CN104274336A - Skin care emulsion serving as vegetable oil body and containing active peptides of coenzyme Q10 - Google Patents

Abstract

The invention relates to a skin care emulsion serving as a vegetable oil body and containing active peptides of a coenzyme Q10 and particularly relates to a novel formula of an emulsion. The skin care emulsion comprises a water-phase component, carboxyethyl cellulose is used as an emulsifying agent, a safflower oil body is used as an oil-phase component of a substrate, an Arabidopsis thaliana oil body containing CoQ10 is used as a functional component, a coupling agent PEG600 is adopted, methylparaben and propylparaben are used as preservatives, and crocus sativus is used as an essence. According to the skin care emulsion, the Arabidopsis thaliana oil body containing CoQ10 and the safflower oil body substrate are uniformly distributed in a moisturizing emulsion by using an emulsifying technology, and the carboxyethyl cellulose serving as the emulsifying agent is added, so that the interfacial tension can be reduced, and the emulsion can be favorably formed and stabilized. The specific surface area of the vegetable oil body is relatively large, so that the emulsion is more easily absorbed by skins, and furthermore, a breathable protective film can be formed on the surfaces of the skins; in addition, by using the vegetable oil body serving as a natural emulsifying agent, CoQ10 can be distributed into the oil body and can be more easily absorbed by the skins, so that skin aging can be effectively delayed or inhibited.

Description

A kind of vegetable oils facial treatment milk containing coenzyme Q10 active polypeptide

Technical field

The invention belongs to cosmetics manufacturing technology field, especially relate to a kind of facial treatment milk of vegetable oils of coenzyme Q10 active polypeptide.

Background technology

Coenzyme Q10 (coenzyme Q, CoQ10) is also known as ubiquinone (ubiquinone, UQ, Q).CoQ10 is a kind of and the untight coenzyme of protein bound in respiratory chain; it is the fat-soluble quinones extensively existed in organism; play an important role in proton displacement and electron transmission in human body respiration chain; can be used as cellular metabolism and Cellular respiration activator; or important antioxidant and nonspecific immunity strengthening agent; mitochondrial peroxidating can be suppressed; there is accelerating oxidation phosphorylation reaction; protection biofilm structure integrity; nonspecific potentiation is had to immunity; increase antibody to produce, improve T cell function.

CoQ10 is widely used in a lot, first the application of CoQ10 in field of medicaments comprise 1, the application of CoQ10 in oral disease; 2, the application of CoQ10 in cardiovascular disease; 3, the application of CoQ10 in acquired immune deficiency syndrome (AIDS); 4, the research of CoQ10 in diabetes; 5, otherwise application.In recent years add the skin protection cosmeticss such as the health food of CoQ10, essence, emulsion and foundation cream to sell well rapidly market, as a kind of important life nutritional material, CoQ10 has important effect.1, CoQ10 has effect of protection skin; CoQ10 penetrates into the oxidation reaction that skin growth layer can weaken photon; specific phosphorylated tyrosine kinase can be started under the assistance of fertility alcohol; prevent the oxidative damage of DNA; suppress the expression of irradiation under ultraviolet ray human skin fibroblast Collagenase, protection skin avoids damage.2, the application of coenzyme Q10 in washing articles for use; Coenzyme Q10, as a kind of Natural antioxidant, can be used for scavenging activated oxygen, delay skin aging, effectively can go deep into skin, and activated cell is active, improves skin quality; There is promotion skin metabolism, repair effect of the aspects such as wrinkle of skin, according to the demand of cosmetics difference in functionality, various different product can be modulated.3, coenzyme Q10 is in the application in oral care implement field; Coenzyme Q10 can improve microcirculation, promotes to organize microcirculqtory system metabolism, strengthens tissue cell activity, accelerates cell turnover, is beneficial to cell tissue maintenance, reparation; Have powerful oxidation resistance, the edema of prevention dental tissue cell, film rupture and death, strengthen gingiva protective capability, the old and feeble degeneration of dental tissue caused by prevention D mono-galactose.

