CN103665166A

CN103665166A - Dog fusion interferon

Info

Publication number: CN103665166A
Application number: CN201210319688.0A
Authority: CN
Inventors: 郭村勇
Original assignee: Schweitzer Co Ltd
Current assignee: Schweitzer Biotech Co Ltd; Schweitzer Co Ltd
Priority date: 2012-09-03
Filing date: 2012-09-03
Publication date: 2014-03-26
Also published as: TW201410707A

Abstract

The invention relates to a dog fusion interferon which comprises a dog interferon and a dog immunoglobulin Fc fragment, wherein the dog interferon and the dog immunoglobulin Fc fragment are further connected through a connexon. The invention also relates to a polynucleotide for encoding the dog fusion interferon and application of the dog fusion interferon.

Description

Dog fused interferon

Technical field

The present invention is about animal health field, particularly about a kind of dog fused interferon with antiviral activity.

Background technology

Interferon, rabbit is to find in British scholar Alick Isaacs and Jean Lindenmann are carrying out influenza virus test in nineteen fifty-seven the earliest, when cell suffers after virus infection, can manufacture immediately a kind of cytohormone, bring out adjacent cells and produce antiviral protein, the copying of viral interference.This cytohormone is named as Interferon, rabbit (Interferon, IFN) subsequently.

Interferon, rabbit is a kind of glucoprotein, mainly contains tri-kinds of interferon alphas, β, γ, can bring out generation via different cause of diseases, such as: virus, bacterium, rickettsia, protozoon and bifilar Nucleotide etc.; Interferon, rabbit after bringing out not can with cause of disease direct effect, but produce antiviral protein to reach antiviral function via induction, these antiviral proteins comprise albumen activating enzyme (the dsRNA-dependent protein kinase that relies on AMPLIGEN, PKR), Mx albumen (Mx protein) and 2 ', 5 '-oligoadenylate synthetase (2 ', 5 ' Oligoadenylate synthetase/RNase L, OAS) etc.Wherein PKR is a kind of protein kinase, can make eIF2 phosphorylation, makes host cell stop translating viral protein; Mx albumen is a kind of GTP (guanosine triphosphate) acid hydrolysis enzyme (GTPase), can be combined with viral protein and the copying and the transportation of protein of viral interference; OAS can be hydrolyzed viral AMPLIGEN.On the other hand, Interferon, rabbit also can induce adjacent cells to produce other cells of antiviral protein obstruction virus infection, and allows cell set up antiviral state, reaches the effectiveness that viral interference infects.Except having antivirus action, that Interferon, rabbit also has is antitumor, promote the functions such as cytodifferentiation and immunomodulatory.

Current interferon formulation on the market, mostly be the development and Design for mankind institute, such as: be used for treating the Interferon, rabbit on the tumor diseases such as the virus diseases such as mankind's Type B and C type hepatitis and Ka Boxishi knurl (Kaposi ' s sarcoma, KS), melanochrome tumour (malignant melanoma).

In recent years, be subject to aging, the social trend of few sonization affects, pet quantity is more and more, also the development of the many pet relevant industries of related drive, the most general pet-dog wherein, also on human work, play an important role gradually, according to American Pets commodity, manufacturing association (APPMA) investigation shows, the output value of American Pets relevant industries has reached 52,000,000,000 dollars in 2009, wherein Medical pet accounts for 40% (approximately 20,800,000,000 dollars), pet medicine accounts for 24% (approximately 124.8 hundred million dollars), and in pet medicine, antibiotic formulations and skin are looked after articles for use and are accounted for 70%, all the other 30% is vaccine and curative drug, wherein still price is high less for curative drug kind, a market that has development potentiality.The present invention be for dog, only develop special use Interferon, rabbit as curative drug.

