CN111233998B - Canine interferon CaIFN-lambda mutant and application thereof - Google Patents

Canine interferon CaIFN-lambda mutant and application thereof Download PDF

Info

Publication number
CN111233998B
CN111233998B CN202010202421.8A CN202010202421A CN111233998B CN 111233998 B CN111233998 B CN 111233998B CN 202010202421 A CN202010202421 A CN 202010202421A CN 111233998 B CN111233998 B CN 111233998B
Authority
CN
China
Prior art keywords
leu
lambda
caifn
recombinant
arg
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010202421.8A
Other languages
Chinese (zh)
Other versions
CN111233998A (en
Inventor
秦彤
崔尚金
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Animal Science of CAAS
Original Assignee
Institute of Animal Science of CAAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Animal Science of CAAS filed Critical Institute of Animal Science of CAAS
Priority to CN202010202421.8A priority Critical patent/CN111233998B/en
Publication of CN111233998A publication Critical patent/CN111233998A/en
Application granted granted Critical
Publication of CN111233998B publication Critical patent/CN111233998B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/555—Interferons [IFN]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Toxicology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oncology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Communicable Diseases (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention discloses a group of recombinant canine interferon CaIFN-lambda proteins, namely mutant proteins of wild type canine interferon CaIFN-lambda proteins. Wherein, the biological activity of the 3 interferon CaIFN-lambda mutants is obviously superior to that of the wild canine interferon CaIFN-lambda. The recombinant wild canine interferon CaIFN-lambda protein provided by the invention has excellent antiviral activity, and has great potential and value in development of antiviral drugs and veterinary clinical application.