Because coenzyme Q10 has great use value on the fields such as medicine, food additive, thus the research of this product and exploitation cause the concern of more and more people.At process aspect, in recent years, the new product of coenzyme Q10 is much more popular on the developed country markets such as America and Europe and Japan, Chinese Enterprise has also grasped the advanced technologies such as biological extraction method, semi-chemical synthesis and fermentable extraction method gradually, therefore, the product producing this market prospect fabulous at Chinese Speeding up development becomes the task of top priority.

Utilize plant bioreactor to produce pharmaceutical protein, more and more receive the concern of people in recent years, oil body protein is memebrane protein main in oil body.Oil body protein is the hydrophobin of alkalescence, and three parts form oil body protein: the C end of lipophilic and N end, and middle hydrophobic region, it enters into oil body inside by immobilized artificial membrane.N end and C end are then embedded in oil body surface, are exposed in Cytoplasm.Oil body protein has surfactant, makes it can not be combined with oil body.This non binding of oil body is very suitable as emulsifying agent.Emulsifying agent can reduce the interfacial tension between immiscible liquid, makes it to become emulsion.Oil body emulsifying agent extracts from natural oilseed, and the structure of oil body protein and its specificity, make oil body be widely used in biotechnology, and such as it can as emulsifying agent, carries and fixing recombiant protein etc.It can also be applied to purification, refolding and fixing recombiant protein, on oil body surface, destination protein and oil body protein are combined by two kinds of modes usually, are respectively to express in oil body with oil body protein fusion and be connected with oil body protein as affinity tag by part.The present invention is according to vegetable oils characteristic, coenzyme Q10 gene is made to be connected to N end or the C end of oil body protein gene, gene fusion construct, makes destination protein specific expressed in vegetable oils, utilizes the characteristic that oil body lipophilic is hydrophobic, after seed is pulverized, through different extracting solution extracting, reclaim oil phase, both fusion rotein and other components intracellular can be separated, simplify purification procedures, reduce purification cost and production cost.

In recent years, biology gene engineering technology tremendous development and had influence on the every aspect of life sciences, all bring brand-new opportunity to develop also to cosmetics industry, cosmetics have been improved looks from the beauty treatment of traditional chemistry, plant beauty to biological beauty and gene and have been developed simultaneously.Such as, traditional skin nursing is only confined to oil film and covers and keep the physical methods such as moisture, and beauty and skin care theory starts the nursing turning to cellular level now, and the cosmetics therefore containing the biotic factor material of high-affinity arise at the historic moment.Nowadays, increasing medicine and biotechnology expert throw oneself into this research field in the world, and many countries also all aim at this great market of biological cosmetics, exploitation biological beauty product.Somatomedin, hyaluronic acid and the nucleic acid etc. obtained with biotechnology are applied to cosmetics, these new research trends also make people recognize biological cosmetics will bring the change of essence to cosmetics quality.

Biological cosmetics refers to the cosmetics that applied bioengineering technology and goods thereof obtain, its main component biologically active polypeptide major part is cell growth factor, content is atomic in vivo for they, but biological activity is high, biological regulation effect is played to various kinds of cell physiological function and metabolic activity, affect the growth of polytype cell, division, differentiation, propagation and migration directly or indirectly, play an important role in beauty and skin care, plastic surgery, burn ulcer and various dermopathic wound repair with healing.Cell growth factor to be modified or after special conservation treatment through stable structure; add in cosmetics with certain valid density, can effectively and Skin Cell have an effect, promote epithelial cell Nutrition and Metabolism; protection skin, prevents the skin injury because a variety of causes causes.Normal skin protection kind adds the function that competent cell somatomedin effectively can also promote subcutaneous collagen cell, accelerates the growth of skin collagen cell, makes cell accelerate secretion collagen, thus reaches crease-resistant and the effect of slow down aging.

Summary of the invention

The object of the invention is to provide a kind of skin care item containing coenzyme Q10 active polypeptide, comprises facial treatment milk, gives full play to the oil body Transdermal absorption effect of coenzyme Q10 albumen.

