CN110904115A - Canine recombinant interferon α 7, preparation method and application thereof, expression vector containing canine recombinant interferon α 7 and host cell - Google Patents

Abstract

The invention discloses a canine recombinant interferon α 7, a preparation method and application thereof, an expression vector and a host cell containing canine recombinant interferon α 7, a nucleotide sequence of the canine recombinant interferon α 7 is obtained by codon optimization, and a pichia pastoris strain expression system is utilized to express the canine recombinant stem containing codon optimization of the inventionThe canine recombinant interferon α prepared by the method has high purity, the protein concentration reaches 0.72mg/ml after purification, the protein yield of 1L recombinant yeast engineering bacteria reaches 138mg, and the antiviral specific activity of the recombinant protein on MDCK cells to VSV can reach 1.43 multiplied by 10⁶IU/mg, researches on expression, fermentation and activity of CaIFN- α 7 in a eukaryotic yeast system, and has important significance for early realization of industrial production of the canine α interferon.

Description

Canine recombinant interferon α 7, preparation method and application thereof, expression vector containing canine recombinant interferon α 7 and host cell

Technical Field

The invention belongs to the field of biological products, and discloses a canine recombinant interferon α 7, a preparation method and application thereof, an expression vector containing canine recombinant interferon α 7 and a host cell.

Background

In recent years, the pet industry in China is rapidly developed, the number of pet dogs and cats is increasing, and the pet-derived viral epidemic disease is a disease with serious harm at present. The most common canine distemper, canine parvovirus disease and the like are generally serious in harm, high in morbidity, strong in infectivity and high in mortality, are the most serious infectious diseases which harm the canine raising industry in China, and seriously restrict the development of the pet industry. Traditional treatment regimens are clinically poorly effective, and active treatment and prevention of canine viral diseases is therefore a major concern in the industry.

Since the discovery of interferons, the existence of interferons has been found in various mammals, fishes, insects and other animals, and the wide existence of interferons has been confirmed, which are classified into 3 types, i.e., type I, type II and type III, based on the genetic homology, structural characteristics, receptors and biological activities of different interferons, type I interferons include IFN- α, IFN- β, IFN-delta, IFN-epsilon, IFN-kappa, IFN-tau and IFN-omega, type II includes only gamma interferon, and IFN-lambda is the type III interferon found in 2003.

The full length of the canine interferon- α gene is 564 nucleotides, codes 187 amino acids, and consists of a signal peptide of 23 amino acids and a mature protein of 164 amino acids, CaIFN- α contains 6 cys and 2 potential N-glycosylation sites, and the homology of CaIFN- α 4-8 and the amino acid sequence of the previously reported subtype CaIFN- α 1-3 is 93-100%, according to the amino acid sequence and a molecular system development tree, the CaIFN- α is divided into two groups, wherein the group I is CaIFN α 1, 2 and 7, and the group II is CaIFN- α 3, 4, 5, 6 and 8.

At present, because the recombinant interferon expressed by pronucleus can not be subjected to posttranslational modification, the space conformation of the recombinant interferon has a certain difference with that of natural interferon, and the immunogenicity of the recombinant interferon is lower.

Disclosure of Invention

The invention aims to provide a canine recombinant interferon α 7, a preparation method and application thereof, an expression vector containing the canine recombinant interferon α 7 and a host cell, wherein the canine recombinant interferon α 7 with high expression efficiency and high purity is prepared by optimizing codons on the basis of not changing the amino acid sequence of the canine interferon α 7.

The technical scheme adopted by the invention is as follows:

the nucleotide sequence of the canine recombinant interferon α 7 is shown as SEQ ID No. 3.

The invention also provides a recombinant expression vector containing the nucleotide sequence of the canine recombinant interferon α 7.