Description

Canine interferon CaIFN-lambda mutant and application thereof
The application is a divisional application of Chinese invention application 'CN 201810867859.0, a recombinant canine interferon CaIFN-lambda and application thereof'.
Technical Field
The invention belongs to the fields of genetic engineering and biological engineering, and particularly relates to recombinant canine interferon and application thereof.
Background
Interferons (IFNs) are a group of active proteins (mainly glycoproteins) with multiple functions, which are generated by biological cells induced by Interferon inducers, and have biological activities such as broad-spectrum antiviral activity, cell growth influence, differentiation activity, immune function regulation and the like. Interferons do not directly inactivate viruses but exert their effect by inducing cells to synthesize antiviral proteins (AVPs). Meanwhile, the activity of natural killer cells (NK cells), macrophages and T lymphocytes can be enhanced, so that the immune regulation effect is achieved, and the antiviral capacity is enhanced. The follow-up survey finds that the interferon has good antiviral and virus replication inhibiting effects in treatment, and particularly has a certain curative effect on canine viral diseases.
Based on the source difference, physicochemical property, biological activity and recognition receptor difference of interferon-producing cells, the interferon-producing cells can be classified into types I, II and III. Type I interferons include IFN-alpha, IFN-beta, IFN-omega, and type II interferons include only IFN-gamma. Wherein, the I-type interferon has stronger antiviral activity and is an effective treatment medicine for viral diseases such as hepatitis B and the like. The canine interferons currently used in veterinary clinical are all alpha interferons, and are mainly gene recombinant proteins obtained from escherichia coli, and only show single isoforms, such as alpha-2 b and the like.
Lambda interferon (IFN-. lambda.) is a recently discovered type III interferon, and although the induction mechanism and biological activity are similar to those of type I interferon, the genes, structures and receptors are different. Human IFN-lambda includes IFN-lambda 1, IFN-lambda 2 and IFN-lambda 3, and is effective in inhibiting replication of hepatitis B virus, hepatitis C virus, herpes virus and influenza A virus. Canine IFN- λ (CaIFN- λ) has been studied relatively rarely.
Disclosure of Invention
In order to overcome the defects and shortcomings in the prior art, the invention provides a recombinant canine interferon CaIFN-lambda and application thereof. The purpose of the invention is realized by the following technical scheme:
the invention provides a group of recombinant canine interferon CaIFN-lambda proteins, which are mutant proteins of wild type CaIFN-lambda, and on the basis of a wild type CaIFN-lambda sequence SEQ ID NO.11, the recombinant canine interferon CaIFN-lambda proteins comprise at least one of the following mutations: E84G, T94V, T101M.
In a specific case, the recombinant canine interferon CaIFN- λ protein comprises 2 mutations, E84G and T94V, E84G and T101M, or T94V and T101M.
In a specific case, the recombinant canine interferon CaIFN- λ protein comprises 3 mutations, E84G, T94V and T101M.
In a specific case, the amino acid sequence of the recombinant canine interferon CaIFN-lambda protein is selected from SEQ ID NO.2, SEQ ID NO.4 or SEQ ID NO. 6.
In a specific case, the amino acid sequence of the recombinant canine interferon CaIFN-lambda protein is added with a connecting sequence GSSSS and a tag protein HHHHHHHHHH after the sequence selected from SEQ ID NO.2, SEQ ID NO.4 or SEQ ID NO. 6.
The invention provides an isolated nucleic acid molecule encoding a recombinant canine interferon CaIFN-lambda protein; preferably, the nucleotide sequence of the nucleic acid molecule is shown as SEQ ID NO.1, SEQ ID NO.3 or SEQ ID NO. 5.
The invention provides an expression cassette or a vector, which comprises a nucleic acid molecule for coding recombinant canine interferon CaIFN-lambda protein.
The invention provides a recombinant bacterium, which contains the nucleic acid molecule, the expression cassette or the vector.
The invention provides a recombinant canine interferon CaIFN-lambda protein, a nucleic acid molecule for encoding the recombinant canine interferon CaIFN-lambda protein, an expression cassette or a vector containing the nucleic acid molecule for encoding the recombinant canine interferon CaIFN-lambda protein, and/or application of recombinant bacteria in preparation of the recombinant canine interferon CaIFN-lambda.
The invention provides a composition, which comprises one or more of the recombinant canine interferon CaIFN-lambda proteins.
The invention provides a preparation method of recombinant canine interferon, which comprises the following steps: culturing a recombinant bacterium containing a nucleic acid molecule for coding the recombinant canine interferon CaIFN-lambda protein to obtain the recombinant canine interferon.
Correspondingly, the invention provides a recombinant canine interferon product, and the product is prepared by the method.
Preferably, the product comprises one or more of the recombinant canine interferon CaIFN-lambda proteins.
The invention provides an application of recombinant canine interferon CaIFN-lambda protein in treatment of canine virus infection; preferably, the viral infection is a canine coronavirus infection.
The term "application" or "use" as used herein may refer to both diagnostic or therapeutic applications and non-diagnostic or therapeutic applications, such as scientific research.
The invention has the beneficial effects that:
