin and col fusion rotein to be expressed in Arabidopis thaliana seed.
Buffer A:0.4M Sucrose,0.5M NaCl,0.05M Tris-HCl(pH=8.0);
Buffer B:20 mM Na2HPO4,20 mM NaCl(pH=8.0)。
embodiment 12: the oil body Activity determination containing oleosin-col fusion rotein
With the oil body of mtt assay mensuration containing oleosin-col fusion rotein, wild-type oil body and positive control standard college albumen to the Mitogenic activity of Balb/c 3T3 cell.Result shows, the oil body ED50 containing fusion rotein is 1.4ng/ml, and the ED50 of wild-type oil body is 0.32ng/ml, and the ED50 of positive control standard college is 1.8 ng/ml.
<110> Jilin Agriculture University
The oil body of <120> eleoplast albumen and collagen fusion protein
<160> 5
<210> 1
<211> 297
<212> DNA
<213> is artificial
<400> 1
ggtgagccag gtaacccagg ttctccagga aaccaaggtc aacctggaaa caagggttct 60
cctggaaacc caggtcaacc tggtaacgag ggacaaccag gtcaacctgg tcaaaacggt 120
caaccaggtg agcctggatc taacggtcct caaggttccc aaggtaaccc aggtaagaac 180
ggtcaaccag gttctccagg ttcccaaggt tctcctggaa accaaggttc tccaggtcaa 240
ccaggtaacc caggtcaacc tggagagcaa ggtaagccag gtaaccaagg tccagcc 297
<210> 2
<211> 1548
<212> DNA
<213> phaseolus vulgaris seeds
<400> 2
gaattcattg tactcccagt atcattatag tgaaagtttt ggctctctcg ccggtggttt 60
tttacctcta tttaaagggg ttttccacct aaaaattctg gtatcattct cactttactt 120
gttactttaa tttctcataa tctttggttg aaattatcac gcttccgcac acgatatccc 180
tacaaattta ttatttgtta aacattttca aaccgcataa aattttatga agtcccgtct 240
atctttaatg tagtctaaca ttttcatatt gaaatatata atttacttaa ttttagcgtt 300
ggtagaaagc ataatgattt attcttattc ttcttcatat aaatgtttaa tatacaatat 360
aaacaaattc tttaccttaa gaaggatttc ccattttata ttttaaaaat atatttatca 420
aatatttttc aaccacgtaa atctcataat aataagttgt ttcaaaagta ataaaattta 480
actccataat ttttttattc gactgatctt aaagcaacac ccagtgacac aactagccat 540
ttttttcttt gaataaaaaa atccaattat cattgtattt tttttataca atgaaaattt 600
caccaaacaa tcatttgtgg tatttctgaa gcaagtcatg ttatgcaaaa ttctataatt 660
cccatttgac actacggaag taactgaaga tctgctttta catgcgagac acatcttcta 720
aagtaatttt aataatagtt actatattca agatttcata tatcaaatac tcaatattac 780
ttctaaaaaa ttaattagat ataattaaaa tattactttt ttaattttaa gtttaattgt 840
tgaatttgtg actattgatt tattattcta ctatgtttaa attgttttat agatagttta 900
aagtaaatat aagtaatgta gtagagtgtt agagtgttac cctaaaccat aaactataag 960
atttatggtg gactaatttt catatatttc ttattgcttt taccttttct tggtatgtaa 1020
gtccgtaact ggaattactg tgggttgcca tggcactctg tggtcttttg gttcatgcat 1080
ggatgcttgc gcaagaaaaa gacaaagaac aaagaaaaaa gacaaaacag agagacaaaa 1140
cgcaatcaca caaccaactc aaattagtca ctggctgatc aagatcgccg cgtccatgta 1200
tgtctaaatg ccatgcaaag caacacgtgc ttaacatgca ctttaaatgg ctcacccatc 1260
tcaacccaca cacaaacaca ttgccttttt cttcatcatc accacaacca cctgtatata 1320