Further, the expression vector is pPIC9K-CaIFN- α 7. in order to simply and rapidly obtain high-expression transformants, screening of high-copy clones of a target gene is often carried out, so that a resistance gene, such as a gene resistant to G418 (geneticin), needs to be introduced into the vectors, and then a pPIC9K expression vector is provided, so that the high-copy expression clones can be screened by increasing the concentration of G418. the pPIC9K contains a bacterial kan gene and confers geneticin resistance to Pichia pastoris. the geneticin resistance level mainly depends on the number of the integrated kan gene. after the single copy of pPIC9K is integrated into the genome of Pichia pastoris, the geneticin resistance level is conferred to the Pichia pastoris at about 0.25 mg/ml. the multi-copy integration of any vector can increase the geneticin resistance level, from 0.5mg/ml (1-2 copies) to 4mg/ml (7-12 copies), and the high-copy of the geneticin resistance gene can be inferred from the genetic linkage between the kan gene and the expression cassette (pAOX1 and the target gene).

Since the pPIC9K expression vector can be used for screening high-copy transformants, but the expression vector does not carry a Tag which is convenient for purification, the HIS6-Tag is added at the N end of the amino acid when the gene is synthesized, and the protein of interest can be purified by affinity chromatography.

The invention also provides a host cell containing the nucleotide sequence of the canine recombinant interferon α 7 or the recombinant expression vector.

Furthermore, the host cell is a pichia pastoris cell strain GS115, the GS115 contains HIS4 gene mutation and cannot synthesize histidine, and the expression vector pPIC9K contains the HIS4 gene as a selection marker, so that a transformant can grow in a histidine-deficient culture medium, and the GS115 is selected as the expression host cell to facilitate the selection of the transformant.

Pichia pastoris, as unicellular organism, is easy for gene construction and culture in laboratories, and as eukaryote it has the ability to modify proteins post-translationally, such as hydrolysis, folding, disulfide bond formation and glycosylation of proteins, so many proteins which are inactive or have low activity after being expressed in prokaryotic expression system can be successfully expressed in Pichia pastoris expression system. Compared with other expression systems, the expression system has the characteristics of relatively quick expression, simple operation, low experiment and production cost, high economical efficiency and high yield.

The invention also provides a preparation method of the canine recombinant interferon α 7, which comprises the following steps:

(1) connecting the nucleotide sequence gene of the canine recombinant interferon α 7 with a vector pPIC9K, transforming the gene into an escherichia coli competent cell DH5a, culturing, selecting a single colony, extracting a plasmid, and performing PCR identification;

(2) selecting a bacterial colony which is identified by PCR and sequenced correctly for amplification culture, then extracting recombinant plasmids, linearizing the recombinant plasmids, and then purifying;

(3) electrically transforming the linearized recombinant plasmid obtained in the step (2) into a pichia pastoris cell strain GS115, and sequentially carrying out incubation and culture until the diameter of a bacterial colony is 1 mm;

(4) and (3) culturing the recombinant strain GS115/pPIC9K-CaIFN- α 7 of the positive clone strain obtained in the step (3) in a BMGY culture medium until the OD600 value of the strain is 2-6, centrifuging, diluting the strain precipitate with an induction culture medium BMMY until the OD600 value is 1-2, culturing for 4-5 days, supplementing methanol every 24 hours until the final concentration is 1%, performing induction culture, centrifuging, collecting supernatant, and purifying to obtain the canine recombinant interferon- α 7 protein.

The invention provides application of the canine recombinant interferon α 7 in preparation of a VSV virus resistant medicament.

The canine recombinant interferon α 7 provided by the invention can be further prepared into a biological product which is further applied to antiviral drugs, and the biological product is preferably a freeze-dried preparation.

Compared with the prior art, the invention directionally clones the nucleotide sequence gene after codon optimization into pichia pastoris expression plasmid to construct recombinant plasmid, the recombinant plasmid is transformed into pichia pastoris competent cells to prepare recombinant bacteria, and the recombinant bacteria is introducedThe fermentation and expression of yeast are optimized by optimizing methanol induction conditions, induction concentration, induction time, protein harvesting time and the like, and the product yield is effectively improved by adopting an affinity chromatography method for purification, so that the canine recombinant interferon- α 7 with high yield, high purity and high activity is obtained, and the antiviral activity of the canine interferon α 7 recombinant protein is 1.03 multiplied by 10⁶IU/mL, specific activity 1.43X 10⁶IU/mg。

Drawings

FIG. 1 is a schematic diagram of the construction of pPIC9K-CaIFN- α 7 vector;