according to the invention, 5 mutants are obtained by mutating wild type canine interferon CaIFN-lambda protein, wherein the biological activity of the 3 mutants is obviously superior to that of the wild type canine interferon CaIFN-lambda. The recombinant wild type canine interferon CaIFN-lambda protein, namely the canine interferon CaIFN-lambda mutant protein, provided by the invention has excellent antiviral activity, and has great potential and value in development of antiviral drugs and veterinary clinical application.
Drawings
FIG. 1. RT-PCR amplification results for wild-type CaIFN- λ: 1.CaIFN- λ; 2. and (5) negative control.
FIG. 2 expression analysis of wild-type and mutant recombinant CaIFN- λ: m, Marker, respectively; 1. wild-type CaIFN- λ; 2. CaIFN- λ -mut 1; 3. CaIFN- λ -mut 2; 4. CaIFN- λ -mut 3; 5. CaIFN- λ -mut 4; 6. CaIFN-lambda-mut 5.
FIG. 3 Western blot analysis of purified wild type and mutant recombinant CaIFN-. lambda.s: 1. wild-type CaIFN- λ; 2. CaIFN- λ -mut 1; 3. CaIFN- λ -mut 2; 4. CaIFN- λ -mut 3; 5. CaIFN- λ -mut 4; 6. CaIFN-lambda-mut 5.
FIG. 4. OD of standard protein sample under different concentration gradients562Value standard curve.
Detailed Description
The present invention is described in further detail by the following examples, but it should be understood that the present invention is not limited by the following. The methods and procedures not described in detail are performed with reference to experimental methods and procedures conventional in the art.
Example 1: construction of expression vectors for CaIFN-lambda wild-type and mutants
1. Construction of wild-type CaIFN-lambda expression vector:
analysis was performed using DNAStar according to the GenBank landing CaIFN-. lambda.Gene sequence (KC754970.1), and after removing the sequence of the signal peptide, Oligo 6 was used to design a primer, the upstream primer IFN-. lambda.F was CGCCATATGATGGGCCCTGTCCCTACTTCCAA(Nde I) (SEQ ID NO.12), the downstream primer IFN-. lambda.R was CCCAAGCTTGACGCACAGGTCTCTACTGG (Hind III) (SEQ ID NO.13), and the total length of the amplification was 534bp, which was synthesized from Beijing Huada gene.
The full length of CaIFN-lambda was amplified with reference to an article by Limin Yang et al (Limin et al, 2013) to obtain an amplification template. The reaction system of RT-PCR is as follows: 1 mu L of template; IFN lambda-F/R1.0. mu.L each; dNTPs (2.5mM) 1.0. mu.L; LA Taq (5U/. mu.L) 0.5. mu.L; 10 × LA Taq Buffer II (Mg2+ Plus)2.0 μ L; ddH2Make up to 20. mu.L of O. And (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 45 s; annealing at 55 ℃ for 45 s; extending at 72 ℃ for 7 min; final extension at 72 ℃ for 10 min. After completion of the reaction, the detection was carried out by electrophoresis on nucleic acid using 1.0% agarose (FIG. 1).
The pET-21a vector and the recovered PCR product were subjected to double digestion with restriction enzymes Nde I and Hind III, and the reaction system was as follows: mu.L of PCR-recovered product (100 ng/. mu.L) or pET-21a vector (100 ng/. mu.L), 1.0. mu.L of LNde I, 1.0. mu.L of Hind III, 2.0. mu.L of 10 × CutSmart, ddH2And supplementing O to 20 mu L, mixing uniformly, placing on a metal bath, and reacting for 0.5h at 37 ℃. And (5) carrying out agarose gel electrophoresis detection after the reaction is finished. Recovering the enzyme cutting product with the right size.
The recovered restriction enzyme product CaIFN-lambda target fragment and pET-21a vector are connected by using T4 DNA ligase of TaKaRa company. A connection system: 1.0. mu. L T4 DNA Ligase (350U/. mu.L); 1.0. mu.L of 10 XT 4 DNA Ligase Buffer; 6.0 μ LCaIFN- λ target fragment; 2.0. mu.L of pET-21a vector; ddH2And supplementing O to 10.0 mu L, uniformly mixing, placing on a metal bath, and reacting for 5-6h at 16 ℃.
After amplification of the transformed competent cell BL21(DE3), sequencing is carried out to identify the recombinant positive clone, and pET-21 a-IFN-lambda is obtained.
The coding nucleic acid sequence of GSSSSHHHHHH was inserted at the C-terminus of the pET-21a-IFN- λ insert.
2. Construction of CaIFN-lambda mutant expression vector:
5 CaIFN-lambda mutants are designed, and the coding nucleic acid sequence and amino acid sequence information are shown in the following table:
TABLE 1 sequence information of CaIFN-Lambda mutants
Mutants Coding nucleic acid sequence Mutant amino acid sequences Mutation point
Mut1 SEQ ID NO.1 SEQ ID NO.2 T101M
Mut2 SEQ ID NO.3 SEQ ID NO.4 T94V
Mut3 SEQ ID NO.5 SEQ ID NO.6 E84G
Mut4 SEQ ID NO.7 SEQ ID NO.8 W44P
Mut5 SEQ ID NO.9 SEQ ID NO.10 E29G
The coding nucleic acid sequence (SEQ ID NO.1, 3, 5, 7 and 9) is added with GSSSSHHHHHH coding nucleic acid sequence at C end, then Nde I and Hind III enzyme cutting sites are added at two ends, the whole sequence is synthesized by Nanjing Kingsry science and technology company, and is cloned to pET-21a vector, and after transformation and amplification, sequencing is carried out to identify recombinant positive clone, thus obtaining pET-21 a-IFN-lambda-mut 1, pET-21 a-IFN-lambda-mut 2, pET-21 a-IFN-lambda-mut 3, pET-21 a-IFN-lambda-mut 4 and pET-21 a-IFN-lambda-mut 5, and the specific operation method refers to the wild type CaIFN-lambda expression vector.
Example 2: inducible expression and purification of recombinant proteins
1. Inducing expression of recombinant protein:
