CN113549634B - Gene for coding soluble HPV58L1 protein and construction and application of recombinant plasmid thereof - Google Patents

Abstract

The invention discloses a gene for coding soluble HPV58L1 protein and construction and application of recombinant plasmid thereof. The gene HPV58L1 is obtained by optimization design on the basis of comprehensive multiple complex factors, and recombinant plasmids pUC-58L1 and pESUMO-58L are constructed. The HPV58L1 gene can obviously improve the soluble expression efficiency of the target protein, and the product has uniform property and stable performance, and the expression quantity of the target protein can meet the requirement of industrial production; the invention provides a low-cost prokaryotic expression method of soluble HPV58L1 protein, which is characterized in that the HPV58L1 protein and SUMO protein are subjected to fusion expression, and recombinant expression protein with good solubility and obvious hemagglutination activity can be obtained.

Description

Gene for coding soluble HPV58L1 protein and construction and application of recombinant plasmid thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a gene for coding soluble HPV58L1 protein and construction and application of recombinant plasmid thereof.

Background

According to statistics, 57 ten thousand new cases and 31.1 ten thousand death cases of cervical cancer worldwide in 2018 are the fourth most common female cancer, and long-term persistent infection of High Risk type Human papilloma virus (HR-HPV) is an important cause for cervical canceration. Human Papilloma Virus (HPV) is a double-stranded small-molecule DNA virus with strict species specificity, mainly infects Human skin and mucosal tissues, has high diversity and species specificity, and exhibits significant differences in geographical and ethnic distributions. HPV58 is one of the most common oncogenic subtypes; worldwide, HPV58 is ranked sixth in the etiology of cervical cancer, but is more prevalent in east asian, with the detection rate ranking to the third after HPV 16 and HPV 18, accounting for 10% -18% of all cases. In addition to cervical cancer, HPV infection is closely related to diseases such as anogenital cancer, head and neck squamous cell carcinoma, and skin warts.

HPV is a kind of small dsDNA virus, its genome size is about 8000 bp, and its molecular weight is about 5X 10 ⁶ Dalton, diameter of 50-60 nm, regular icosahedron structure. Contains 8 Open Reading Frames (ORFs) which encode different proteins, and is classified into: early, late and long control regions. The early region is located downstream of the genome and encodes a participating virusThe replicated and transcribed non-structural proteins E1, E2, E4, E5, E6 and E7. The late region is about 2500 bp in size, encodes L1 and L2 structural proteins, and the two proteins together form the capsid of the virus. The L1 protein is the major capsid protein of HPV, is encoded by the L1 ORF, and serves as the basis for HPV typing due to the very high conservation of the L1 ORF. The L1 protein is about 55-60 kDa in size. In general, 5L 1 proteins polymerize to form 5-mers, and 72 5-mers together with a certain number of L2 proteins constitute a viral capsid with a 20-hedral structure of T = 7.

Research shows that L1 protein can self-assemble to form Virus-like particles (VLP) under proper conditions, all approved HPV preventive vaccines are developed based on VLP, but related vaccines are developed by using a baculovirus expression system, so the production cost is high, the price is high, the protective subtype is limited, and the popularization rate in developing countries and low-income areas is low.

Disclosure of Invention

The invention aims to provide a gene for coding soluble HPV58L1 protein, recombinant plasmid and recombinant engineering bacteria thereof, and a method for expressing the HPV58L1 protein, and aims to improve the solubility, the activity and the expression quantity of the HPV58L1 protein and reduce the preparation cost thereof.

In order to solve the technical problems, the invention adopts the following technical scheme:

modifying based on wild type HPV58L1 gene, and adopting nucleotide codon with highest use frequency in escherichia coli for all corresponding amino acids; moreover, the secondary structure of the mRNA can not influence the translation efficiency in order to avoid the high GC ratio of the translated mRNA, and the optimal codon frequency can be corrected by avoiding some common enzyme cutting sites; finally, on the basis of comprehensively considering multiple complex factors, a brand-new HPV58L1 DNA sequence is researched and designed, and is shown as SEQ ID NO. 1.