This skin-protection product provided by the invention is achieved by the following technical programs: a kind of facial treatment milk containing coenzyme Q10 (COQ10) active polypeptide, be made up of the raw material of following weight portion: oiliness raw material 20% (wherein glycerol 10%), emulsifying agent 10%, coupling agent 3%, antiseptic 0.25%, essence 2%, nourishing additive agent 8%, vitamin C 5% all the other be deionized water.

The present invention prepares a kind of preparation method containing coenzyme Q10 (COQ10) active polypeptide facial treatment milk, comprises the following steps and is prepared: first extracted by vegetable oils, then join in oil body by water, mix homogeneously; Then add glycerol and emulsifying agent carboxyethyl cellulose step by step, coupling agent PEG600, stirs, and high shear is emulsified at 1000rpm-30000rpm, emulsifying 10-20min in homogenizer; Finally, add the mixed liquor of antiseptic methyl hydroxybenzoate and propylparaben and nourishing additive agent after stirring again and contain the vegetable oils of coenzyme Q10 active polypeptide and vitamin C and Stigma Croci essence, after stirring product of the present invention.

The present invention is that the fusion expressed product of the oil body protein and coenzyme Q10 that utilization is embedded in oil body surface can directly as the exploitation of active component for skin care item; simplify the processing technique that somatomedin mixes with emulsifying agent (or protective agent), reduce production cost.The biological activity of coenzyme Q10 albumen can be protected simultaneously; coenzyme Q10 active polypeptide is utilized the characteristic of oil body protein; wrapped up by vegetable oils; be positioned at oil body surface; by emulsifying homogeneous technology; coenzyme Q10 albumen can be made to be evenly distributed in very much in facial treatment milk, by the Transdermal absorption effect of oil body, to make it easily play a role.Present invention process is simple, and effect is remarkable, and cost reduces, so technical scheme of the present invention is the technical scheme of high-quality.

Accompanying drawing explanation

Fig. 1 oil body expresses the carrier schematic diagram (oil body expresses the carrier schematic diagram of coenzyme Q10 gene) of CoQ10 gene

Fig. 2 safflower oil bodies microgram

Fig. 3 contains the audio-visual picture (audio-visual picture of the arabidopsis oil body containing coenzyme Q10 albumen) of the arabidopsis oil body of CoQ10 albumen

Fig. 4 contain the arabidopsis oil body of CoQ10 albumen Activity determination (containing coenzyme Q10 albumen the Activity determination of arabidopsis oil body)

Fig. 5 contains the emulsion audio-visual picture (audio-visual picture containing coenzyme Q10 facial treatment milk) of CoQ10 vegetable oils

specific embodiment

Embodiment 1 coenzyme Q10 albumen is expressed in vegetable oils

The nucleotide sequence of Preference to the coenzyme Q10 CoQ10 found from GENBANK according to vegetable codon is transformed, and rare amino acid codon less for content in plant is replaced to the codon of favorite plant.Degeneracy according to codon eliminates restriction enzyme site used in this experiment, sends to Shanghai Sheng Gong biological engineering company limited and carries out synthetic restructuring coenzyme Q10 gene (SEQ ID NO.1).

Embodiment 2 clones phaseolus vulgaris seeds specific promoter and terminator

Clone's Kidney bean promoter and terminator gene, in order to clone seed-specific expression promoter and terminator from bean gene group sequence, utilize primer, the polymerase chain reaction (PCR) of employing standard, from bean gene group DNA, amplification obtains the DNA fragmentation of 1548bp and 1220bp, the fragment of amplification, through digestion with restriction enzyme, is cloned in pUC57 cloning vehicle, saves backup.Through order-checking, its base sequence is as shown in sequence table SEQ ID NO.2 and SEQ ID NO.3.