inoculating the positive bacteria with correct sequencing in 10mL LB liquid medium containing benzyl amine resistance according to the proportion of 1:100, and culturing in a constant temperature incubator at 37 ℃ until logarithmic growth phase (OD)600The value reaches 0.8), 5mL is taken out to be used as a negative control, and IPTG is added into the remaining 5mL of bacterial liquid to be induced under the condition of 25 ℃ overnight. Centrifuging at 12,000rpm for 2min to collect induced and non-induced thallus, re-suspending with PBS, mixing with 5 xSDS-PAGE sample buffer at a ratio of 1:4, heating the protein sample in boiling water bath for 5min, cooling to room temperature, centrifuging at 1500rpm for 30s, collecting appropriate amount of supernatant, performing 15% polyacrylamide gel electrophoresis (SDS-PAGE), and observing the expression of target protein.
The film transfer operation is carried out by using a semi-dry transfer printing instrument from Bole of America, and the operation process is briefly described as follows:
(1) after electrophoresis, taking down SDS-PAGE gel from the gel plate, and soaking the gel plate, a thick filter plate and a nitrocellulose membrane (NC membrane) in the semi-dry membrane transferring liquid for 5 min;
(2) a first filter plate is padded on a semi-dry membrane converter, an NC membrane is placed on the first filter paper, SDS-PAGE gel is placed on the NC membrane, a filter plate is covered, bubbles are removed, and finally an electrode of the converter is covered, and a power supply is switched on; transfer conditions: 18V, 30 min.
Western blot: (1) taking out the transferred NC film, washing off the semi-dry transfer film liquid remained on the surface of the film by using TBST, putting the film into 5% skim milk (the skim milk is TBST which is 1:20), and sealing for 2h at 37 ℃;
(2) after the sealing is finished, washing the NC membrane for 3 times by using TBST, 5min each time, adding a primary antibody of the mouse anti-His label diluted by 1:2000, and incubating for 2h at room temperature;
(3) after the primary antibody incubation is finished, washing the NC membrane for 3 times by using TBST, 5min each time, adding a goat anti-mouse HRP (horse radish peroxidase) labeled secondary antibody diluted by 1:2000, and incubating for 45min at room temperature;
(4) washing NC membrane with TBST for 5 times, each time for 5min, developing with DAB substrate color developing kit of Jiangsukang as century science and technology limited company, and reacting at room temperature for 5 min.
After staining, a band of interest corresponding to the expected size appeared at about 20kDa, and successful IFN-. lambda.His expression was initially judged (FIG. 2).
2. Purification and quantification of recombinant proteins
Washing 1.5L of wild type and mutant recombinant bacteria collected after induction with PBS, freeze-thawing for three times to break the bacteria, purifying recombinant Protein according to Beaverbeads (TM) His-tag Protein Purification kit of beaver nanometer, concentrating the obtained target Protein through an ultrafiltration tube, replacing PBS with eluent, and measuring and calculating the content of the purified Protein according to the instruction of the Beaver beads Protein quantitative kit (product number: P0010S).
After the IFN-lambda-His protein is purified by magnetic beads, the result of Western blot detection shows that a single specific band with the size of about 20kDa is obtained, which indicates that the purity of the protein is better (figure 3).
The OD of the standard protein sample under different concentration gradients is measured according to the kit562Values, a standard curve was plotted and the formula for the curve was obtained (fig. 4). OD of recombinant CaIFN-lambda determined by enzyme-labeling instrument562The values were substituted into the formula to calculate the concentration of the purified target protein as shown in table 2:
TABLE 2 protein concentration of recombinant CaIFN- λ
Recombinant CaIFN-lambda Protein concentration (mg/mL)
Wild type 0.134
CaIFN-λ-mut1 0.135
CaIFN-λ-mut2 0.156
CaIFN-λ-mut 3 0.133
CaIFN-λ-mut 4 0.125
CaIFN-λ-mut 5 0.122
Example 3: recombinant CaIFN-Lambda antiviral activity assay
1. Determination of VSV TCID 50:
well-grown CRFK and MDCK cells are taken and paved into a 96-well plate according to the ratio of 100 mu L/well for culture, when the cells grow to a monolayer, the culture medium is poured out, the cells are washed by DMEM, VSV diluted by the proportion of DMEM (10-time gradient) is added, 100 mu L of VSV is added into each well, 6 wells are made for each concentration, the cell culture is continued, the cells are observed once every 12-16h, and the TCID50 of the VSV is calculated according to the Reed-Muench method.
2. Recombinant CaIFN-Lambda anti-VSV Activity assay
Digesting CRFK and MDCK cells with good growth state, counting, uniformly paving 100 mu L/well into a 96-well plate, culturing until the cells grow to a monolayer, sucking out a culture medium, slightly washing 3 times by using PBS buffer solution, adding 10-fold diluted and purified recombinant CaIFN-lambda of a DMEM culture medium with 4% FBS into a cell culture plate, wherein each well is 100 mu L, each dilution is 6 wells, and placing the cells into 5% CO at 37 ℃ for 5 ℃2The culture medium containing recombinant CaIFN-lambda is discarded after 18h in the incubator, and the cells are gently washed 3 times with DMEM medium, 100. mu.L VSV virus containing 100TCID50 is added to each well, 5% CO at 37 ℃2The culture was carried out in an incubator, and a negative control (no virus and only interferon), a positive control (no heavy group CaIFN-. lambda., only VSV virus) and a blank control (only cells and no virus and interferon) were set simultaneously. Observing the growth condition of the cells under an inverted microscope every 12h, and counting the pathological changes in the cell wells with each dilution when obvious pathological changes can be observed in CRFK and MDCK cells in more than 75 percent of positive control wells to inhibitThe dilution of interferon for half of the cytopathic events was 1 Interferon Unit (IU). The recombinant CaIFN-lambda activity was calculated according to the Reed-Muench method and the results are shown in Table 3.