The HPV58L1 DNA gene obtained by synthesis and optimization is loaded into a pUC57 plasmid to form a recombinant plasmid pUC-58L1; and a recombinant plasmid pESUMO-58L is constructed.

The method for constructing the recombinant plasmid for expressing the soluble HPV58L1 protein comprises the following steps:

(1) Designing an amplification primer of the gene HPV23L1, wherein a forward primer comprisesBsa IRestriction enzyme site, reverse primer including flanking stop codonXho IA restriction enzyme site;

(2) PCR amplifying gene HPV58L1 by using the amplification primer;

(3) Respectively carrying out restriction endonuclease on pESUMO plasmid and obtained PCR amplification productBsa IAndXho Idouble digestion, recovering double digestion products of empty vector plasmid pE-SUMO and HPV58L1 gene, connecting overnight at 16 ℃ by using T4 DNA ligase to obtain recombinant plasmid;

(4) The recombinant plasmid pESUMO-58L1 obtained in the previous step is transformed into an escherichia coli competent cell BL21 and coated on Amp ⁺ Culturing on an LB solid culture medium, selecting a single colony to perform bacteria liquid PCR identification, screening a positive colony, extracting positive colony plasmid, and obtaining a recombinant plasmid for expressing the soluble HPV58L1 protein if a sequencing result is correct.

The sequences of the amplification primers are as follows:

primer name	Cleavage site	Sequence 5'-3'
			F-58	Bas I	TT GGTCTC TAGGTATGTCCGTGTGGCGTC
R-58	Xho I	CCG CTCGAG TTATTTTTTAACCTTTTTGCGT

The preparation method of the soluble human papilloma virus 58 subtype L1 protein comprises the following steps:

(1) Inoculating the recombinant plasmid pESUMO-58L1 to Amp ⁺ Culturing in LB liquid culture medium to OD ₄₅₀ When the concentration of the inducer IPTG is 0.75-0.85, the concentration is 0.3 mmol/L,Inducing expression at 18 ℃;

(2) After induction expression is finished, centrifugally collecting thalli, washing, crushing, centrifugally separating and collecting supernate;

(3) And eluting and purifying the supernatant through a Ni affinity chromatography column to obtain the SUMO-58L1 protein.

Compared with the prior art, the invention has the main beneficial technical effects that:

(1) The invention optimizes the HPV58L1 gene, so that the HPV58L1 gene can efficiently express the target protein HPV58L1 in an escherichia coli host, and the fusion expression is carried out in the escherichia coli based on the SUMO label expression system, so that the solubility of the target protein is increased, and the expressed target protein has higher biological activity.

(2) The gene and the expression system thereof can obviously improve the soluble expression efficiency of the target protein, and the prepared purified product has uniform property and good stability; the protein expression amount is up to 100 mu g/ml, and the requirement of industrial production can be met.

(3) The invention provides a low-cost prokaryotic expression method of soluble HPV58L1 protein, which is characterized in that the HPV58L1 protein and SUMO protein are fused and expressed, and recombinant expression protein with good solubility and obvious hemagglutination activity can be obtained.

Drawings

FIG. 1 shows a PCR and double digestion identification map of recombinant plasmid; wherein the content of the first and second substances,

FIG. A shows PCR identification of bacterial liquid of pESUMO-58L 1; m, marker; lanes 1-8, pESUMO-58L1 amplification product;

FIG. B shows the double restriction enzyme identification of the recombinant expression vector: m, marker; lane 1 shows the product of pESUMO-58L1 double digestion.

FIG. 2 is a diagram of the preliminary expression and identification profile of the recombinant SUMO-L1 protein; wherein the content of the first and second substances,

panel A is a 12% SDS-PAGE identification; m: a protein Marker;1: pE-SUMO-L1 empty bacteria are not induced; 2: inducing the pE-SUMO-L1 expression bacteria for 10 hours; 3: BL21 (DE 3) control group of airborne microorganisms (NC);

b is Western Blot identification; m: a protein Marker;1: NC comparison; 2: SUMO-L1 recombinant protein;

panel C is solubility analysis. M: a protein Marker;1: ultrasonic precipitation; 2: and (4) ultrasonic supernatant treatment.