Kidney bean promoter primer

Primer5F：GAATTCATTGTACTCCCAG

Primer5R：AGTAGAGTAGTATTGAATATGAG

Kidney bean terminator primer

tem5F：AATAAGTATGAACTAAAATGC

tem5R：TTAGTTGGTAGGGTGCTAGGAA

Embodiment 3 builds plant specific expression carrier pOBT

The cloning vehicle of pUC57-Kidney bean promoter restricted enzyme pstI and NcoI is digested, reclaim object fragment Kidney bean promoter sequence, digest basic plasmid pO with pstI and NcoI (take p1301 as basic framework simultaneously, its T-DNA district is transformed, except the NOS gene remaining with T-DNA district, all the other genes are all replaced by 35S and Bar gene, with pEGAD plasmid for template, 35S-F forward primer 47bp cggggtaccAtccgtcaacatggtggagcacgacacgcttgtctact and Bar-R downstream primer 54bpcggaattcactagttcagatctcggtgacgggcaggaccggacggggcggaa cc is utilized to carry out PCR, amplification obtains 35S-Bar gene, before utilizing kpnI and SpeI restriction enzyme site to be inserted into the NOS gene in pCAMBIA1301 carrier T-DNA district, construct the basic plasmid of p1301-35S-Bar-NOS, be abbreviated as pO plasmid), the Kidney bean promoter fusion gene of oil body protein and coenzyme Q10 (be used for start) is connected with basic plasmid pO, transformation of E. coli, obtain pOB intermediate carrier, cloning vehicle HindIII and kpnI of pUC57-terminator is digested, reclaim object fragment Kidney bean terminator, simultaneously with these two enzymic digestion pOB intermediate carriers, terminator is connected with the pOB carrier after enzyme action, transformation of E. coli, obtains plant specific expression carrier pOBT.

The clone of embodiment 4 arabidopsis oil body protein gene

Get arabidopsis seed, extract DNA genome, with primer:

1：CCATGGCGGATACAGCTAGAGG

2：CACCGGGTGGAGTAGTGTGCTGG

Carry out amplification arabidopsis oil body protein gene, through order-checking, its base sequence is as shown in sequence table SEQ ID NO.4; The fragment of amplification, through restricted enzyme (NcoI enzyme and EcoRI enzyme) digestion, is cloned in pUC57 cloning vehicle, saves backup.

Embodiment 5 builds the vegetable oils specific expression carrier pOBT-CoQ10 containing arabidopsis oil body protein and coenzyme Q10 fusion gene

To clone the arabidopsis oil body protein gene obtained and coenzyme Q10 gene of recombinating for template, design fusion gene primer, by fusion DNA vaccine technology, obtain oleosin-CoQ10 fusion gene, through order-checking, its base sequence is as shown in sequence table SEQ ID NO.5.Fusion gene restricted enzyme NcoI and HindIII is carried out enzyme action, with these two enzymes, enzyme action is carried out to pOBT carrier simultaneously, then fusion gene is connected with the pOBT carrier after enzyme action, transformation of E. coli, produces pOBT-CoQ10 plant oil-body expression vector.