3. Determination of anti-CCoV Activity of recombinant CaIFN-Lambda
The CaIFN-. lambda.anti-CCoV activity was determined on CRFK/CCoV and MDCK/CCoV systems as above, and the results are shown in Table 3.
TABLE 3 recombinant CaIFN-Lambda anti-VSV and CCoV Activity
Figure GDA0003236618570000061
Therefore, the antiviral activity of the recombinant CaIFN-lambda-mut 1, CaIFN-lambda-mut 2 and CaIFN-lambda-mut 3 is obviously superior to that of the wild type CaIFN-lambda, the recombinant CaIFN-lambda has broad-spectrum antiviral efficacy, has a protective effect on cells from being infected by VSV and CCoV, has no obvious cytotoxicity, and proves that the recombinant CaIFN-lambda has a potential therapeutic effect on canine coronavirus diseases. The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.
SEQUENCE LISTING
<110> Beijing animal husbandry and veterinary institute of Chinese academy of agricultural sciences
<120> canine interferon CaIFN-lambda mutant and application thereof
<130> CP11802269C-DIV2
<160> 15
<170> PatentIn version 3.3
<210> 1
<211> 513
<212> DNA
<213> CaIFN-lambda mutant 1 nucleotide sequence
<400> 1
ggccctgtcc ctacttccaa acccaccaca accaggaggg gctgccacat ggacaggttc 60
cagtctctgt cacccaggga gctagaagcc ttcaagaagg ccaaggatgc cttggaagag 120
tcgctctcct ggaagaactg gagctgcagc tctcgcctct tccctagatc cagggacctg 180
agactcctgc aggcctggga gcgtcctgtg gccttggagg ctgagctaga cttgacactg 240
aaggtcctgg agaacatgac tgactcatcg ctgggggtca ccctggacca gcccctccgc 300
atgctgcacc acatccactc ggagctccag gcttgtgtcc cggctcagcc cacagcagac 360
cccaggcccc acggccgcct ccaccactgg ctgcaccggc tccagaaggc ccccaaggag 420
tcccagggct gcctcgaggc ctccatcacg ttcaacctct tccgcctcct cacacgggac 480
ctgaaatgtg ttgccagtag agacctgtgc gtc 513
<210> 2
<211> 171
<212> PRT
<213> CaIFN-lambda mutant 1 amino acid sequence
<400> 2
Gly Pro Val Pro Thr Ser Lys Pro Thr Thr Thr Arg Arg Gly Cys His
1 5 10 15
Met Asp Arg Phe Gln Ser Leu Ser Pro Arg Glu Leu Glu Ala Phe Lys
20 25 30
Lys Ala Lys Asp Ala Leu Glu Glu Ser Leu Ser Trp Lys Asn Trp Ser
35 40 45
Cys Ser Ser Arg Leu Phe Pro Arg Ser Arg Asp Leu Arg Leu Leu Gln
50 55 60
Ala Trp Glu Arg Pro Val Ala Leu Glu Ala Glu Leu Asp Leu Thr Leu
65 70 75 80
Lys Val Leu Glu Asn Met Thr Asp Ser Ser Leu Gly Val Thr Leu Asp
85 90 95
Gln Pro Leu Arg Met Leu His His Ile His Ser Glu Leu Gln Ala Cys
100 105 110
Val Pro Ala Gln Pro Thr Ala Asp Pro Arg Pro His Gly Arg Leu His
115 120 125
His Trp Leu His Arg Leu Gln Lys Ala Pro Lys Glu Ser Gln Gly Cys
130 135 140
Leu Glu Ala Ser Ile Thr Phe Asn Leu Phe Arg Leu Leu Thr Arg Asp
145 150 155 160
Leu Lys Cys Val Ala Ser Arg Asp Leu Cys Val
165 170
<210> 3
<211> 513
<212> DNA
<213> CaIFN-lambda mutant 2 nucleotide sequence
<400> 3
ggccctgtcc ctacttccaa acccaccaca accaggaggg gctgccacat ggacaggttc 60
cagtctctgt cacccaggga gctagaagcc ttcaagaagg ccaaggatgc cttggaagag 120
tcgctctcct ggaagaactg gagctgcagc tctcgcctct tccctagatc cagggacctg 180
agactcctgc aggcctggga gcgtcctgtg gccttggagg ctgagctaga cttgacactg 240
aaggtcctgg agaacatgac tgactcatcg ctgggggtcg tcctggacca gcccctccgc 300
acgctgcacc acatccactc ggagctccag gcttgtgtcc cggctcagcc cacagcagac 360
cccaggcccc acggccgcct ccaccactgg ctgcaccggc tccagaaggc ccccaaggag 420
tcccagggct gcctcgaggc ctccatcacg ttcaacctct tccgcctcct cacacgggac 480
ctgaaatgtg ttgccagtag agacctgtgc gtc 513
<210> 4
<211> 171
<212> PRT
<213> CaIFN-lambda mutant 2 amino acid sequence
<400> 4
Gly Pro Val Pro Thr Ser Lys Pro Thr Thr Thr Arg Arg Gly Cys His
1 5 10 15
Met Asp Arg Phe Gln Ser Leu Ser Pro Arg Glu Leu Glu Ala Phe Lys
20 25 30
Lys Ala Lys Asp Ala Leu Glu Glu Ser Leu Ser Trp Lys Asn Trp Ser
35 40 45
Cys Ser Ser Arg Leu Phe Pro Arg Ser Arg Asp Leu Arg Leu Leu Gln
50 55 60
Ala Trp Glu Arg Pro Val Ala Leu Glu Ala Glu Leu Asp Leu Thr Leu
65 70 75 80
Lys Val Leu Glu Asn Met Thr Asp Ser Ser Leu Gly Val Val Leu Asp
85 90 95
Gln Pro Leu Arg Thr Leu His His Ile His Ser Glu Leu Gln Ala Cys
100 105 110
Val Pro Ala Gln Pro Thr Ala Asp Pro Arg Pro His Gly Arg Leu His
115 120 125
His Trp Leu His Arg Leu Gln Lys Ala Pro Lys Glu Ser Gln Gly Cys
130 135 140
Leu Glu Ala Ser Ile Thr Phe Asn Leu Phe Arg Leu Leu Thr Arg Asp
145 150 155 160
Leu Lys Cys Val Ala Ser Arg Asp Leu Cys Val
165 170
<210> 5
<211> 513
<212> DNA
<213> CaIFN-lambda mutant 3 nucleotide sequence
<400> 5
ggccctgtcc ctacttccaa acccaccaca accaggaggg gctgccacat ggacaggttc 60
cagtctctgt cacccaggga gctagaagcc ttcaagaagg ccaaggatgc cttggaagag 120
tcgctctcct ggaagaactg gagctgcagc tctcgcctct tccctagatc cagggacctg 180
agactcctgc aggcctggga gcgtcctgtg gccttggagg ctgagctaga cttgacactg 240
aaggtcctgg ggaacatgac tgactcatcg ctgggggtca ccctggacca gcccctccgc 300
acgctgcacc acatccactc ggagctccag gcttgtgtcc cggctcagcc cacagcagac 360
cccaggcccc acggccgcct ccaccactgg ctgcaccggc tccagaaggc ccccaaggag 420
tcccagggct gcctcgaggc ctccatcacg ttcaacctct tccgcctcct cacacgggac 480
ctgaaatgtg ttgccagtag agacctgtgc gtc 513
<210> 6
<211> 171
<212> PRT
<213> CaIFN-lambda mutant 3 amino acid sequence
<400> 6
Gly Pro Val Pro Thr Ser Lys Pro Thr Thr Thr Arg Arg Gly Cys His
1 5 10 15
Met Asp Arg Phe Gln Ser Leu Ser Pro Arg Glu Leu Glu Ala Phe Lys
20 25 30
Lys Ala Lys Asp Ala Leu Glu Glu Ser Leu Ser Trp Lys Asn Trp Ser
35 40 45
Cys Ser Ser Arg Leu Phe Pro Arg Ser Arg Asp Leu Arg Leu Leu Gln
50 55 60
Ala Trp Glu Arg Pro Val Ala Leu Glu Ala Glu Leu Asp Leu Thr Leu
65 70 75 80
Lys Val Leu Gly Asn Met Thr Asp Ser Ser Leu Gly Val Thr Leu Asp
85 90 95
Gln Pro Leu Arg Thr Leu His His Ile His Ser Glu Leu Gln Ala Cys
100 105 110
Val Pro Ala Gln Pro Thr Ala Asp Pro Arg Pro His Gly Arg Leu His
115 120 125
His Trp Leu His Arg Leu Gln Lys Ala Pro Lys Glu Ser Gln Gly Cys