FIG. 2 shows the electrophoresis of linearized pPIC9K-CaIFN- α 7 plasmid, in lane 1 showing pPIC9K-CaIFN- α 7 plasmid, in lane 2 showing SacI linearized pPIC9K-CaIFN- α 7 plasmid, and M is DL5000DNA Marker;

FIG. 3 is a high copy transformant screening chart;

FIG. 4 shows the PCR identification result of recombinant strain GS115/pPIC9K-CaIFN- α 7, wherein lanes 1-8 are the PCR amplification products of 1-8 cloned genomic DNAs, 9 is the PCR product of Pichia pastoris GS115/pPIC9K genomic DNAs, and M is DL2000 DNAmarker;

FIG. 5 shows the SDS-PAGE identification result of the expression product of recombinant GS115/pPIC9K-CaIFN- α 7, wherein lane 1 is the culture supernatant of Pichia pastoris GS115/pPIC9K induced for 72h, lanes 2-9 are the culture supernatant of clone induced for 72h, and M is protein molecular weight Marker;

FIG. 6 shows the Western blot identification result of the expression product of recombinant strain GS115/pPIC9K-CaIFN- α 7, wherein lanes 1-8 are the culture supernatant of the clone strain induced for 72h, lane 9 is the culture supernatant of Pichia pastoris GS115/pPIC9K induced for 72h, and M is the pre-stained protein molecular weight Marker;

FIG. 7 is an SDS-PAGE analysis of purified product of canine recombinant interferon- α 7 protein, lane 1: sample loading, lane 2: flow-through sample, lane 3:80mM imidazole eluate, M is protein molecular weight Marker;

FIG. 8 is a Western blot analysis chart of a purified product of the canine recombinant interferon- α 7 protein, wherein 1 is a culture supernatant obtained by inducing Pichia pastoris GS115/pPIC9K for 72 hours, 2 is a purified sample, and M is a pre-stained protein molecular weight Marker;

FIG. 9 shows the results of the detection of the biological activity of the expression product of recombinant strain GS115/pPIC9K-CaIFN- α 7, C is a cell control group, and V is a virus control group.

Detailed Description

The present invention will be described in detail with reference to examples.

Example 1 optimization of Gene sequence encoding Canine Interferon- α 7 and primer design and Synthesis

The invention optimizes codon and synthesizes target gene sequence according to that the cDNA sequence (NM-001006654.1) of canine interferon- α 7 in GenBank is shown as SEQ ID No. 2. the codon of the gene for coding canine interferon- α 7 uses the most preferred codon of Pichia pastoris, the gene sequence of the optimized canine interferon- α 7 is shown as SEQ ID No.3, and the amino acid sequence of the coding protein is shown as SEQ ID No. 1.

Example 2 construction of pPIC9K-CaIFN- α 7 expression vector

The CaIFN- α 7 gene fragment shown in SEQ ID No.3 in example 1 and a vector pPIC9K are subjected to double enzyme digestion by EcoRI and NotI, a double enzyme digestion fragment is recovered, the CaIFN- α 7 gene fragment and the vector pPIC9K are connected at 16 ℃ overnight according to the molar ratio of 3: 1, transformed into an Escherichia coli competent cell DH5a, coated on an LB plate containing Amp (100ug/mL), cultured at 37 ℃ for 16-24h, single colonies are picked up, plasmids are extracted, PCR identification is carried out, and the plasmid is sent to a manufacturer for sequencing, and the construction schematic diagram of the pPIC9K-CaIFN- α 7 vector is shown in figure 1.

EXAMPLE 3 electroporation transformation of Yeast cells and selection of high expression transformants

Selecting a colony which is identified by PCR and sequenced correctly for amplification culture, selecting a high-purity plasmid large-extraction kit of Tiangen biochemical reagents, and extracting plasmids according to the instruction. Pichia pastoris GS115 competent cells were prepared according to the Invitrogen Pichia Expression Kit instructions. The recombinant plasmid was linearized with the restriction enzyme SacI and digested for 5h in a metal bath at 37 ℃. The linearization system is shown in Table 1.