ttcattctct tccgccacct caatttcttc acttcaacac acgtcaacct gcatatgcgt 1380
gtcatcccat gcccaaatct ccatgcatgt tccaaccacc ttctctctta tataatacct 1440
ataaatacct ctaatatcac tcacttcttt catcatccat ccatccagag tactactact 1500
ctactactat aataccccaa cccaactcat attcaatact actctact 1548
<210> 3
<211> 1220
<212> DNA
<213> phaseolus vulgaris seeds
<400> 3
aataagtatg aactaaaatg catgtaggtg taagagctca tggagagcat ggaatattgt 60
atccgaccat gtaacagtat aataactgag ctccatctca cttcttctat gaataaacaa 120
aggatgttat gatatattaa cactctatct atgcacctta ttgttctatg ataaatttcc 180
tcttattatt ataaatcatc tgaatcgtga cggcttatgg aatgcttcaa atagtacaaa 240
aacaaatgtg tactataaga ctttctaaac aattctaact ttagcattgt gaacgagaca 300
taagtgttaa gaagacataa caattataat ggaagaagtt tgtctccatt tatatattat 360
atattaccca cttatgtatt atattaggat gttaaggaga cataacaatt ataaagagag 420
aagtttgtat ccatttatat attatatact acccatttat atattatact tatccactta 480
tttaatgtct ttataaggtt tgatccatga tatttctaat attttagttg atatgtatat 540
gaaagggtac tatttgaact ctcttactct gtataaaggt tggatcatcc ttaaagtggg 600
tctatttaat tttattgctt cttacagata aaaaaaaaat tatgagttgg tttgataaaa 660
tattgaagga tttaaaataa taataaataa taaataacat ataatatatg tatataaatt 720
tattataata taacatttat ctataaaaaa gtaaatattg tcataaatct atacaatcgt 780
ttagccttgc tggacgactc tcaattattt aaacgagagt aaacatattt gactttttgg 840
ttatttaaca aattattatt taacactata tgaaattttt tttttttatc ggcaaggaaa 900
taaaattaaa ttaggaggga caatggtgtg tcccaatcct tatacaacca acttccacag 960
gaaggtcagg tcggggacaa caaaaaaaca ggcaagggaa attttttaat ttgggttgtc 1020
ttgtttgctg cataatttat gcagtaaaac actacacata acccttttag cagtagagca 1080
atggttgacc gtgtgcttag cttcttttat tttatttttt tatcagcaaa gaataaataa 1140
aataaaatga gacacttcag ggatgtttca acccttatac aaaaccccaa aaacaagttt 1200
cctagcaccc taccaactaa 1220
<210> 4
<211> 762
<212> DNA
<213> Arabidopis thaliana seed
<400> 4
atggcggata cagctagagg aacccatcac gatatcatcg gcagagacca gtacccgatg 60
atgggccgag accgagacca gtaccagatg tccggacgag gatctgacta ctccaagtct 120
aggcagattg ctaaagctgc aactgctgtc acagctggtg gttccctcct tgttctctcc 180
agccttaccc ttgttggaac tgtcatagct ttgactgttg caacacctct gctcgttatc 240
ttcagcccaa tccttgtccc ggctctcatc acagttgcac tcctcatcac cggttttctt 300
tcctctggag ggtttggcat tgccgctata accgttttct cttggattta caagtaagca 360
cacatttatc atcttacttc ataattttgt gcaatatgtg catgcatgtg ttgagccagt 420
agctttggat caattttttt ggtcgaataa caaatgtaac aataagaaat tgcaaattct 480
agggaacatt tggttaacta aatacgaaat ttgacctagc tagcttgaat gtgtctgtgt 540
atatcatcta tataggtaaa atgcttggta tgatacctat tgattgtgaa taggtacgca 600
acgggagagc acccacaggg atcagacaag ttggacagtg caaggatgaa gttgggaagc 660
aaagctcagg atctgaaaga cagagctcag tactacggac agcaacatac tggtggggaa 720
catgaccgtg accgtactcg tggtggccag cacactactt aa 762