130 135 140
Leu Glu Ala Ser Ile Thr Phe Asn Leu Phe Arg Leu Leu Thr Arg Asp
145 150 155 160
Leu Lys Cys Val Ala Ser Arg Asp Leu Cys Val
165 170
<210> 7
<211> 513
<212> DNA
<213> CaIFN-lambda mutant 4 nucleotide sequence
<400> 7
ggccctgtcc ctacttccaa acccaccaca accaggaggg gctgccacat ggacaggttc 60
cagtctctgt cacccaggga gctagaagcc ttcaagaagg ccaaggatgc cttggaagag 120
tcgctctccc cgaagaactg gagctgcagc tctcgcctct tccctagatc cagggacctg 180
agactcctgc aggcctggga gcgtcctgtg gccttggagg ctgagctaga cttgacactg 240
aaggtcctgg agaacatgac tgactcatcg ctgggggtca ccctggacca gcccctccgc 300
acgctgcacc acatccactc ggagctccag gcttgtgtcc cggctcagcc cacagcagac 360
cccaggcccc acggccgcct ccaccactgg ctgcaccggc tccagaaggc ccccaaggag 420
tcccagggct gcctcgaggc ctccatcacg ttcaacctct tccgcctcct cacacgggac 480
ctgaaatgtg ttgccagtag agacctgtgc gtc 513
<210> 8
<211> 171
<212> PRT
<213> CaIFN-lambda mutant 4 amino acid sequence
<400> 8
Gly Pro Val Pro Thr Ser Lys Pro Thr Thr Thr Arg Arg Gly Cys His
1 5 10 15
Met Asp Arg Phe Gln Ser Leu Ser Pro Arg Glu Leu Glu Ala Phe Lys
20 25 30
Lys Ala Lys Asp Ala Leu Glu Glu Ser Leu Ser Pro Lys Asn Trp Ser
35 40 45
Cys Ser Ser Arg Leu Phe Pro Arg Ser Arg Asp Leu Arg Leu Leu Gln
50 55 60
Ala Trp Glu Arg Pro Val Ala Leu Glu Ala Glu Leu Asp Leu Thr Leu
65 70 75 80
Lys Val Leu Glu Asn Met Thr Asp Ser Ser Leu Gly Val Thr Leu Asp
85 90 95
Gln Pro Leu Arg Thr Leu His His Ile His Ser Glu Leu Gln Ala Cys
100 105 110
Val Pro Ala Gln Pro Thr Ala Asp Pro Arg Pro His Gly Arg Leu His
115 120 125
His Trp Leu His Arg Leu Gln Lys Ala Pro Lys Glu Ser Gln Gly Cys
130 135 140
Leu Glu Ala Ser Ile Thr Phe Asn Leu Phe Arg Leu Leu Thr Arg Asp
145 150 155 160
Leu Lys Cys Val Ala Ser Arg Asp Leu Cys Val
165 170
<210> 9
<211> 513
<212> DNA
<213> CaIFN-lambda mutant 5 nucleotide sequence
<400> 9
ggccctgtcc ctacttccaa acccaccaca accaggaggg gctgccacat ggacaggttc 60
cagtctctgt cacccaggga gctaggagcc ttcaagaagg ccaaggatgc cttggaagag 120
tcgctctcct ggaagaactg gagctgcagc tctcgcctct tccctagatc cagggacctg 180
agactcctgc aggcctggga gcgtcctgtg gccttggagg ctgagctaga cttgacactg 240
aaggtcctgg agaacatgac tgactcatcg ctgggggtca ccctggacca gcccctccgc 300
acgctgcacc acatccactc ggagctccag gcttgtgtcc cggctcagcc cacagcagac 360
cccaggcccc acggccgcct ccaccactgg ctgcaccggc tccagaaggc ccccaaggag 420
tcccagggct gcctcgaggc ctccatcacg ttcaacctct tccgcctcct cacacgggac 480
ctgaaatgtg ttgccagtag agacctgtgc gtc 513
<210> 10
<211> 171
<212> PRT
<213> CaIFN-lambda mutant 5 amino acid sequence
<400> 10
Gly Pro Val Pro Thr Ser Lys Pro Thr Thr Thr Arg Arg Gly Cys His
1 5 10 15
Met Asp Arg Phe Gln Ser Leu Ser Pro Arg Glu Leu Gly Ala Phe Lys
20 25 30
Lys Ala Lys Asp Ala Leu Glu Glu Ser Leu Ser Trp Lys Asn Trp Ser
35 40 45
Cys Ser Ser Arg Leu Phe Pro Arg Ser Arg Asp Leu Arg Leu Leu Gln
50 55 60
Ala Trp Glu Arg Pro Val Ala Leu Glu Ala Glu Leu Asp Leu Thr Leu
65 70 75 80
Lys Val Leu Glu Asn Met Thr Asp Ser Ser Leu Gly Val Thr Leu Asp
85 90 95
Gln Pro Leu Arg Thr Leu His His Ile His Ser Glu Leu Gln Ala Cys
100 105 110
Val Pro Ala Gln Pro Thr Ala Asp Pro Arg Pro His Gly Arg Leu His
115 120 125
His Trp Leu His Arg Leu Gln Lys Ala Pro Lys Glu Ser Gln Gly Cys
130 135 140
Leu Glu Ala Ser Ile Thr Phe Asn Leu Phe Arg Leu Leu Thr Arg Asp
145 150 155 160
Leu Lys Cys Val Ala Ser Arg Asp Leu Cys Val
165 170
<210> 11
<211> 171
<212> PRT
<213> wild type CaIFN-lambda amino acid sequence
<400> 11
Gly Pro Val Pro Thr Ser Lys Pro Thr Thr Thr Arg Arg Gly Cys His
1 5 10 15
Met Asp Arg Phe Gln Ser Leu Ser Pro Arg Glu Leu Glu Ala Phe Lys
20 25 30
Lys Ala Lys Asp Ala Leu Glu Glu Ser Leu Ser Trp Lys Asn Trp Ser
35 40 45
Cys Ser Ser Arg Leu Phe Pro Arg Ser Arg Asp Leu Arg Leu Leu Gln
50 55 60
Ala Trp Glu Arg Pro Val Ala Leu Glu Ala Glu Leu Asp Leu Thr Leu
65 70 75 80
Lys Val Leu Glu Asn Met Thr Asp Ser Ser Leu Gly Val Thr Leu Asp
85 90 95
Gln Pro Leu Arg Thr Leu His His Ile His Ser Glu Leu Gln Ala Cys
100 105 110
Val Pro Ala Gln Pro Thr Ala Asp Pro Arg Pro His Gly Arg Leu His
115 120 125
His Trp Leu His Arg Leu Gln Lys Ala Pro Lys Glu Ser Gln Gly Cys
130 135 140
Leu Glu Ala Ser Ile Thr Phe Asn Leu Phe Arg Leu Leu Thr Arg Asp
145 150 155 160
Leu Lys Cys Val Ala Ser Arg Asp Leu Cys Val
165 170
<210> 12
<211> 32
<212> DNA
<213> upstream primer IFN lambda-F
<400> 12
cgccatatga tgggccctgt ccctacttcc aa 32
<210> 13
<211> 29
<212> DNA
<213> downstream primer IFN lambda-R
<400> 13
cccaagcttg acgcacaggt ctctactgg 29
<210> 14
<211> 513
<212> DNA
<213> CaIFN-lambda mutant 1+2 nucleotide sequence
<400> 14
ggccctgtcc ctacttccaa acccaccaca accaggaggg gctgccacat ggacaggttc 60
cagtctctgt cacccaggga gctagaagcc ttcaagaagg ccaaggatgc cttggaagag 120
tcgctctcct ggaagaactg gagctgcagc tctcgcctct tccctagatc cagggacctg 180
agactcctgc aggcctggga gcgtcctgtg gccttggagg ctgagctaga cttgacactg 240
aaggtcctgg agaacatgac tgactcatcg ctgggggtcg tcctggacca gcccctccgc 300
atgctgcacc acatccactc ggagctccag gcttgtgtcc cggctcagcc cacagcagac 360
cccaggcccc acggccgcct ccaccactgg ctgcaccggc tccagaaggc ccccaaggag 420
tcccagggct gcctcgaggc ctccatcacg ttcaacctct tccgcctcct cacacgggac 480
ctgaaatgtg ttgccagtag agacctgtgc gtc 513
<210> 15
<211> 513
<212> DNA
<213> CaIFN-lambda mutant 1+3 nucleotide sequence
<400> 15
ggccctgtcc ctacttccaa acccaccaca accaggaggg gctgccacat ggacaggttc 60
cagtctctgt cacccaggga gctagaagcc ttcaagaagg ccaaggatgc cttggaagag 120
tcgctctcct ggaagaactg gagctgcagc tctcgcctct tccctagatc cagggacctg 180
agactcctgc aggcctggga gcgtcctgtg gccttggagg ctgagctaga cttgacactg 240
aaggtcctgg ggaacatgac tgactcatcg ctgggggtca ccctggacca gcccctccgc 300
atgctgcacc acatccactc ggagctccag gcttgtgtcc cggctcagcc cacagcagac 360
cccaggcccc acggccgcct ccaccactgg ctgcaccggc tccagaaggc ccccaaggag 420
tcccagggct gcctcgaggc ctccatcacg ttcaacctct tccgcctcct cacacgggac 480
ctgaaatgtg ttgccagtag agacctgtgc gtc 513