TABLE 1

Reagent	Dosage (mu L)
		pPIC9K-CaIFN α 7 plasmid	About 1. mu.g
SacI	1μL
		Cut Smart buffer	2μL
Add dd H2O to	50μL

The linearized plasmid was then recovered by ethanol precipitation, the linearized plasmid was added to 0.1 volume of 3mol/L NaAc (pH5.2) and 2.5 volumes of absolute ethanol, centrifuged at-20 ℃ for 20min at 14,000r/min, the supernatant was decanted, 700. mu.L of 75% ethanol was added, rinsed after several minutes of high speed centrifugation, the supernatant was discarded and repeated once, the EP tube was inverted on a clean bench blotting paper for about 10 minutes, water and residual ethanol were removed as much as possible, 20. mu.L of ddH2O was redissolved, and after quantification, it was placed on ice for use, and the concentration of the recovered plasmid was determined by one-drop gel electrophoresis, the linearized and purified pPIC9K-CaIFN- α 7 plasmid was subjected to gel electrophoresis, the results were consistent with expectations, see FIG. 2.

100 mu L of the prepared yeast allelochemicals GS115 are mixed with 10 mu L (10-15 mu g) of linearized recombinant expression plasmids, the mixture is transferred into a precooled electrotransformation cup with the depth of 0.2cm, the liquid is gently shaken to the bottom of the cup, and the cup is immediately iced for 5 min. Wiping water vapor, placing on an electric transfer instrument, setting electric transfer parameters, and selecting the electric transfer parameters: the voltage is 1500v, the capacitance is 25 muF, the resistance is 200 omega, the electric shock time is 4-5 ms, and the electric conversion is immediately carried out.

Immediately after electrotransfer, 1mL of precooled 1mol/L sorbitol is added into an electrotransfer cup, the mixture is quickly and uniformly mixed, the mixture is transferred into a new 1.5mL EP tube, and the mixture is incubated for 1-2 h in an incubator at 30 ℃ without shaking. And (3) coating 100 mu L of bacterial liquid on an MD (MD) plate, inversely culturing for 3-5 days in a 30 ℃ culture box, and observing the growth of transformants. The diameter of the bacterial colony is 1 mm. Meanwhile, a mixture of DNA and GS115 cells transformed without electric shock was plated as a negative control.

Single colonies growing on the plates were picked with a sterile toothpick, inoculated sequentially by photolithography onto YPD plates containing G148 at a concentration gradient of 0, 0.25, 0.5, 0.75, 1.0, 2.0, 3.0, 4.0mg/mL, and high G418 resistant strains were selected step by step. The sequence of photocopies was from a YPD plate containing a higher concentration of G418 to a YPD plate containing a lower concentration of G418. The plate is placed in a constant temperature incubator at 30 ℃ for 3-5 days until a clone colony grows out (see figure 3).

Single colonies growing on high G418 YPD plates were picked up, and after picking with a pipette tip, the cells were dispersed in 10. mu.L of water, and the single colonies were stored by gently dipping the pipette tip onto a new pre-labeled MD plate. Boiling in boiling water bath for 10min, freezing in liquid nitrogen for 30min, boiling in boiling water bath for 10min, centrifuging at 12000r/min for 5min, taking supernatant as template, and performing PCR identification by respectively using a segment of sequence of target gene as upstream primer and downstream primer. The reaction system is shown in Table 2:

an upstream primer F: 5'-CGGAATTCATCACCATCACCATCACTGTC-3', respectively;

a downstream primer R: 5'-TTGCGGCCGCTTACTCCTTTCTTCTAATTC-3', respectively;

TABLE 2

PCR reaction system	Volume (μ L)
		2X Premix	10
Forward Primer 10μM	1
		Reverse Primer 10μM	1
Form panel	0.5
		Add dd H2O to	20

And (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 5 min; 30 cycles of 94 ℃ for 1min, 60 ℃ for 30s and 72 ℃ for 30 s; finally, extension is carried out for 10min at 72 ℃.

And (3) carrying out electrophoresis on the PCR product by using 1.0% agarose gel nucleic acid, and observing an electrophoresis result under an ultraviolet gel imager. As shown in fig. 4. The results showed that the PCR products of the 8 clones selected were consistent with the expected size.