FIG. 3 is a diagram showing the purification and identification of E.coli-expressed recombinant protein of HPV58L1; wherein the content of the first and second substances,

panel A shows the results of 12% SDS-PAGE identification; m. protein Marker;1.SUMO-58L1 protein before purification; 2. purified SUMO-58L1 protein;

and B, western Blot identification. Protein Marker in the figure; 1. purified SUMO-58L1 protein.

FIG. 4 shows the result of SUMO protease purification and SUMO-tag cleavage of the recombinant SUMO-58L1 protein; wherein the content of the first and second substances,

panel A is an SDS-PAGE identification of purified SUMO protease (Ulp 1); wherein m. protein Marker;1. purified Ulp1;

panel B is an SDS-PAGE identification of UMO-tag excision; m. protein Marker; SUMO-58L1 protein; 2. performing enzyme digestion reaction on the product; 3. purifying the concentrated HPV58L1 protein.

FIG. 5 shows the hemagglutination activity assay of recombinant proteins, wherein 1; NC is PBS negative control.

FIG. 6 shows the results of the measurement of the growth and the potency of the serum antibody of the immunized mouse; wherein the content of the first and second substances,

panel A shows the results of ELISA assays on sera at 0, 7, 14, 21, 28 and 36d after immunization;

panel B shows the serum titer of 36d immunized mice.

FIG. 7 shows the results of indirect Immunofluorescence (IFA) assays; wherein the content of the first and second substances,

panel A shows pcDNA3.1-GFP transfected 293T cells;

b is the reaction condition of 293T cell transfected by pcDNA3.1-HPV 58L1 and immune serum;

panel C is a Blank Control (BC) with PBS instead of mouse serum;

panel D is the serum from mice immunized with PBS as a Negative Control (NC).

Detailed Description

The following examples are provided to illustrate the present invention in detail and are not intended to limit the scope of the present invention in any way.

The experimental procedures, in which specific conditions are not specified, in the following examples are generally carried out according to conventional conditions, such as those described in (molecular cloning: A laboratory Manual, fourth edition 2012 of the original book).

DNA extension and PCR amplification reagents and restriction enzymes in the following examplesBsaI, ecoRI and Xho IFrom NEB (New England Biolabs, Inc.); the anti-HRP labeled goat anti-mouse IgG used was purchased from Abcam.

In the following examples, the formulation of the lysis buffer used in the purification step was: PBS (3-morpholine propanesulfonic acid), pH7.4.

EXAMPLE one construction of recombinant expression plasmid

1. Cloning of HPV58L1 protein coding region gene

1.1 Design synthesis of HPV58L1 gene sequence

The HPV58L1 gene sequence is a DNA sequence optimized by preferred codons of escherichia coli, and specifically comprises the following steps:

firstly, transforming wild HPV58L1 gene, and adopting nucleotide codon with highest use frequency in escherichia coli for all amino acids; meanwhile, in order to avoid the phenomenon that the GC proportion of the translated mRNA is too high, the secondary structure of the mRNA affects the translation efficiency, some common enzyme cutting sites are avoided, the optimal codon frequency is corrected, other influencing factors are comprehensively considered, and finally a brand-new HPV58L1 DNA sequence is researched and designed, wherein the sequence is shown as SEQ ID No. 1.

The HPV58L1 DNA obtained by optimization is synthesized by the company of Biotechnology engineering (Shanghai), and the synthesized gene is directly loaded into the pUC57 plasmid, named as recombinant plasmid pUC-58L1.

2. PCR amplification and double digestion recovery of HPV58L1 gene

2.1 Design and Synthesis of primer sequences

Designing and synthesizing a forward primer according to the HPV58L1 gene sequence, and specifically referring to Table 1; wherein the forward direction isThe object F-58 comprisesBsa IA restriction enzyme site; the reverse primer R-58 includes a stop codon flanked byXhoIRestriction enzyme sites, which are indicated by underlining in the primer sequences.