Claims (10)

1. A recombinant canine interferon CaIFN-lambda protein is characterized in that the amino acid sequence of the protein is shown as SEQ ID NO. 6.
2. An isolated nucleic acid molecule encoding the protein of claim 1.
3. The nucleic acid molecule of claim 2, wherein the nucleotide sequence of said nucleic acid molecule is set forth in SEQ ID No. 5.
4. An expression cassette or vector comprising the nucleic acid molecule of claim 2 or 3.
5. A recombinant bacterium comprising the nucleic acid molecule of claim 2 or 3 or the expression cassette or vector of claim 4.
6. Use of the protein of claim 1, the nucleic acid molecule of claim 2 or 3, the expression cassette or vector of claim 4, and/or the recombinant bacterium of claim 5 for the preparation of recombinant canine interferon CaIFN- λ.
7. A preparation method of recombinant canine interferon is characterized by comprising the following steps: culturing the recombinant strain of claim 5 to obtain the recombinant canine interferon.
8. A recombinant canine interferon product, produced by the process of claim 7.
9. Use of a protein according to claim 1, a nucleic acid molecule according to claim 2 or 3 or a product according to claim 8 for the manufacture of a medicament for the treatment of canine viral infections.
10. The use according to claim 9, wherein the viral infection is a Vesicular Stomatitis Virus (VSV) or canine coronavirus (CCoV) infection.
CN202010202421.8A 2018-08-02 2018-08-02 Canine interferon CaIFN-lambda mutant and application thereof Active CN111233998B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010202421.8A CN111233998B (en) 2018-08-02 2018-08-02 Canine interferon CaIFN-lambda mutant and application thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN202010202421.8A CN111233998B (en) 2018-08-02 2018-08-02 Canine interferon CaIFN-lambda mutant and application thereof
CN201810867859.0A CN108912222B (en) 2018-08-02 2018-08-02 Recombinant canine interferon CaIFN-lambda and application thereof