Example 4 inducible expression and identification of recombinant Yeast engineered bacteria

The recombinant strain GS115/pPIC9K-CaIFN- α 7 and the empty vector transformed yeast GS115/pPIC9K monoclonal with 8 positive clones obtained in the example 3 are respectively inoculated into 20-30mL of BMGY culture medium, cultured at 30 ℃ and 220rpm/min for about 16-20 h until the OD600 value of the strain is 2-6 and 1500-3000 g, centrifuged at room temperature for 10min, the culture medium is discarded, the strain is collected, the strain precipitate is resuspended in 25mL of BMMY culture medium, the OD600 value is 1-2, the strain precipitate is cultured at 28 ℃ and 220rpm/min for 4-5 d, and methanol is supplemented every 24h until the final concentration is 1%.

After induction culture is finished, collecting culture supernatant, adding a sample into a protein Loading buffer, boiling for 10min at 100 ℃, taking 10 mu L of sample, and carrying out SDS-PAGE electrophoresis and western blot detection. The results of SDS-PAGE (FIG. 5) and Western blot (FIG. 6) showed that: the secretion supernatant can see obvious target bands at about 24KD and 27KD, because pichia pastoris has the effect of post-translational modification on exogenous recombinant protein, glycosylation modification can be carried out on the recombinant protein, the problem of incomplete N-glycosylation modification can exist, and the recombinant canine interferon has two N-glycosylation sites (at positions 78-80 and 133-135), so that two bands with different relative molecular weights are obtained due to incomplete glycosylation modification. Based on the expression level of clones 1-8, clone No. 5 was selected for subsequent experiments.

Example 5 purification of recombinant pPIC9K-CaIFN-a7 and protein quantification by Coomassie Brilliant blue method

Clone No. 5 was inoculated into 5mL YPD seed solution, cultured overnight, and then transferred to 50mL BMGY, which was cultured for 16-20 h at 30 ℃ with shaking table 220 r/min. Centrifuging 1500-3000 g of a sterilized centrifuge tube at normal temperature for 10min, diluting the thallus with an induction culture medium BMMY to an OD600 value of 1-2, culturing at 28 ℃ and 220rpm/min for 4-5 d, and supplementing methanol every 24h until the final concentration is 1%. After the induction culture is finished, collecting culture supernatant, filtering the culture supernatant by a 0.45 mu m filter, and performing affinity chromatography by using an affinity chromatography column, wherein the method comprises the following specific steps:

washing: cleaning of Ni with pure Water²⁺Chelating affinity chromatographic column and instrument pipeline.

Balancing: after 10 column volumes of pure water, 3-5 column volumes of Buffer A (50mM Tris,100mM NaClpH7.4) were equilibrated.

Loading: and when the conductivity value and the absorption value of 280nm wavelength are detected stably on line, the sample injection is started.

Balancing: after loading, the column was chromatographed using Buffer A, and unbound heteroproteins were washed off.

And (3) elution: the target protein was collected by washing with an Elution Buffer (50mM Tris,100mM NaCl,500mM MIDdazole, pH7.4) containing imidazole at various concentrations.

The components collected in the purification process are analyzed by SDS-PAGE, and the SDS-PAGE detection result shows that the molecular weight of the canine recombinant interferon- α 7 protein expressed by the recombinant strain is about 24KD, and the molecular weight is consistent with the expected target protein size.

Dialyzing the eluted components into a pH7.4Tris-HCl buffer system, detecting protein quantification by a Coomassie brilliant blue method, and controlling the concentration of the purified canine recombinant interferon- α 7 protein to be 0.72 mg/mL.

Example 6 Western blot identification of expression products

Adding protein loading buffer into purified dog recombinant interferon- α 7, boiling for 10min at 100 ℃, taking 10 microliter boiled sample, loading, selecting 15% SDS-PAGE gel electrophoresis, electrically transferring the polyacrylamide gel after electrophoresis to a PVDF membrane by an electrowetting transfer system with the parameters of 300mA and 60min, taking out the PVDF membrane, sealing for 1h at 37 ℃ in TBST of 5% skimmed milk powder, discarding liquid, washing the membrane with TBST, adding Anti-His monoclonal antibody, incubating overnight at 4 ℃, washing the membrane with TBST for 3 times, 8min each time, adding HRP-goat Anti-mouse monoclonal antibody diluted by 1:10000, incubating for 1h at 37 ℃, washing the membrane with TBST for 3 times, 8min each time, directly developing with DAB developing solution, photographing and recording, as shown in figure 8, a KD-blot result shows that an expression product can be specifically combined with the monoclonal antibody, has obvious reaction bands at 24 and 27 positions, is consistent with an SDS-result, and shows that the expression product has good immunoreactivity.

Example 7 detection of biological Activity of Canine recombinant Interferon- α 7

Antiviral Activity of the purified Canine recombinant Interferon- α 7 of example 5 on the MDCK-VSV System Using the Microcytopathy inhibition method

Preparing a solution of a to-be-detected product: and sequentially carrying out 2-fold gradient dilution on the interferon in a 96-well cell culture plate from 1: 20000, wherein each dilution is carried out with one multiple hole, and 10 dilutions (1-10 holes) are carried out in total.

Removing culture medium in the full monolayer cell bottle, washing with PBS for 2 times, digesting, collecting cells, and preparing into 3.0 × 10/ml with nutrient solution⁵～4.0×10⁵Cell suspensions of individual cells were inoculated into the above 96-well cell culture plate, 100. mu.l per well, and cultured at 37 ℃ under 5% CO2 for 24 hours; the supernatant of the cell culture plate was discarded, and the VSV virus solution to be used was diluted with a maintenance solution (stored at-80 ℃) to 100TCID50/0.1mL, and then added to each well of the cell plate in an amount of 100. mu.l per well, followed by being placedIn a 5% CO2 incubator at 37 ℃, a No. 11 hole is a cell control C, no interferon protection and no VSV virus liquid are added, and only cell suspension is added; well 12 is virus control V, no interferon protection, and VSV virus fluid only.

Culturing for 18-24 h, observing half cell lesion number, taking the highest dilution with 50% cell lesion as an Interferon Unit (IU), calculating the activity (IU/mg) of the canine interferon α 7 recombinant protein according to a Reed-muench method, and indicating that the antiviral activity of the canine interferon α 7 recombinant protein is 1.03 multiplied by 10⁶IU/mL (see FIG. 9), specific activity 1.43X 10⁶IU/mg, in conclusion, the canine interferon α 7 recombinant protein has better in vitro antiviral activity.

The above detailed description of the canine recombinant interferon α 7 and the preparation method and use thereof, the expression vector containing the canine recombinant interferon α 7, and the host cell with reference to the examples is illustrative and not intended to be limiting, and several examples are given by way of limitation, so that variations and modifications thereof without departing from the general concept of the present invention are within the scope of the present invention.

SEQUENCE LISTING

<110> Jiuzhuan Biotechnology Co., Ltd, Anhui; tu lake InteFell BioProcessary research institute Co Ltd

<120> canine recombinant interferon α 7, preparation method and application thereof, expression vector containing canine recombinant interferon α 7 and application thereof