TABLE 1 primer List

Primer name	Cleavage site	Sequence (5 '-3')
			F-58	Bas I	TT GGTCTC TAGGTATGTCCGTGTGGCGTC（SEQ ID NO.2）
R-58	Xho I	CCG CTCGAG TTATTTTTTAACCTTTTTGCGT（SEQ ID NO.3）

2.2 PCR amplification and recovery of HPV58L1 Gene

A pUC57-HPV 58L1 plasmid containing HPV58L1 genes and synthesized by a biological company is used as a template, F-58 and R-58 primers are used for amplifying target genes, and an amplification system is as follows:

volume of the components (50 μ L)

Primer STAR Max 25 μL

F-58 1 μL

R-58 1 μL

pUC57-HPV 58L1 plasmid 1. Mu.L (10 ng)

Sterile DDW 22. Mu.L.

The total reaction system is 50 mu L, and the PCR reaction conditions are as follows: pre-denaturation at 95 ℃ for 5min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 90 s; a total of 30 cycles; extension at 72 ℃ for 10 min. After the PCR is finished, the obtained product is subjected to electrophoretic identification, and after the identification, the successfully amplified L1 gene is recovered by using a DNA recovery kit.

2.3 Double digestion recovery of PCR amplification product and empty vector plasmid

The pESUMO plasmid and the PCR amplification product (HPV 58L1 gene) were separately subjected to restriction endonucleaseBsa IAndXhothe specific reaction conditions of the double digestion are as follows:

the enzyme digestion system is as follows:

HPV58L1 gene or pESUMO plasmid 20. Mu.L

10×Buffer 5 µL

Bsa I 1μL

Xho I 1μL

Double distilled water 23. Mu.L.

The total volume was 50. Mu.L, and the reaction conditions were 37 ℃ for 4 hours. The empty vector plasmid pE-SUMO and the double-restriction products of HPV58L1 gene were then recovered separately and ligated with T4 DNA ligase at 16 ℃ overnight in a ligation reaction (20. Mu.L) as follows:

HPV58L1 Gene 3. Mu.L

pE-SUMO 9 μL

10×T4 Buffer 2μL

T4 DNA Ligase 1 μL

Sterile DDW 5. Mu.L.

Transformation of ligation product pE-SUMO-L1E.coliAnd (3) selecting positive clones by the competent cell DH5 alpha through bacterial liquid PCR and double enzyme digestion identification, and carrying out positive sequencing on the quality-improved particles to obtain a recombinant plasmid pESUMO-58L1 after the sequencing is correct.

3. Construction of recombinant expression bacteria of HPV58L1 protein

Respectively transforming the recombinant plasmid pESUMO-58L1 into escherichia coli competent cells BL21, and coating the escherichia coli competent cells BL21 on Amp ⁺ Culturing on an LB solid culture medium, selecting a single colony to carry out bacteria liquid PCR identification and double enzyme digestion (see figure 1), screening positive colonies, extracting positive colony plasmids to carry out sequencing, and naming the sequencing result as recombinant plasmids pSUMO-HPV58L1 with correct sequencing result, namely the recombinant plasmids for expressing soluble human papilloma virus 58 subtype L1 protein.

Example II Primary inducible expression and identification of HPV58 subtype L1 protein

1. Expression and identification of E.coli expression strains of HPV58L1

Inoculating Escherichia coli expression strain pESUMO-58L1 to Amp ⁺ Culturing in LB liquid culture medium to OD ₄₅₀ When the value is about 0.8, IPTG is added to make the final concentration be 0.3 mmol/L, and then the induction expression is carried out for 12h at the temperature of 18 ℃; after induction expression is finished, thalli are collected in a centrifugal mode, a small part of thalli are taken to be identified by SDS-PAGE and West-Blotting, meanwhile, no-load escherichia coli is set as a control, the result is shown in figure 2, and a target band of an expression product of pESUMO-58L1 at the position of about 80kDa can be seen from the figure, and the HPV58L1 protein is about 58kDa; the SUMO label is about 12kDa, HIS-tag is added, the molecular weight of the SUMO-58L1 protein of the fusion protein is about 72kDa, and the HIS-tag is positively charged, so that the migration rate in SDS-PAGE electrophoresis is delayed, and the predicted positions of target bands at 80kDa are basically consistent, which indicates that the recombinant protein SUMO-58L1 is expressed in pESUMO-58L1 expression strain.

2. Solubility analysis of recombinant protein HPV58-L1

After the induction expression for 18 h at 16 ℃ with the inducer IPTG concentration of 0.3 mmol/L, pESUMO-58L1 expression thalli were collected, resuspended in PBS and then treated by ultrasonication, and the supernatant and the precipitate were identified by 12% SDS-PAGE, respectively. The results showed that protein bands were present at the approximately 80kDa position of both the sonicated supernatant and the pellet of pESUMO-58L1, while the expression level in the recombinant SUMO-58L1 protein supernatant was overall higher than that of the pellet (FIG. 2C).

EXAMPLE III purification and Activity identification of HPV58L1 recombinant proteins

1. Purification of HPV58L1 recombinant proteins

Mixing the rest thallus with a washing buffer solution according to the weight ratio of 1. Mixing the thallus precipitate and the bacteria breaking buffer solution according to the weight ratio of 1.

Purifying the supernatant through a Ni affinity chromatography column, wherein the elution mode is as follows: wash Buffer, pH8.0 50mmol/L Tris-HCl Buffer +20 mmol/L imidazole containing 250mmol/L NaCl; elution Buffer pH8.0, 50mmol/L Tris-HCl Buffer solution containing 250mmol/L NaCl +200 mmol/L imidazole), collecting the eluted components, detecting by SDS-PAGE and Western-blot, and confirming that the molecular weight of the SUMO-23 L1 protein obtained by purification is consistent with the expected result at 80kDa, thus proving that SUMO-23 L1 protein is successfully obtained.

2. Excision of SUMO-58L1 recombinant protein SUMO tag

And (3) constructing an enzyme digestion reaction system after the Ulp1 protease is purified by using Ni-NTA, and carrying out enzyme digestion on the SUMO-L1 protein to remove the SUMO-tag. The enzyme cutting system is as follows: the ratio of the Ulp1 protease to the SUMO-L1 protein is 1, the enzyme digestion system comprises 50mmol/L Tris-HCL, 200 mmol/L NaCl and 1 mmol/L DTT, the pH condition is 8.0, and after the enzyme digestion system reacts for 3 hours at 30 ℃, the enzyme digestion reaction system is sampled and analyzed by 12% SDS-PAGE. After the recombined SUMO-L1 protein reacts with the ULP1 protease, enzyme digestion reaction liquid passes through a Ni-NTA chromatographic column, each component of SUMO-tag, the ULP1 protease, the L1 protein and the like in an enzyme digestion system is separated, and the collected L1 protein is concentrated through an Amicon Ultra centrifugal filter to improve the protein concentration.

As shown in FIG. 4, ulp1 purified with Ni column showed a single band at 48 kDa, which is about 90% pure (FIG. 4A); after the ULP1 cuts the recombinant SUMO-L1 protein by enzyme, SDS-PAGE results show that the ULP1 can specifically cut the recombinant HPV58L1 protein containing the SUMO tag, after the enzyme cutting, the target protein size of the HPV58L1 is about 58kDa, and the SUMO tag size is about 12.4 kDa (figure 4B); the enzyme digestion system passes through a Ni-NTA chromatographic column, each component of SUMO-tag, ulp1 protease, L1 protein and the like in the system is separated, the collected L1 protein is concentrated through an Amicon Ultra centrifugal filter, and the protein purity is about 95%.

3. Hemagglutination Assay (HA) for identifying recombinant HPV58L1 protein activity

3.1 Method for preparing red blood cells

Sucking 1ml of fresh mouse blood with a sterile syringe into a sterile centrifuge tube containing 1,000u of heparin (anticoagulation); adding 9ml PBS into the centrifuge tube, centrifuging for 5min at 1500r/min, and removing the supernatant; resuspending the erythrocytes with 10ml PBS, centrifuging at 2000r/min for 10min, discarding the supernatant, and thus washing the erythrocytes three times; and finally, preparing a mouse erythrocyte suspension with the volume fraction of 1% by using PBS according to the required dosage.

3.2 HA

Hemagglutination test: a96-well microtube coagulation reaction plate was removed, and 25. Mu.l of PBS was pipetted from the 1 st well to the 8 th well by 25. Mu.l per well. Sucking 25 mul of purified HPV58L1 recombinant protein, adding into the 1 st hole, sucking 25 mul from the 1 st hole after fully mixing, adding into the 2 nd hole, sucking 25 mul from the 2 nd hole, adding into the 3 rd hole after fully mixing again, repeating the steps until the 5 th hole is diluted by times, and adding 25 mul PBS into each of the 6 th, 7 th and 8 th holes to set as negative control. 25. Adding mu.l of 1% mouse erythrocyte suspension from the 8 th hole to the 1 st hole, suspending, shaking and mixing uniformly; standing at room temperature for 40min, photographing and recording the experimental result. Hemagglutination experiments showed that the purified HPV58L1 protein has hemagglutination activity to agglutinate mouse erythrocytes with a hemagglutination valence of 1.

EXAMPLE IV animal experiments with HPV58L1 recombinant proteins

1. Immunization procedure

Animal grouping: mice to be immunized (6-8 week old female Balb/c mice) were divided into three groups of 4 mice each, with the immunizing doses of 20. Mu.g/mouse, 5. Mu.g/mouse and NC group (PBS), respectively. The immunization mode comprises the following steps: in the experiment, a subcutaneous multipoint injection method is adopted to immunize an experimental mouse for 3 times in total, and the interval time of each time is two weeks. Collecting a serum sample: mice were bled at 0 d, 7 d, 14 d, 21 d, 28 d and 36d, respectively, for tail-off: after the tail of the mouse is broken, 10 mu L of blood at the tail end of the mouse is sucked by using a micropipette and diluted in 990 mu L of PBS buffer solution (1.

2. Preliminary immune evaluation

(1) ELISA for determining serum titer

L1 protein was diluted to a concentration of 4. Mu.g/mL with CBS solution, 100. Mu.L per well was added to a 96-well plate and coated for 2h at 37 ℃. Washed 5 times with PBST and blocked overnight at 4 ℃ with 300. Mu.L per well of 5% skim milk solution. Mouse immune sera were incubated for 1h at 37 ℃ as primary antibody at 2-fold gradient dilutions, with dilutions of 1. PBST was washed 5 times, 100. Mu.L of HRP-goat anti-mouse IgG (1. PBST is washed for 5 times, TMB substrate color development solution is added into 50 μ L of each well for reaction for 5min, and 2mol/LH is added into 50 μ L of each well ₂ SO ₄ The reaction was stopped and the absorbance read at 450 nm. When the OD of the detection hole is ₄₅₀ Value is not less than negative NC hole OD ₄₅₀ When the value is 2.1 times (P/N is more than or equal to 2.1), the well is judged to be a positive well, and the dilution factor of the antibody corresponding to the well is the titer of the antibody.

The ELISA results showed that specific antibodies were produced in either the 20 μ g or 5 μ g group compared to the PBS group, and the specific antibody levels increased with the increase in the number of immunizations and the passage of immunization time (fig. 6A); the serum titer of the mice at 36 days after immunization can reach 1.024 × 10 ⁵ (FIG. 6B).

(2) Indirect immunofluorescence assay (IFA)

293T cells at 2X 10 ⁴ One/well was seeded in 96-well cell plates. And after the growth reaches about 60 percent of confluence, mixing the plasmids pcDNA3.1-GFP and pcDNA3.1-HPV 58L1 which are prepared in advance with Lipofectamine 2000 respectively, adding serum-free DMEM, standing for 20 min after mixing uniformly, sucking the cell culture supernatant, adding the mixed solution into a cell culture plate, and supplementing complete DMEM culture medium after 6 h. After 48 h of transfection, the transfection condition was judged by observing the expression condition of GFP, and pcDNA3.1 was transfected without load as a negative control. Transfected cells were fixed with pre-chilled methanol for 20 min, blocked with 5% skim milk at 37 ℃ for 1h, primary antibody selected from immune serum diluted 1. Mouse sera were immunized with PBS as Negative Control (NC), mouse sera were replaced with PBS as Blank Control (BC), secondary antibodies were incubated with FITC-goat anti-mouse IgG diluted 1.

IFA results showed successful expression of control GFP protein, indicating successful transfection (fig. 7A); and the pcDNA3.1-HPV 58L1 is transfected into 293T cells for transient expression and then incubated with mouse immune serum, and obvious green fluorescence can also be observed, which indicates that the eukaryotic HPV58L1 can perform specific reaction with the mouse immune serum (figure 7B), and indicates that the mouse can generate specific antibodies in vivo after being immune-stimulated by HPV58L1 protein obtained by prokaryotic expression.

While the invention has been described in detail with reference to the drawings and examples, it will be understood by those skilled in the art that various changes in the specific parameters of the embodiments described above may be made or equivalents of related steps, methods and materials may be substituted without departing from the spirit of the invention to form multiple embodiments, which are common variations of the invention and will not be described in detail herein.

SEQUENCE LISTING

<110> Zheng Zhou university

<120> gene encoding soluble HPV58L1 protein and construction and application of recombinant plasmid thereof

<130> /

<160> 3

<170> PatentIn version 3.2

<210> 1

<211> 1497

<212> DNA

<213> HPV58L1

<400> 1

atgtccgtgt ggcgtccgtc tgaggccact gtgtacctgc cgccggtgcc ggtgtctaag 60

gttgtaagca ctgatgaata tgtgtctcgc accagcattt attattatgc tggctcttcc 120

cgtctgctgg ctgttggcaa tccatacttc tccatcaaat ctccgaacaa caacaaaaaa 180

gtactggttc cgaaggtatc tggcctgcag tatcgtgtct ttcgtgtgcg tctgccggat 240

cccaacaagt tcggtttccc ggacaccagc ttctacaacc cggataccca acgtctggtc 300

tgggcatgtg taggcctgga aatcggtcgt ggtcagccac tgggtgttgg cgtatctggt 360

catccgtatt tcaacaaatt tgatgacact gaaacctcta accgttatcc ggcacagcca 420

ggttctgata accgtgaatg cctgtctatg gattataaac aaacccaact gtgtctgatt 480

ggctgtaaac cgccgactgg tgagcattgg ggtaaaggtg ttgcctgtaa caacaacgca 540

gctgctactg attgtccgcc actggaactg tttaactcta ttattgagga tggtgacatg 600

gtagataccg gttttggttg catggacttt ggtaccctgc aggctaacaa atctgatgtg 660

ccgattgata tttgtaactc tacctgcaaa tatccagatt atctgaaaat ggcctctgaa 720

ccgtatggtg attctctgtt cttttttctg aggcgtgagc agatgttcgt tcgtcacttc 780

ttcaaccgtg ccggtaaact gggcgaggct gtcccggatg acctgtatat taaaggttcc 840

ggtaacactg cagttatcca atcttctgca ttttttccaa ctccgtctgg ctctatggtt 900

acctctgaat ctcaactgtt taacaagccg tattggctgc agcgtgcaca aggtcataac 960

aacggcattt gttggggcaa tcagctgttc gtgaccgtag ttgataccac tcgtagcact 1020

aacatgaccc tgtgcactga agtaactaag gaaggtacct ataaaaacga taactttaag 1080

gaatatgtac gtcatgttga agaatacgac ttacagttcg tgttccagct gtgcaagatt 1140

accctgactg cagagatcat gacctatatc catactatgg attccaacat tctggaggac 1200

tggcaatttg gtctgacccc gccgccgtct gcctctctgc aggacaccta tcgttttgtt 1260

acctcccagg ctattacttg ccaaaaaacc gcaccgccga aagaaaaaga agatccactg 1320

aacaaatata ctttttggga ggttaacctg aaggaaaagt tttctgcaga tctggatcag 1380

tttccgctgg gtcgtaagtt tctgctgcaa tctggcctga aagcaaagcc gcgtctgaaa 1440

cgttctgccc cgactacccg tgcaccatcc accaaacgca aaaaggttaa aaaataa 1497

<210> 2

<211> 29

<212> DNA

<213> Artificial primer

<400> 2

ttggtctcta ggtatgtccg tgtggcgtc 29

<210> 3

<211> 31

<212> DNA

<213> Artificial primer

<400> 3

ccgctcgagt tattttttaa cctttttgcg t 31

Claims (8)

1. The gene HPV58L1 for coding soluble human papilloma virus 58 subtype L1 protein has the DNA sequence shown in SEQ ID NO. 1.

2. A vector plasmid pUC-58L1 comprising vector plasmid pUC57 and the gene HPV58L1 of claim 1 loaded therein.

3. A recombinant plasmid pESUMO-58L1, comprising a vector plasmid pE-SUMO and the HPV58L1 gene of claim 1 loaded therein.

4. A recombinant plasmid for expressing soluble HPV58L1 protein, which contains the gene HPV58L1 of claim 1.

5. The method for constructing the recombinant plasmid expressing the soluble HPV58L1 protein according to claim 4, comprising the following steps:

(1) Designing an amplification primer based on the gene HPV58L1 of claim 1, and a forward primer thereof comprisesBsa IRestriction enzyme site, reverse primer including flanking stop codonXho IA restriction enzyme site;

(2) PCR amplifying gene HPV58L1 by using the amplification primer;

(3) Respectively carrying out restriction endonuclease on pESUMO plasmid and obtained PCR amplification productBsa IAnd withXhoI double digestion, recovery of empty vector plasmid pE-SUMO and HPV58L1 gene doubleEnzyme digestion products are connected overnight at 16 ℃ by T4 DNA ligase to obtain recombinant plasmids;

(4) The recombinant plasmid pESUMO-58L1 obtained in the previous step is transformed into escherichia coli competent cells BL21 and coated on Amp ⁺ Culturing on LB solid culture medium, selecting single colony to carry out bacteria liquid PCR identification, screening positive colony, extracting positive colony plasmid, and obtaining recombinant plasmid expressing soluble HPV58L1 protein with correct sequencing result.

6. The method for constructing a recombinant plasmid according to claim 5, wherein the sequences of the amplification primers are as follows:

F-58：5’- TT GGTCTC TAGGTATGTCCGTGTGGCGTC-3', enzyme cutting site:Bas I；

R-58：5’- CCG CTCGAG TTATTTTTTAACCTTTTTTTTGCGT-3', cleavage site:Xho I。

7. a preparation method of soluble HPV58L1 protein comprises the following steps:

(1) Inoculating the recombinant plasmid pESUMO-58L1 of claim 3 to Amp ⁺ Culturing in LB liquid culture medium to OD ₄₅₀ When the value reaches 0.75-0.85, inducing expression by an inducer IPTG;

(2) After induction expression is finished, centrifugally collecting thalli, washing, crushing, centrifugally separating and collecting supernate;

(3) And eluting and purifying the supernatant through a Ni affinity chromatography column to obtain the SUMO-58L1 protein.

8. The use of the gene HPV58L1 as claimed in claim 1, the vector plasmid pUC-58L1 as claimed in claim 2, the recombinant plasmid pESUMO-58L1 as claimed in claim 3 or the soluble HPV58L1 protein as claimed in claim 7 in the preparation of vaccine.

Images