Arabidopsis oil body protein and coenzyme Q10 fusion gene primer

1：CCATGGCGGATACAGCTAGAGG

2：CAGCCCAAGCCATAGTAGTGTGC

3：CAGCACACTACTATGGCTTGGGC

4：TTATCTCAGTTCCCACCACTTCAGG

The genetic transformation that embodiment 6 Flora dip method is carried out

First, infecting waters wildtype Arabidopsis thaliana and butch flax plant the previous day irrigates; Agrobacterium tumefaciens attachment being seeded to 50ml contains in the YEP fluid medium of three anti-(100 μ g/ml Rif, 50 μ g/ml Str and 50 μ g/ml Kan), carry out preculture (180rpm/min, 28 DEG C): get pre-incubated Agrobacterium 7ml and join in the YEP fluid medium resisted containing three, carry out amplification culture, until OD5900=1.0 ~ 1.2; Agrobacterium bacterium liquid is moved on in centrifuge tube, and 20 DEG C, the centrifugal 20min of 4000rpm, collects thalline, removes three anti-culture medium.With the resuspended thalline of Flora-Dip Buffer, its OD590 is made to reach 0.8 ~ 0.9.The bud cut kind of a pod before conversion, bloom and show money or valuables one carries unintentionally.Plug the bamboo let of suitably height in alms bowl body surrounding, turn to support the alms bowl body carrying out infecting around.The stem of arabidopsis and blade base are immersed in resuspended Agrobacterium bacterium liquid, leave standstill 7 minutes, then inhale and abandon too much bacterium liquid.Keep flat the alms bowl body after conversion, spend the night with moisturizings such as plastic sheetings, within second day, can slightly reveal a crack, within the 3rd day, normally place.One Zhou Houke carries out secondary infection.After seed maturity, the pod that jaundice is ripe can be plucked every other day, results seed.

Embodiment 7 screens the high transgenic line of expression

Transgenic line in greenhouse or land for growing field crops through growth with grow, then blossom and have seeds, form transgenic T1 for seed, after T1 is for seed harvest, every strain transfer-gen plant gets 200-1000mg, the fusion rotein of extract oil body protein and coenzyme Q10 in extracting solution, detects the expression of restructuring coenzyme Q10 through Enzyme-multiplied immune technique, filter out the transgenic line of high expressed, the strain expression of high expressed reaches 2875.64pg/ml.

Prepared by the oil body of embodiment 8 containing coenzyme Q10 active polypeptide

From the transgenic oil crop seeds containing coenzyme Q10 albumen, extract the oil body containing coenzyme Q10 albumen, save backup, concrete grammar is as follows: (1) gets 0.1mg transgenic seed, puts into mortar, adds 1ml PBS, fully grinds with pestle.Until solution turned cloudy, cannot see kind of a grain.Put into centrifuge 10000rpm, 4 DEG C, centrifugal 10min; (2) centrifugal rear solution is divided into three layers, and namely top layer is white oil layer, intermediate layer liquid, and bottom sediment.By upper strata oil body fraction and liquid part mix homogeneously, whole sucking-off, notes not sucking-off bottom sediment, is moved in another centrifuge tube by the liquid rotating of sucking-off, add PBS, centrifugal 10000rpm, 4 DEG C, 10min, repeat 1,2 steps, 3 ~ 4 times.(3) liquid of the centrifugal rear sucking-off of repetition 1,2 step is added the PBS mixing of 500 μ l, 4 DEG C in centrifuges, 10000rpm, centrifugal 10min.(4) be divided into two-layer after now centrifugal, for upper strata oil fraction and subnatant body divide, by lower floor's liquid sucking-off, discard.Repeat 3,4 steps again, 3 ~ 4 times.

The assay of coenzyme Q10 albumen in embodiment 9 oil body

Transgenic line in greenhouse or land for growing field crops through growth with grow, then blossom and have seeds, form transgenic T1 for seed, after T1 is for seed harvest, every strain transfer-gen plant gets 200-1000mg, the fusion rotein of extract oil body protein and coenzyme Q10 albumen in extracting solution, adopt ELISA method, operate according to ELISA kit (gold medal bio tech ltd, Changchun hundred) description, detect the expression of coenzyme Q10 albumen in oil body, as calculated, in arabidopsis oil body, the expression of coenzyme Q10 is 2875.64pg/ml.

The Activity determination of coenzyme Q10 albumen in embodiment 10 oil body

1, collect logarithmic (log) phase cell NIH3T3 cell and use cell counting count board counting, in 96 hole flat undersides, every hole adds 100ul Cell sap, and cell number is about 6000.

2., 37 DEG C, 5%CO2 cultivates 24h, puts basis of microscopic observation cell monolayer and is paved with at the bottom of hole.Now, gently pour out the complete medium in 96 orifice plates, every hole adds the starvation media of 100ul.

3., 5%CO2,37C cultivate 24 hours, if 7 gradient dosings, every hole 100ul, if 2 multiple holes.Use sterling albumen bFGF as positive control, wildtype Arabidopsis thaliana seed oil bodies is as negative control simultaneously.

4,5%CO2, cultivate 48 hours for 37 DEG C, every hole adds the MTT solution that 25ul concentration is 0.5%,

5,5%CO2,37 DEG C of continuation stop cultivating after cultivating 4h, abandon culture fluid.

6, every hole adds 120ulDMSO, low-speed oscillation 10min, and purple crystal fully dissolves rear enzyme-linked immunosorbent assay instrument and measures under 570nm wavelength.The results are shown in Figure 4.

The extraction of embodiment 11 safflower oil bodies

(1) get 200 ~ 1000mg wild type Semen Carthami, put into mortar, add 1ml Buffer A, fully grind with pestle.Until solution turned cloudy, cannot see kind of a grain.Put into centrifuge 12000rpm, 4 DEG C, centrifugal 30min;

(2) centrifugal rear solution is divided into three layers, and namely top layer is white oil layer, intermediate layer liquid, and bottom sediment.By upper strata oil body fraction and liquid part mix homogeneously, whole sucking-off, notes not sucking-off bottom sediment, is moved in another centrifuge tube by the liquid rotating of sucking-off, add BufferB, centrifugal 18000rpm, 4 DEG C, 10min, repeat 1,2 steps, 3 ~ 4 times.

(3) the Buffer C liquid of the centrifugal rear sucking-off of repetition 1,2 step being added 500 μ l mixes, 4 DEG C in centrifuges, 18000rpm, centrifugal 10min.

(4) be divided into two-layer after now centrifugal, for upper strata oil fraction and subnatant body divide, by lower floor's liquid sucking-off, discard.Repeat 3,4 steps again, 3 ~ 4 times.

Buffer?A：0.6M?Sucrose，0.5M?NaCl，0.05M?Tris-HCl(pH＝7.0)；

Buffer?B：0.4M?Sucrose，0.5M?NaCl，0.05M?Tris-HCl(pH＝7.0)；

Buffer?C：20mM?Na ₂HPO ₄，20mM?NaCl(pH＝7.0)。

Embodiment 12 facial treatment milk recipe determination

A kind of facial treatment milk containing coenzyme Q10 active polypeptide, be made up of the raw material of following weight portion: 5%-25% wetting agent (safflower oil bodies), 10% glycerol, 10%-25% emulsifying agent (carboxyethyl cellulose), 1.5%-8% coupling agent (PEG600), 0.05%-0.5% antiseptic (methyl hydroxybenzoate and propylparaben mixed liquor), 1%-10% nourishing additive agent (the arabidopsis oil body containing coenzyme Q10 albumen) and 5%-20% vitamin C, appropriate amount of essence, all the other are deionized water, the present invention devises orthogonal experiment, by stability experiment and Activity determination, determine that best emulsion formulations is 10% oiliness raw material (safflower oil bodies), 10% glycerol, 10% emulsifying agent (carboxyethyl cellulose), 3% coupling agent (PEG600), 0.25% antiseptic (methyl hydroxybenzoate and propylparaben mixed liquor), 0.5% essence, 8% nourishing additive agent (the arabidopsis oil body containing coenzyme Q10 albumen), 5% vitamin C.

Embodiment 13 facial treatment milk preparation method

The present invention prepares a kind of preparation method containing coenzyme Q10 active polypeptide facial treatment milk, comprises the following steps and is prepared: first extracted by vegetable oils, then join in oil body by water, mix homogeneously; Then add glycerol and emulsifying agent carboxyethyl cellulose step by step, coupling agent PEG600, stirs, and high shear is emulsified at 1000rpm-30000rpm, emulsifying 10-20min in homogenizer; Finally, add the mixed liquor of antiseptic methyl hydroxybenzoate and propylparaben and nourishing additive agent after stirring again and contain the vegetable oils of coenzyme Q10 active polypeptide and vitamin C and Stigma Croci essence, after stirring product of the present invention.