Host cell

<130>1

<160>3

<170>PatentIn version 3.3

<210>1

<211>510

<212>PRT

<213> amino acid sequence of canine recombinant interferon α 7

<400>1

1 His His His His His His Cys His Leu Pro Asp Thr His Gly Leu Arg Asn TrpArg Val

21 Leu Thr Leu Leu Gly Gln Met Arg Arg Leu Ser Ala Gly Ser Cys Asp HisTyr Thr Asn

41 Asp Phe Ala Phe Pro Lys Glu Leu Phe Asp Gly Gln Arg Leu Gln Glu AlaGln Ala Leu

61 Ser Val Val His Val Met Thr Gln Lys Val Phe His Leu Phe Cys Pro AspThr Ser Ser

81 Ala Pro Trp Asn Met Thr Leu Leu Glu Glu Leu Cys Ser Gly Leu Ser GluGln Leu Asp

101 Asp Leu Glu Ala Cys Pro Leu Gln Glu Ala Gly Leu Ala Glu Thr Pro LeuMet His Glu

121 Asp Ser Thr Leu Arg Thr Tyr Phe Gln Arg Ile Ser Leu Tyr Leu Gln AspArg Asn His

141 Ser Pro Cys Ala Trp Glu Met Val Arg Ala Glu Ile Gly Arg Ser Phe PheSer Ser Thr

161 Ile Leu Gln Glu Arg Ile Arg Arg Lys Glu

<210>2

<211>492

<212>DNA

<213> Gene sequence before optimization of canine recombinant interferon α 7

<400>2

cacctgcccg acacccacgg cctgcgcaac tggagggtcc tgacgctcct gggacagatg 60

aggagactct ccgccggctc ttgtgaccac tacaccaatg actttgcctt ccccaaggag 120

ctgtttgatg gccagcggct ccaggaggcg caggccctct ctgtggtcca cgtgatgacc 180

cagaaggtct tccacctctt ctgcccggac acgtcctctg ctccttggaa catgactctc 240

ctggaggaac tgtgctcggg gctctctgag cagctggatg acctggaggc ctgtcccctg 300

caggaggcgg ggctggccga gacccccctc atgcatgagg actccaccct gaggacctac 360

ttccaaagga tctccctcta cctgcaagac aggaaccaca gcccgtgtgc ctgggagatg 420

gtccgagcag aaatcgggag atccttcttc tcctcgacaatcttgcaaga aagaatcagg 480

aggaaggaat ga 492

<210>3

<211>510

<212>DNA

<213> optimized gene sequence of canine recombinant interferon α 7

<400>3

catcaccatc accatcactg tcatttgcca gatactcacg gtttgagaaa ctggagagtt 60

ttgactttgt tgggtcaaat gagaagattg tctgctggtt cttgtgatca ttacactaac 120

gatttcgctt tccctaagga attgtttgat ggtcaaagat tgcaagaggc tcaagctttg 180

tctgttgttc atgttatgac tcaaaaggtt ttccacttgt tctgtccaga tacttcttct 240

gctccttgga acatgacttt gttggaagag ttgtgttctg gtttgtctga acaattggat 300

gatttggagg cttgtccatt gcaagaagct ggtttggctg agactccttt gatgcatgaa 360

gattctactt tgagaactta cttccaaaga atctctttgt atttgcaaga tagaaatcac 420

tctccatgtg cttgggaaat ggttagagct gagatcggta gatctttctt ttcttctact 480

atcttgcaag aaagaattag aagaaaggag 510

Claims (7)

1. The canine recombinant interferon α 7 is characterized in that the nucleotide sequence of the canine recombinant interferon α 7 is shown as SEQ ID No. 3.

2. A recombinant expression vector comprising the nucleotide sequence of the canine recombinant interferon α 7 of claim 1.

3. A host cell comprising the nucleotide sequence of canine recombinant interferon α 7 of claim 1 or the recombinant expression vector of claim 2.

4. The host cell of claim 3, wherein the host cell is Pichia pastoris cell strain GS 115.

5. The method of claim 1 for preparing canine recombinant interferon α 7, wherein the method comprises the steps of:

(1) connecting the nucleotide sequence gene of the canine recombinant interferon α 7 of claim 1 with a vector pPIC9K, transforming into an escherichia coli competent cell DH5a, culturing, picking out a single colony, extracting a plasmid, and performing PCR identification;

(2) selecting a bacterial colony which is identified by PCR and sequenced correctly for amplification culture, then extracting recombinant plasmids, linearizing the recombinant plasmids, and then purifying;

(3) electrically transforming the recombinant plasmid obtained in the step (2) into a pichia pastoris cell strain GS115, and sequentially carrying out incubation and culture until the diameter of a bacterial colony is 1 mm;

(4) and (3) culturing the recombinant strain GS115/pPIC9K-CaIFN- α 7 of the positive clone strain obtained in the step (3) in a BMGY culture medium until the OD600 value of the strain is 2-6, centrifuging, diluting the strain precipitate with an induction culture medium BMMY culture medium until the OD600 value is 1-2, culturing for 4-5 days, supplementing methanol every 24 hours until the final concentration is 1%, performing induction culture, centrifuging, collecting supernatant, and purifying to obtain the canine recombinant interferon- α 7 protein.

6. The use of the canine recombinant interferon α 7 of claim 1 in the preparation of a medicament against VSV virus.

7. A biological product comprising the canine recombinant interferon α 7 of claim 1.

Images