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CN201810867859.0A Division CN108912222B (en) 2018-08-02 2018-08-02 Recombinant canine interferon CaIFN-lambda and application thereof

Publications (2)

Publication Number Publication Date
CN111233998A CN111233998A (en) 2020-06-05
CN111233998B true CN111233998B (en) 2021-10-19

Family

ID=64393850

Family Applications (3)

Application Number Title Priority Date Filing Date
CN202010202421.8A Active CN111233998B (en) 2018-08-02 2018-08-02 Canine interferon CaIFN-lambda mutant and application thereof
CN202010197088.6A Active CN111233997B (en) 2018-08-02 2018-08-02 Recombinant canine interferon CaIFN-lambda mutant and application thereof
CN201810867859.0A Active CN108912222B (en) 2018-08-02 2018-08-02 Recombinant canine interferon CaIFN-lambda and application thereof

Family Applications After (2)

Application Number Title Priority Date Filing Date
CN202010197088.6A Active CN111233997B (en) 2018-08-02 2018-08-02 Recombinant canine interferon CaIFN-lambda mutant and application thereof
CN201810867859.0A Active CN108912222B (en) 2018-08-02 2018-08-02 Recombinant canine interferon CaIFN-lambda and application thereof

Country Status (1)

Country Link
CN (3) CN111233998B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113980972A (en) * 2021-12-07 2022-01-28 山东农业大学 Codon-optimized canine lambda 1 interferon coding gene and application thereof in preparation of canine lambda 1 interferon

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FI90990C (en) * 1984-12-18 1994-04-25 Boehringer Ingelheim Int Recombinant DNA molecule, transformed host organism, and method for producing interferon
CN100572393C (en) * 2006-04-06 2009-12-23 北京江中泽生科技有限责任公司 Dog interferon alpha preparation method and purposes
CN101100664B (en) * 2006-07-28 2010-06-16 王明丽 Method for preparing recombinant canine alpha-type interferon
WO2011017160A1 (en) * 2009-07-28 2011-02-10 Pestka Biomedical Laboratories, Inc. Mutant human interferon proteins and genes
CN102079784A (en) * 2009-11-30 2011-06-01 李为民 Canine interferon-Alpha mutant
CN103665166A (en) * 2012-09-03 2014-03-26 福又达生物科技股份有限公司 Dog fusion interferon
CN105037523B (en) * 2015-06-25 2019-02-19 北京三元基因药业股份有限公司 Interferon mutant and its polyethyleneglycol derivative
CN107177614A (en) * 2017-07-18 2017-09-19 哈尔滨紫霞生物科技有限公司 A kind of method for improving canine recombinant interferon gamma fusion protein antiviral activity
CN108359004A (en) * 2018-01-12 2018-08-03 中国农业科学院北京畜牧兽医研究所 Dog recombinant interferon-λ 1 and the preparation method and application thereof

Also Published As

Publication number Publication date
CN111233997A (en) 2020-06-05
CN108912222A (en) 2018-11-30
CN111233997B (en) 2022-04-12
CN111233998A (en) 2020-06-05
CN108912222B (en) 2020-06-19

Similar Documents

Publication Publication Date Title
JP2548201B2 (en) Method for producing human interferon and high-purity human interferon
CN106674354B (en) Fusion protein of chicken interferon IFN-lambda and IFN-alpha
CN111004317B (en) Canine recombinant interferon alpha 7 and preparation method and application thereof
CN111233998B (en) Canine interferon CaIFN-lambda mutant and application thereof
CN112500472B (en) Cat omega interferon mutant and preparation method and application thereof
CN108840952A (en) A kind of fusion protein and preparation method thereof being made of Chicken Albumin, chicken interferon gamma and chicken interferon α
JP2792813B2 (en) Novel leukocyte interferon
WO2020108427A1 (en) NOVEL INTERFERON-α AND PREPARATION METHOD THEREFOR, COMPOSITION AND USE THEREOF
CN113121672B (en) Soluble prokaryotic expression and purification method of cat interferon gamma and application
CN108840945A (en) Pig albumin-interferon-&#39; alpha &#39;-interleukin-22 fusion protein, preparation method and its encoding gene, a boar long-acting interferon
CN107253996A (en) Sheep albumin interferon-tau interleukin-22 fusion protein, preparation method and its encoding gene, a kind of sheep long-acting interferon
CN107353347A (en) A kind of fusion protein being made up of pig albumin, Porcine interferon-gamma and porcine interferon alpha and preparation method thereof
CN108840934B (en) Recombinant sheep long-acting interferon tau, fusion protein for preparing long-acting interferon tau and preparation method of fusion protein
CN110904115A (en) Canine recombinant interferon α 7, preparation method and application thereof, expression vector containing canine recombinant interferon α 7 and host cell
CN101475942A (en) B19 virus VP1 unique region gene
CN112661835B (en) Preparation method of mink IFN-epsilon mature peptide
CN108822221A (en) A kind of fusion protein and preparation method thereof being made of Chicken Albumin, chicken interferon gamma and recombinant chIL-2
CN108794637A (en) A kind of canine recombinant long-acting interferon α and the fusion protein and preparation method thereof for preparing this long-acting interferon
CN114805539B (en) Preparation method and application of pig interferon alpha 17 mutant recombinant protein
CN107245110A (en) A kind of fusion protein being made up of sheep albumin, sheep interferon gamma and sheep interferon-tau and preparation method thereof
CN107337738A (en) A kind of canine recombinant long-acting interferon and prepare fusion protein of this long-acting interferon and preparation method thereof
CN108794643A (en) A kind of fusion protein and preparation method thereof being made of dog albumin, dog interferon γ and canine leucocyte interleukin 2
CN108864304A (en) A kind of fusion protein and preparation method thereof being made of dog albumin, dog interferon γ and dog interferon alpha
CN112143749A (en) Long-acting recombinant canine interferon product, preparation method and application
CN111647614A (en) Construction method and application of recombinant bacterium for producing canine alpha-interferon

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant