CN105177037B - Utilize double oil body protein fusion technological expression collagens - Google Patents

Abstract

The invention discloses the oil bodies containing double oil body proteins Yu collagen small peptide fusion protein, the double oil body proteins of arabidopsis are merged with recombinant collagen small peptide using recombinant DNA technology, construct fusion gene expression plasmid expression vector pKO-OL-OL-Col, conversion is into oil crops, express fusion protein, obtain the oil body containing double oil body proteins Yu collagen small peptide fusion protein, it is easy to operate, it is low in cost, expression quantity is high, oil body containing double oil body proteins Yu recombinant collagen small peptide fusion protein, the activity of collagen with higher, the production of cosmetics can be directly applied to, reduce production cost, be omitted collagen purification and with emulsifier (or protective agent) mixed process, double oil bodies and fusion protein one preferably protect recombined collagen small peptide.

Description

Utilize double oil body protein fusion technological expression collagens

Technical field

The invention belongs to molecular biology fields, and in particular to the double oil body proteins of soybean and collagen small peptide fusion protein And the oil body containing the fusion protein.

Background technique

Collagen, it is a kind of biological polymer substance that English scientific name, which is Collagen, is much dynamic without vertebra Object and vertebrate in-vivo content protein the most abundant, the 20%-30% for accounting for about vivo protein total amount is extracellular matrix (ECM) a kind of protein possesses one or several triple-helix structure regions being made of α chain, i.e. collagen domain.By many decades The research and development come, it has been found that and confirmed the collagen of 27 seed types, wherein accounting for about 90% I-type collagen content Highest.

Collagen molecules are a long 3000A, and it is one of known longest protein, glue that diameter, which is the shaft of 15A, The former most common structure feature of albumen is triple-helix structure, is mutually turned around by 3 left hand helix chains and twists into one close right hand Composite screw structure keeps its molecular structure highly stable.Collagen molecules are made of the similar more skin chains of 3 sizes, and 3 More skin chains have helical conformation.3 spirals are wound mutually, form a supercoil.In this supercoil, each residue rises 2.9A, each circumference have 3.3 residues.This skin more than three strands is combined with hydrogen bond formation mutually, and distinctive three strands of collagen Superhelix makes collagen property sufficiently stable, and common processing temperature and heat treatment in short-term cannot make collagen Protein breakdown.

The collagen domain of collagen has some tripeptides being repeated cyclically, as Gly-Pro-Y, glycine-X-Y, Gly-Pro-Hyp (X, Y represent other any amino acid residues in addition to glycine and proline).Wherein, Glycine is 1/3 of total amino acid content in collagen, i.e., each two other amino acid residues just will appear a sweet ammonia Acid.So its peptide chain can be expressed as Gly-X-Y.

For collagen, there are many biological effectiveness, such as: 1, soluble collagen immunity is very low, without Dissolubility collagen immunity is comparatively lower, and body will not generate chronic rejection to it in normal circumstances；2, collagen Albumen can induce epithelial cell etc. to be proliferated, broken up and migrated.In embryonic development and the wound healing of adult and tissue During remodeling, the interaction of collagen and cell is an essential feature of cellular activity, and collagen is to upper The formation of skin plays promotion and inducing action；3, its distinctive triple-helix structure due to collagen, makes most albumen Enzyme can only cut off its pendant moiety, and only clostridiopetidase A can just degrade collagen, be broken its peptide chain, go forward side by side one Step is hydrolyzed；4, anthemorrhagic performance: the inner membrance undertissue that the endangium being damaged is exposed is mainly collagen, it can It discharges with induced platelet and collectively constitutes tampon with blood platelet and play anastalsis；5, biocompatibility: collagen and host Having good interaction between cell and its tissue is biocompatibility.As the collagen of extracellular matrix skeleton, Its unique triple-helix structure, make its before it is absorbed after all show good biocompatibility.