<210> 5
<211> 1056
<212> DNA
<213> is artificial
<400> 5
atggcggata cagctagagg aacccatcac gatatcatcg gcagagacca gtacccgatg 60
atgggccgag accgagacca gtaccagatg tccggacgag gatctgacta ctccaagtct 120
aggcagattg ctaaagctgc aactgctgtc acagctggtg gttccctcct tgttctctcc 180
agccttaccc ttgttggaac tgtcatagct ttgactgttg caacacctct gctcgttatc 240
ttcagcccaa tccttgtccc ggctctcatc acagttgcac tcctcatcac cggttttctt 300
tcctctggag ggtttggcat tgccgctata accgttttct cttggattta caagtaagca 360
cacatttatc atcttacttc ataattttgt gcaatatgtg catgcatgtg ttgagccagt 420
agctttggat caattttttt ggtcgaataa caaatgtaac aataagaaat tgcaaattct 480
agggaacatt tggttaacta aatacgaaat ttgacctagc tagcttgaat gtgtctgtgt 540
atatcatcta tataggtaaa atgcttggta tgatacctat tgattgtgaa taggtacgca 600
acgggagagc acccacaggg atcagacaag ttggacagtg caaggatgaa gttgggaagc 660
aaagctcagg atctgaaaga cagagctcag tactacggac agcaacatac tggtggggaa 720
catgaccgtg accgtactcg tggtggccag cacactactg gtgagccagg taacccaggt 780
tctccaggaa accaaggtca acctggaaac aagggttctc ctggaaaccc aggtcaacct 840
ggtaacgagg gacaaccagg tcaacctggt caaaacggtc aaccaggtga gcctggatct 900
aacggtcctc aaggttccca aggtaaccca ggtaagaacg gtcaaccagg ttctccaggt 960
tcccaaggtt ctcctggaaa ccaaggttct ccaggtcaac caggtaaccc aggtcaacct 1020
ggagagcaag gtaagccagg taaccaaggt ccagcc 1056
Claims (5)
1. an antigen-4 fusion protein gene, it is formed by Arabidopis thaliana oil body protein and recombined collagen gene fusion, and its base sequence is as shown in sequence table SEQ ID NO.5.
2. a fusion rotein, it is by the albumen of the genetic expression of its base sequence as shown in sequence table SEQ ID NO.5.
3. an expression vector
pOBTcol, it is prepared by following method:
1) take p1301 as basic framework, utilize kpnI and SpeI restriction enzyme site, before 35S-Bar gene being inserted into T-DNA district NOS gene, obtain the basic plasmid of p1301-35S-Bar-NOS, be called for short: pO;
2) with pstI with NcoI respectively enzyme cut and be connected gene shown in pO plasmid and sequence table SEQ ID NO.2, obtain intermediate carrier pOB;
3) with Hind III and kpnI respectively enzyme cut and be connected gene shown in intermediate carrier pOB and sequence table SEQ ID NO.3, obtain plant specific expression carrier pOBT;
4) with NcoI and Hind III respectively enzyme cut and connect gene shown in plant specific expression carrier pOBT and sequence table SEQ ID NO.5, obtain expression vector
pOBTcol.
4. the oil body of eleoplast albumen and collagen fusion protein, it is prepared by following method: insert in plant expression vector by the gene of its base sequence as shown in sequence table SEQ ID NO.5, the expression plasmid obtained, is converted in oil crops, results Extraction oil of seed body.