Embodiment 14 facial treatment milk stability experiment

(1) in 40 DEG C of electro-heating standing-temperature cultivators, place 30-50 days, observe after recovering room temperature, lamination, does not have good stability;

Within (2) 24 hours, frequent variations back and forth between 0 DEG C-50 DEG C, repeatable operation 15-30 days like this, observes after recovering room temperature, does not have lamination, have good stability;

(3) in the electro-heating standing-temperature cultivator of-5 DEG C of refrigerators and 40 DEG C, respectively put 1 day, repeatable operation 5-7 days like this, observe after recovering room temperature, do not occur lamination, have good stability;

(4) in the electro-heating standing-temperature cultivator of 40 DEG C, place 5-7 days, then in 0 DEG C of-5 DEG C of refrigerator, place 5-7 days, the electro-heating standing-temperature cultivator next putting into 40 DEG C-50 DEG C is again placed 30 days, observes, have good stability after recovering room temperature.

By above-mentioned laboratory observation, oiliness raw material 10%, glycerol 10%, emulsifying agent 10%, coupling agent 3%, antiseptic 0.25%, essence 0.5%, nourishing additive agent 8%, vitamin C 5%, the stability of this emulsion formulations is better.

Embodiment 15 facial treatment milk effect containing coenzyme Q10 oil body

First carry out anti-oxidation efficacy detection to facial treatment milk, select the scavenging action of pyrogallol method detection to ultra-oxygen anion free radical, crystal violet method detects the scavenging action to light free radical, and DPH method detects the scavenging action to total free radical.

Then white-skinned face function is detected, adopt tyrosine inhibiting AChE, get 4 test tubes and be numbered C1, C2, T1, T2 respectively, in each pipe, corresponding reagent is added according to the order of table 1, C1, T1 first put into 37 DEG C of water-bath 10min before adding tryrosinase, and then added tryrosinase, then C1, C2, T1, T2 were jointly put into and jointly put into 37 DEG C of water-bath 10min, take out measure the absorbance of each pipe of C1, C2, T1, T2 at 475nm place respectively, do three times parallel.

Above-mentioned this method is adopted to measure the clearance rate of the ultra-oxygen anion free radical of the skin care item of following different formulations, Scavenging action to hydroxyl free radical, total free radical scavenging activity, tyrosinase inhibition rate.

Composition 1 (the present invention): oiliness raw material (safflower oil bodies) 10%, glycerol 10%, emulsifying agent (carboxyethyl cellulose) 10%, coupling agent (PEG600) 3%, antiseptic (methyl hydroxybenzoate and propylparaben mixed liquor) 0.25%, essence (Stigma Croci essence) 0.5%, nourishing additive agent (the arabidopsis oil body containing 23005.12pg coenzyme Q10 albumen) 8%, vitamin C 5%;

Composition 2: oiliness raw material (safflower oil bodies) 10%, glycerol 10%, emulsifying agent (carboxyethyl cellulose) 10%, coupling agent (PEG600) 3%, antiseptic (methyl hydroxybenzoate and propylparaben mixed liquor) 0.25%, essence (Stigma Croci essence) 0.5%, vitamin C 5%;

Composition 3: oiliness raw material (glycerol) 20%, emulsifying agent (carboxyethyl cellulose) 10%, coupling agent (PEG600) 3%, antiseptic (methyl hydroxybenzoate and propylparaben mixed liquor) 0.25%, essence (Stigma Croci essence) 0.5%, nourishing additive agent (the arabidopsis oil body containing 23005.12pg coenzyme Q10 albumen) 8%, vitamin C 5%;

Composition 4: oiliness raw material (glycerol) 20%, emulsifying agent (carboxyethyl cellulose) 10%, coupling agent (PEG600) 3%, antiseptic (methyl hydroxybenzoate and propylparaben mixed liquor) 0.25%, essence (Stigma Croci essence) 0.5%, nourishing additive agent (23005.12pgCoQ10 sterling) 8%, vitamin C 5%;

Compare the clearance rate of skin care item to ultra-oxygen anion free radical of these four kinds of compositing formulas, Scavenging action to hydroxyl free radical, total free radical scavenging activity, tyrosinase inhibition rate, result is as follows.

Table 1 reactant liquor composition and volume

The antioxidation of table 2 different formulations compares with white-skinned face function

The percutaneous absorption rate of embodiment 16 containing coenzyme Q10 oil body skin care item

First be placed in acceptance pool by magnetic stick, then the rat skin in vitro of preparation is lain in acceptance pool upper end, release pond clip upwards, is then fixed in acceptance pool by stratum corneum side.Get and detect medicine 0.2ml uniform application on keratodermatitis, inject acceptance pool with syringe by probe tube acceptable solution, emptying air, makes skin another side and acceptable solution close contact.The electrode of low frequency electromagnetic composite pulse instrument is fixed on the Corium Mus surface of instrument group and short group thoroughly.Constant speed stirs, respectively at 1,2,4,8,16h extracts acceptable solution 1.0ml, then adds the fresh acceptable solution of 1.0ml.In experiment, the volume of diffusion cell used is 7.0ml, and sampling amount is 1.0ml, and infiltrating area is 2.92cm ², according to oil body content and the CoQ10 content of each compositing formula in the transdermal acceptable solution recorded, add up infiltration capacity (Q) according to following formulae discovery:

$Q=\frac{\mathrm{Cn}\×7.0+\underset{i=1}{\overset{n-1}{\mathrm{\Σ}}}\mathrm{Ci}\×1.0}{S}\mathrm{\μg}$

In formula, the drug level that the Cn: the n-th sample point records; The drug level that Ci: the i-th sample point records;

S: infiltrating area.The accumulative infiltration capacity of the mesaconitine obtained according to formulae discovery

The accumulative infiltration capacity of table 3 different formulations composition

?	1h	2h	4h	8h	16h
						Composition 1	18.635±1.003	37.563±4.457	57.751±9.457	76.256±14.398	89.367±16.987
Composition 2	17.254±1.052	35.756±3.354	53.578±10.184	72.548±12.689	87.574±14.624
						Composition 3	15.245±1.245	31.852±4.257	47.357±9.357	69.375±11.875	85.154±13.357
Composition 4	14.258±2.456	29.457±3.654	44.867±8.574	67.258±10.752	81.589±12.425

Claims (5)

1. the vegetable oils containing coenzyme Q10, it is characterized in that: utilize recombinant DNA technology to construct the vegetable oils specific expression vector pOBT-CoQ10 containing CoQ10 gene, be converted in oil crop, transgene receptor plant is obtained through Screening and Identification, through cultivating results transgenic seed, from transgenic seed, separation and Extraction contains the vegetable oils of coenzyme Q10.

2. the vegetable oils facial treatment milk containing coenzyme Q10 (CoQ10) active polypeptide, is characterized in that: it comprises each composition of following weight percents

All the other are deionized water.

3. facial treatment milk according to claim 2, is characterized in that: wetting agent is safflower oil bodies and glycerol, and nourishing additive agent is arabidopsis oil body and the vitamin C of coenzyme Q10 active polypeptide.

4. facial treatment milk according to claim 2, is characterized in that: described antiseptic is the mixture of methyl hydroxybenzoate and propylparaben, and coupling agent is PEG600, and emulsifying agent is carboxyethyl cellulose, and essence is Stigma Croci essence.

5. facial treatment milk according to claim 2, is characterized in that: be prepared according to following steps: first extracted by vegetable oils, then joins in oil body by water, mix homogeneously; Then add glycerol and emulsifying agent carboxyethyl cellulose step by step, coupling agent PEG600, stirs, and high shear is emulsified at 1000rpm-30000rpm, emulsifying 10-20min in homogenizer; Finally, after stirring, add the mixed liquor of antiseptic methyl hydroxybenzoate and propylparaben and the vegetable oils of nourishing additive agent coenzyme Q10 active polypeptide and Stigma Croci essence again, after stirring product of the present invention.