Due to collagen have effects that it is many, collagen application it is also very extensive.Usually, food grade Collagen mostly come from ossein, tendon and the corium of animal.The soft fine and smooth, appearance of the mouthfeel of food grade collagen be white, Taste is light, is easy digestion, and the superiority incomparable with other materials: being 1. used to manufacture the edible packages material such as casing Material.2. the unique triple-helix structure of collagen macromolecular, makes it have certain thermal stability.3. can be used as solidifying in food Glue and filler.4. collagen have close fibre structure, this structure make collagen-based materials show very strong intensity with Toughness is suitable for preparing various thin-film materials.

Collagen can provide the nutrient of needs for skin regeneration, and strong support can be provided for skin corium, promote skin It repairs, to make skin keep solid and there is elasticity.Collagen can reduce the color spot and sunburn of skin, reduce face wrinkle Line, so that skin be made to become soft and moist gloss.Therefore, the collagen that supplement skin is lost can delay aging, and play The effect of beauty.At least following 4 kinds of cosmetology functions of collagen.1. facial mask has good biofacies due to collagen Capacitive and affinity is stronger, and have good performance of keeping humidity, therefore it is the first choice for making facial mask.2. moisture-keeping function hydrolysis Contain a large amount of hydrophilic radical, and alanine, aspartic acid, glycine, the silk ammonia itself contained in collagen molecules Acid is also all moisturizing factor, and the moisture content of skin can be enhanced, and then has the function that keep moisture of skin.3. whitening function Collagen is easy to be deep into corium through epidermis, and the tyrosine residue being rich in can effectively inhibit the life of melanin At, and achieve the purpose that whitening.4. skin bottom can directly be penetrated by repairing the active collagen of skin, and And it is good with the compatibility of surrounding tissue, can helper cell manufacture collagen, Skin Cell normally grown also to have promote Into effect.At the same time, active collagen can also promote the metabolism of skin histology, and itself also has anti-inflammatory Effect.

Oil body is as emulsifier.It is obtained in production food, feed, drug, personal care product and industrial products etc. wide General application.It is more environmentally-friendly compared with the emulsifier from mineral and renewable.Oil body protein is main memebrane protein in oil body.Oil There are 2-4 hypotypes for body protein.They can show different phenotypes, and sprouting along with seed in Seed development It sends out and changes.Oil body protein is the hydrophobin of alkalinity, and three parts form oil body proteins: the C-terminal and N-terminal of lipophilic, and Intermediate hydrophobic region, it is entered inside oil body by immobilized artificial membrane.N-terminal and C-terminal are then embedded in oil body surface, are exposed to cell In matter.The structure of oil body protein and its specificity, make oil body be widely used in biotechnology.Heavy wool body protein The freexing tolerance of seed and the integrality of emulsion stability and oil body structure after imbibition can be increased, 2-3 Oleosin molecule connects GFP molecule (oleosin-oleosin-GFP, oleosin-oleosin- oleosin-GFP), especially GFP are located at two (oleosin-GFP-oleosin), which is better than single oil body (single-oleosin), between oleosin molecule can be improved GFP Expression quantity, and this structure will not influence plant vigor and physiology or oil body and stablize, and be conducive to Plant Biotechnology more Good commercialization.

Summary of the invention

The object of the present invention is to provide a kind of double oil body proteins of soybean and the fusion of collagen small peptide and its eggs of expression It is white.

A kind of antigen-4 fusion protein gene, it is to be formed by the double oil body proteins of soybean with collagen small peptide Gene Fusion, base sequence Column are as shown in sequence table SEQ ID NO.5；

A kind of fusion protein, it is the albumen expressed by said gene；

A kind of expression vector pKO-O-O-Col, it is prepared by the following method:

1) using p1390 as basic framework, its area T-DNA is transformed, obtains the basic matter of p1390-35S-Bar-NOS Grain, cylinder claim: pO；

2) digestion is distinguished with pstI and EcoRI and connect genes of SEQ ID NO.1 shown in pO plasmid and sequence table 1, obtain Between carrier pO1；

3) p O1 EcoRI and NcoI is digested, is connect with the soybean oil body protein gene of clone, obtains intermediate vector pOB；The cloning vector of pUC57- terminator HindIII and kpnI is digested, target fragment no terminator is recycled, uses simultaneously Terminator connect with the pOB carrier after digestion, produces plant specific expression carrier by the two enzymic digestions pOB intermediate vector pKO-O；

The terminator, nucleotide sequence is as shown in sequence table SEQ ID NO.2；

The soybean oil body protein gene, nucleotide sequence is as shown in sequence table SEQ ID NO.3；

4) digestion is distinguished with Hind III with NcoI and connect plant expression vector pKO-O and sequence table SEQ ID NO.5 institute Show gene, obtains expression vector pKO-O-O-Col.

Oil body containing double oil body proteins Yu collagen small peptide fusion protein, it is prepared by the following method: by a kind of expression Carrier pKO-O-O-Col is converted into oil crops, and harvest seed extracts oil body.

The present invention provides the oil body containing double oil body proteins Yu collagen small peptide fusion protein, the artificial synthesized glue of the present inventor Former small peptide Col gene, using recombinant DNA technology by the double oil body proteins of soybean and collagen small peptide Gene Fusion, insertion is with p1390 The plant specific expression carrier pKO of basic framework transformation, the double oil body proteins of soybean and collagen small peptide Col gene expression plasmid are expressed Carrier pKO-O-O-Col converts into oil crops, expresses fusion protein, obtains containing double oil body proteins and collagen small peptide The oil body of fusion protein, so that fusion protein expression be made to greatly improve.Containing double oil body proteins and collagen small peptide fusion protein Oil body, antioxidant activity with higher, the purification process and collagen small peptide and emulsifier that collagen small peptide is omitted (or are protected Protect agent) mixing processing technology, reduce production cost.It may be directly applied to the exploitation of external preparation and its cosmetics, oil Body and oil body fusion protein are integrated, and can preferably protect recombinant collagen small peptide, the effect of similar PEG modification, recombinant collagen The oil body of small peptide is applied in the products such as cosmetics, hair nursing, directly makees at the same time it can also directly carry recombinant collagen small peptide For affected part, the effect of external drug is preferably played.Oil body is also used as emulsifier, the oil body containing recombinant collagen small peptide It can be used for treating the ingredient in skin disease class drug and oral medicine, promote the absorption of recombinant collagen small peptide.

Have the characteristics that easy to operate, low in cost, expression quantity is high with the method for this method production recombinant collagen small peptide；? Purification phase, since double oil body proteins and recombinant collagen small peptide are mutually coupled expression, so passing through the side of various concentration gradient centrifugation Method can remove 95% or more foreign protein, purify fusion protein.

Detailed description of the invention

The double oil body expression vector pKO-O-O-Col schematic diagrames of the plant of Fig. 1 gene of small peptide containing recombinant collagen；

The SDS-PAGE of Fig. 2 recombinant collagen small peptide detects figure；

The Western Blot of Fig. 3 recombinant collagen small peptide detects figure；

The cytoactive detection figure of Fig. 4 recombinant collagen small peptide.

Specific embodiment

Embodiment 1: the clone of soybean oil body protein gene

It takes soya seeds, extracts DNA genome, with primer:

1:ATGACCACAGTGCCACC

2:TCCTCCAGATGGTCCTCCT

Carry out amplification soybean oil body protein gene, through being sequenced, base sequence such as sequence table 3(SEQ ID NO.3) shown in； The segment of amplification is digested through restriction enzyme (NcoI enzyme and EcoRI enzyme), is cloned into pUC57 cloning vector, is saved backup.

Embodiment 2: the synthesis of recombined collagen small peptide gene C ol

Collagen small peptide is transformed according to favorite plant codon first, by the less rare amino acid of content in plant Codon is substituted for the codon of favorite plant.Digestion position used in this experiment is eliminated according to the degeneracy of codon Point sends to Shanghai Sheng Gong bioengineering Co., Ltd and carries out artificial synthesized recombined collagen small peptide gene (SEQ ID NO.4).

Embodiment 3: clone's soya seeds specific promoter

In order to clone seed-specific expression promoter from soybean genomic sequence, using primer, using the polymerase chain of standard Formula reacts (PCR), and amplification obtains the DNA fragmentation of 402bp from Soybean genomic DNA, and the segment of amplification is through restriction enzyme Digestion, is cloned into pUC57 cloning vector, saves backup.

Soya seeds specific promoter primer

Primer5F: ACTAATTTCATTAAATGCTATGC

Primer5R:GGTCATGGTTGAAGGTG.

The clone of embodiment 4:nos terminator

The gene order that no is searched in NCBI, is then sent for Shanghai Sheng Gong bioengineering Co., Ltd and is manually closed At no gene (SEQ ID NO.2).

Embodiment 5: building plant specific expression carrier pKO-O

The cloning vector of pUC57- soya seeds specific promoter is digested with restriction enzyme pstI and EcoRI, is returned Target fragment soya seeds specific promoter sequence is received, while digesting basic plasmid pO(using p1390 as base with pstI and EcoRI Its area T-DNA is transformed by this skeleton, is obtained the basic plasmid of p1390-35S-Bar-NOS, is abbreviated as pO plasmid), by soybean Seed-specific expression promoter is connect with basic plasmid pO, converts Escherichia coli, generates pO1 intermediate vector；By p O1 with EcoRI and NcoI digestion, connect with the soybean oil body protein gene of clone, obtains intermediate vector pOB；The clone of pUC57- terminator is carried Body is digested with HindIII and kpnI, recycles target fragment no terminator, while using the two enzymic digestions pOB intermediate vector, general Terminator is connect with the pOB carrier after digestion, is converted Escherichia coli, is produced plant specific expression carrier pKO-O(and see Fig. 1).

Embodiment 6: the specific expression carrier pKO-O- containing soybean double oil body proteins and collagen small peptide fusion is constructed O-Col is using the soybean oil body protein gene cloned and the collagen small peptide gene of synthesis as template, by fusion DNA vaccine technology, Obtain Oleosin-Col fusion, through being sequenced, base sequence such as sequence table 5(SEQ ID NO.5) shown in.Base will be merged Because carrying out digestion with restriction enzyme NcoI and HindIII, while digestion is carried out to pKO-O carrier with the two enzymes, then Fusion is connect with the pKO-O carrier after digestion, converts Escherichia coli, generates the double oil body expression of pKO-O-O-Col plant Carrier.

Embodiment 7:pKO-O-O-Col plasmid converts Agrobacterium EHA105

(1) taking 100 μ L Agrobacterium EHA105 competent cells to be placed in 10min in ice bath keeps its thawing spare；

(2) it takes 1 μ L pKO-O-O-Col plasmid to be added in Agrobacterium competent cell, is gently blown and beaten, made with liquid-transfering gun It is uniformly mixed, and ice bath 30 minutes；

(3) it is placed it in immediately after ice bath and freezes 5min in liquid nitrogen, taken out be put into 37 DEG C of thermal shock 5min at once；

(4) plus 1mL is free of resistance YEP fluid nutrient medium into centrifuge tube, and 28 DEG C, 180rpm/min shakes bacterium 4h；

(5) centrifuge 5000rpm is used, 5min is centrifuged, abandons supernatant, 100 μ LYEP culture mediums are added and are resuspended；

(6) re-suspension liquid is coated on containing three anti-(100 μ g/mLRif, 50 μ g/mLKan and 50 μ g/mL Str)) YEP In solid medium tablets, cultivated 2 ~ 3 days in 28 DEG C of insulating boxs.

PKO-O-O-Col is transformed into Agrobacterium competence using this method, picking single colonie carries out liquid concussion training It supports, screens transformant through row bacterium solution PCR, be identified as the Agrobacterium that positive bacterium solution is the pKO-O-O-Col containing target gene Engineering bacterial strain.With 70% glycerol conservation positive strain, -80 DEG C of refrigerators are saved.

Embodiment 8: Agrobacterium-mediated genetic transformation

It takes 1 μ g pKO-O-O-Col Plasmid DNA to be added in 100 microlitres of EHA105 competent cells, mixes gently ice bath Place 5min；It is subsequently placed in liquid nitrogen to go to rapidly in 37 DEG C of water-baths after freezing 5min and incubates 5min, 1mlLB Liquid Culture is added Base, the 180rpm shaken cultivation 4h on 28 DEG C of shaking tables take appropriate bacterium solution to be applied to the LB solid containing streptomysin and kanamycins In culture, 28 DEG C of cultures are set for 24 hours, detect positive single colonie through resistance screening, PCR.It picks from the plate containing pKO-O-O-Col The Agrobacterium single colonie of plasmid, is inoculated into 5mlLB fluid nutrient medium, and shaken cultivation is overnight, and 100 microlitres of bacterium solutions is taken to be inoculated into In 50mlLB fluid nutrient medium, 28 DEG C, 180rpm shaken cultivation to OD600 is 0.8, is then centrifuged for being resuspended, suspension OD=0.6 ?.

The plant cotyledons section such as safflower, corn, rape, peanut is infected into 10min in re-suspension liquid, is placed on containing suitable hormone Culture medium on cultivate, then go on the screening and culturing medium containing 0.5%basta and 250mg/L cephalosporin and cultivate, about Visible resistant buds occur after 30d, after resistant buds are elongated to 2cm, are transferred in root media.

Embodiment 9: the PCR detection of transgenic plant

The genomic DNA for extracting transgenic plant is merged with soybean oil body protein gene with Col using genome as template Gene primer expands soybean oil body protein gene and Oleosin-Col Gene Fusion genetic fragment, amplifies expected purpose item Band.

Embodiment 10: the high transgenic line of screening expression quantity

Transgenic line ties up to greenhouse or crop field through growth and development, then blossoms and has seeds, and forms transgenosis T1 for seed, when After T1 is harvested for seed, every plant of transgenic plant takes 200-1000mg, and oil body protein and Col are extracted in extracting solution merges egg It is white, using Western blot method, sxemiquantitative is carried out to recombinant collagen small peptide, is control with pKO-OL-Col, filters out height The transgenic line of expression.The result shows that the pKO-O-O-Col recombinant vector that the present invention constructs is through the red of agrobacterium mediation converted Flower, soybean, rape, peanut plant are compared with pKO-OL-Col, pOBTcol, through the plant of agrobacterium mediation converted, expression quantity It significantly improves, as shown in the table:

Embodiment 11: the transgenic seed oil body containing oleosin-oleosin-Col fusion protein extracts and SDS- PAGE and Western-blot detection

(1) 200 ~ 1000mg transgenic seed is taken, is put into mortar, 1ml Buffer A is added, is fully ground with pestle. Until solution becomes cloudy, kind of grain is not seen.It is put into centrifuge 12000rpm, 4 DEG C, is centrifuged 10min；

(2) solution is divided into three layers after being centrifuged, i.e. surface layer is white oil layer, middle layer liquid and bottom sediment.By upper layer Oil body fraction and liquid portion are uniformly mixed, and are all sucked out, and are careful not to that bottom sediment is sucked out, the liquid of suction is transferred to separately In one centrifuge tube, add Buffer A, is centrifuged, 1,2 steps of repetition, 3 ~ 4 times；

(3) the Buffer B of 500 μ l is added to mix the liquid for repeating to be sucked out after the centrifugation of 1,2 steps, 4 DEG C in centrifuge, 12000rpm is centrifuged 10min；

(4) it is divided into two layers after being centrifuged at this time, is upper layer oil fraction and lower liquid part, lower liquid is sucked out, abandons Fall.Repeat 3,4 steps, 3 ~ 4 times；

(5) in the EP pipe containing oil fraction, 80 μ l Buffer B and 20 μ l sample-loading buffers is added, are mixed, boiling water In boil 10min, take 10 μ l to be identified with 10% SDS-PAGE and Western-blot, see Fig. 2,3.Transgenosis as can be seen from Fig. 3 There is specific band, and wild type no band at this in 48kDa left-right position in plant.Further demonstrate Oleosin It has been expressed in seed with Oleosin-Oleosin-Col fusion protein.

Buffer A:0.2M Sucrose, 0.4M NaCl, 0.02M Tris-HCl (pH=7.5)；

Buffer B:10 mM Na2HPO4,10 mM NaCl (pH=7.5).

Embodiment 12: the anti-oxidant detection of the oil body containing oleosin-oleosin-Col fusion protein

With oil body of the mtt assay measurement containing oleosin-oleosin-Col fusion protein, wild type oil body and positive control Standard college albumen is shown in Fig. 4 to the Mitogenic activity of Balb/c 3T3 cell.The result shows that the oil body containing fusion protein ED50 is 1.7ng/ml, and the ED50 of wild type oil body is 0.45ng/ml, and the ED50 of positive control standard college is 1.8ng/ ml。

Oil body containing double oil body proteins Yu recombinant collagen small peptide fusion protein, may be directly applied to opening for cosmetics Hair, oil body is as a kind of protective agent, such as in skin care item and medicinal skin care item, can protect recombinant collagen small peptide, and similar PEG is repaired Oil body containing recombinant collagen small peptide is directly applied in the products such as toner, hair nursing by the effect of decorations.

<110>Changchun normal university

<120>double oil body protein fusion technological expression collagens are utilized

<160> 5

<210> 1

<211> 402

<212> DNA

<213>artificial

<400> 1

actaatttca ttaaatgcta atgcagattt tgtgaagtaa aactccacat tatgatgaaa 60

aataccacca acaccacctg cgaaactgta tcccaactgt ccttaataaa aatgttaaaa 120

agtatattat tctcatttgt ctgtcataat ttatgtaccc cactttaatt tttctgatgt 180

actaaaccga gggcaaactg aaacctgttc ctcatgcaaa gcccctactc accatgtatc 240

atgtacgtgt catcacccaa caactccact tttgctatat aacaacaccc ccgtcacact 300

ctccctctct aacacacacc ccactaacaa ttccttcact tgcagcactg ttgcatcatc 360

atcttcattg caaaacccta aacttcacct tcaaccatga cc 402

<210> 2

<211> 250

<212> DNA

<213>artificial

<400> 2

cgttcaaaca tttggcaata aagtttctta agattgaatc ctgttgccgg tcttgcgatg 60

attatcatat aatttctgtt gaattacgtt aagcatgtaa taattaacat gtaatgcatg 120

acgttattta tgagatgggt ttttatgatt agagtcccgc aattatacat ttaatacgcg 180

atagaaaaca aaatatagcg cgcaaactag gataaattat cgcgcgcggt gtcatctatg 240

ttactagatc 250

<210> 3

<211> 687

<212> DNA

<213>artificial

<400> 3

atgaccacag tgccaccaca cagtgtccaa gtgcacacaa caacacaccg ctacgaagcc 60

ggcgtcgtcc ccgccggctc gttttgaggc gccgcgttac gaagccggca tcaaggcgcc 120

ctcttccatt taccattccg agagaggtcc gacgacctct caggttctcg cagttgtcgc 180

cggccttccg gtcggcggca tcctcctgct cctggcagga ctgaccctgg ctggaactct 240

caccgggctg gtggtggcaa caccgctctt catcatcttc agcccggtgc tgattccggc 300

cacggtcgca attggcctgg ccgtggccgg gttcctgacg tcgggagtct ttgggctcac 360

ggcgctgtcg tccttctcct ggatcctgaa ctacatccgg gagacccagc cggcgtcgga 420

gaatctggcc gctgcggcga agcaccatct ggcggaggcg gcggagtacg tggggcagaa 480

gaccaaagaa gtagggcaga aaaccaagga agttgggcag gatattcaga gcaaggcaca 540

agatacaagg gaagcagctg caagagatgc aagagagcaa gggaagcagc tgcaagagat 600

gcaagggatg caaaggtgga ggcgagagat gtaaagagaa caacagtgac agcaacaacc 660

gcaaccgcag gaggaccatc tggagga 687

<210> 4

<211> 308

<212> DNA

<213>artificial

<400> 4

atggtgagcc tggaaaccct ggatctcctg gaaaccaagg tcagcctgga aacaagggtt 60

caccaggaaa tccaggacaa cctggaaacg agggtcagcc tggtcagcca ggacaaaacg 120

gtcaacctgg agagcctgga tctaacggac cacagggttc tcagggtaat cctggaaaga 180

acggacagcc aggatcacct ggatctcagg gatctccagg taaccaggga tctcctggtc 240

aaccaggtaa tccaggtcag ccaggtgagc agggaaagcc tggtaatcag ggaccagccg 300

gtggaagc 308

<210> 5

<211> 996

<212> DNA

<213>artificial

<400> 5

atgaccacag tgccaccaca cagtgtccaa gtgcacacaa caacacaccg ctacgaagcc 60

ggcgtcgtcc ccgccggctc gttttgaggc gccgcgttac gaagccggca tcaaggcgcc 120

ctcttccatt taccattccg agagaggtcc gacgacctct caggttctcg cagttgtcgc 180

cggccttccg gtcggcggca tcctcctgct cctggcagga ctgaccctgg ctggaactct 240

caccgggctg gtggtggcaa caccgctctt catcatcttc agcccggtgc tgattccggc 300

cacggtcgca attggcctgg ccgtggccgg gttcctgacg tcgggagtct ttgggctcac 360

ggcgctgtcg tccttctcct ggatcctgaa ctacatccgg gagacccagc cggcgtcgga 420

gaatctggcc gctgcggcga agcaccatct ggcggaggcg gcggagtacg tggggcagaa 480

gaccaaagaa gtagggcaga aaaccaagga agttgggcag gatattcaga gcaaggcaca 540

agatacaagg gaagcagctg caagagatgc aagagagcaa gggaagcagc tgcaagagat 600

gcaagggatg caaaggtgga ggcgagagat gtaaagagaa caacagtgac agcaacaacc 660

gcaaccgcag gaggaccatc tggaggaatg ggtgagcctg gaaaccctgg atctcctgga 720

aaccaaggtc agcctggaaa caagggttca ccaggaaatc caggacaacc tggaaacgag 780

ggtcagcctg gtcagccagg acaaaacggt caacctggag agcctggatc taacggacca 840

cagggttctc agggtaatcc tggaaagaac ggacagccag gatcacctgg atctcaggga 900

tctccaggta accagggatc tcctggtcaa ccaggtaatc caggtcagcc aggtgagcag 960

ggaaagcctg gtaatcaggg tcagccagga ccagcc 996

Claims (2)

1. a kind of expression vector pKO-O-O-Col, it is prepared by the following method:

1) using p1390 as basic framework, its area T-DNA is transformed, obtains the basic plasmid of p1390-35S-Bar-NOS, cylinder Claim: pO；

2) digestion is distinguished with pstI and EcoRI and connect nucleotide sequence shown in pO plasmid and SEQ ID NO.1, obtain intermediate load Body pO1；

3) p O1 EcoRI and NcoI is digested, is connect with the soybean oil body protein gene of clone, obtains intermediate vector pOB；It will The cloning vector of pUC57- terminator is digested with HindIII and kpnI, recycles target fragment no terminator, while using the two Terminator connect with the pOB carrier after digestion, produces plant specific expression carrier pKO-O by enzymic digestion pOB intermediate vector；

The terminator, nucleotide sequence is as shown in sequence table SEQ ID NO.2；

The soybean oil body protein gene, nucleotide sequence is as shown in sequence table SEQ ID NO.3；

4) digestion is distinguished with Hind III with NcoI and connect base shown in plant expression vector pKO-O and sequence table SEQ ID NO.5 Cause obtains expression vector pKO-O-O-Col.

2. the oil body containing double oil body proteins Yu collagen small peptide fusion protein, it is prepared by the following method: by claim 1 institute A kind of expression vector pKO-O-O-Col stated is converted into oil crops, and harvest seed extracts oil body.