5. the oil body of eleoplast albumen according to claim 4 and collagen fusion protein, is characterized in that: described expression plasmid is a kind of expression vector according to claim 3
pOBTcol.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310212250.7A CN103276002B (en) | 2013-05-31 | 2013-05-31 | Oil body containing oil body protein and collagen fusion protein |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310212250.7A CN103276002B (en) | 2013-05-31 | 2013-05-31 | Oil body containing oil body protein and collagen fusion protein |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103276002A CN103276002A (en) | 2013-09-04 |
CN103276002B true CN103276002B (en) | 2015-01-07 |
Family
ID=49058621
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201310212250.7A Expired - Fee Related CN103276002B (en) | 2013-05-31 | 2013-05-31 | Oil body containing oil body protein and collagen fusion protein |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103276002B (en) |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104274343A (en) * | 2013-07-09 | 2015-01-14 | 吉林农业大学 | Recombinant collagen polypeptides containing vegetable oil body skin-care emulsion |
CN105177037B (en) * | 2015-09-21 | 2018-12-11 | 长春师范大学 | Utilize double oil body protein fusion technological expression collagens |
CN106701784B (en) * | 2017-01-24 | 2020-04-17 | 河南农业大学 | Soybean oil body protein gene GmOLEO1, and coding protein and application thereof |
Family Cites Families (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1986818B (en) * | 2006-12-25 | 2010-09-08 | 吉林农业大学 | Plant oil-body expression vector and process of expressing human epidermal growth factor with plant oil-body |
CN102988257B (en) * | 2012-12-10 | 2015-03-04 | 北京莱米瑞克科技发展有限公司 | Liposome sun-screening skin care product |
CN102988200B (en) * | 2012-12-10 | 2014-09-17 | 北京莱米瑞克科技发展有限公司 | Liposome face-nourishing skin care product |
-
2013
- 2013-05-31 CN CN201310212250.7A patent/CN103276002B/en not_active Expired - Fee Related
Also Published As
Publication number | Publication date |
---|---|
CN103276002A (en) | 2013-09-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU638248B2 (en) | Potato alpha-amylase genes | |
TWI607085B (en) | Manipulating fructan biosynthesis and enhancing plant biomass | |
CN1930293B (en) | Transgenic plants with reduced level of saturated fatty acid and methods for making them | |
CN102250227B (en) | Plant sucrose transport protein, and coding gene and application thereof | |
BRPI1002997A2 (en) | transgenic saccharin sorghum with altered lignin composition and process of preparation thereof | |
BRPI0806507A2 (en) | differential expression of specific subgenomic alleles in cotton and their uses | |
CN106480063A (en) | A kind of tea tree myb transcription factor CsAN1 and its application in regulation and control anthocyanidin metabolism | |
CN103276002B (en) | Oil body containing oil body protein and collagen fusion protein | |
CN113845578B (en) | MYB transcription factor for regulating and controlling synthesis of plant procyanidine, and coding gene and application thereof | |
CN101628941B (en) | Bovine lactoferrin antibacterial peptide fusion protein, coding gene and application thereof | |
CN104404043A (en) | Promoter of gene Me094 related to bacterial-blight resistance of Oryza meyeriana | |
CN104274343A (en) | Recombinant collagen polypeptides containing vegetable oil body skin-care emulsion | |
CN103468737B (en) | A kind of vegetable oils containing keratinocyte growth factor KGF2 | |
CN103333915B (en) | A kind of vegetable oils facial treatment milk containing Prostatropin active polypeptide | |
US9238818B2 (en) | Methods and genetic constructs for modification of lignin composition of corn cobs | |
CN103343137B (en) | Vegetable oil body skin-care emulsion containing epidermal growth factor active polypeptide | |
US20090158472A1 (en) | Transformant plant | |
CN105177037B (en) | Utilize double oil body protein fusion technological expression collagens | |
CN106148368B (en) | Chrysanthemum chitinase CmCHI gene and its application | |
CN103343138A (en) | Vegetable oil body skin-care emulsion containing acidic fibroblast growth factor active polypeptide | |
CN103320457B (en) | A kind of vegetable oils containing CoQ10 | |
CN111793641B (en) | Application of sweet cherry PavSS or PavSPS gene in regulation and control of fruit coloring or fruit ripening and softening | |
CN103602683B (en) | Psoralea corylifolia seed specific promoters and the application on genetically modified plants thereof | |
CN103333258B (en) | A kind of signal peptide-histone h1 fusion rotein and encoding gene thereof and application | |
TW201009076A (en) | Promotor having high expression strength and high amount expression in plant tissues and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150107 Termination date: 20170531 |