Summary of the invention

The present invention provides a kind of dog fused interferon in first part.Because Interferon, rabbit belongs to small protein, transformation period short (approximately 2～8 hours) and unstable in vivo, therefore dog fused interferon provided by the present invention is by longer dog immunoglobulin IgG Fc segment composition of dog interferon albumen and transformation period, and the more stable dog fused interferon of formation.In a preferred embodiment, this dog interferon albumen and this dog immunoglobulin IgG Fc fragment are that the connexon (linker) to be comprised of glycine (Glycine, G) and silk amino acid (Serine, S) is coupled together.In an embodiment, this dog interferon albumen is dog interferon alpha 2, has the Amino acid sequence as shown in SEQ ID No:2; This dog immunoglobulin IgG Fc fragment has the Amino acid sequence as shown in SEQ ID No:4; And this connexon has the Amino acid sequence as shown in SEQ ID No:6; This dog fused interferon has the Amino acid sequence as shown in SEQ ID No:8.

The present invention provides a kind of polynucleotide of the above-mentioned dog fused interferon of encoding in second section.Dog fused interferon provided by the present invention is to obtain by gene turns plantation technology.First by the DNA sequence dna of encoding canine interferon protein, and the choosing of the DNA sequence dna of encoding canine immunoglobulin IgG Fc fragment is grown in display carriers system, the plastid of the DNA sequence dna that formation contains encoding canine fused interferon, again this plastid is turned and grown in representation system, after induced protein performance, obtain dog fused interferon.

In a preferred embodiment, except the DNA sequence dna choosing of the DNA sequence dna of encoding canine interferon protein and encoding canine immunoglobulin IgG Fc fragment is grown in display carriers system, and the DNA sequence dna choosing of the connexon (linker) of coding glycine and silk amino acid composition is grown in this display carriers system, to connect the DNA sequence dna of this encoding canine interferon protein and the DNA sequence dna of encoding canine immunoglobulin IgG Fc fragment.In an embodiment, the DNA sequence dna of this encoding canine interferon protein has the sequence as shown in SEQ ID No:1, the DNA sequence dna of this encoding canine immunoglobulin IgG Fc fragment has the sequence as shown in SEQ ID No:3, and the DNA sequence dna of the connexon (linker) that this coding glycine and silk amino acid form has the sequence as shown in SEQ ID No:5; The DNA sequence dna of this encoding canine fused interferon has the sequence as shown in SEQ ID No:7.

This display carriers can be prokaryotic organism display carriers or eukaryote display carriers.This prokaryotic organism display carriers is including but not limited to pET series acts carrier and pGEX series acts carrier.This eukaryote display carriers is including but not limited to pcDNA series acts carrier.

This representation system can be prokaryotic organism representation system (as: bacterium) or eukaryote representation system (as: yeast, insect cell, vegetable cell and mammalian cell etc.).In an embodiment, this representation system is intestinal bacteria (Escherichia coli).In another embodiment, this representation system is mammalian cell.Can be used for the mammalian cell of dog fused interferon performance of the present invention including but not limited to 3T3 cell, Chinese hamster ovary cell (Chinese hamster ovary cells, CHO cells), young hamster kidney cell (baby hamster kidney cells, BHK cells), human cervical cancer cell (HeLa cells), and human liver cancer cell (HepG2cells) etc.

The present invention provides the purposes of a kind of dog fused interferon in preparation dog antiviral in third part.Through evidence, dog fused interferon provided by the present invention has inducing cell and produces antiviral protein, to reach antiviral effect.In an embodiment, dog fused interferon (CIFN α 2-IgG Fc) induction dog kidney cell (MDCK) with the present invention produces antiviral protein, and with west ink dot method and real-time and quantification PCR (real-time RT-PCR), analyze respectively the performance amount of antiviral protein and gene thereof, result shows, the present invention's dog fused interferon (CIFN α 2-IgG Fc) can produce antiviral protein Mx albumen by induction MDCK cell, and induction MDCK cell increases the gene performance amount of antiviral protein Mx albumen, PKR albumen, OAS albumen.Therefore the generation that, dog fused interferon provided by the present invention can inducing anti-disease toxalbumin is also used for preparing dog antiviral.

Term " prevention, protection, antagonism " means, and compared to the animal or the cell sample that do not use dog fused interferon of the present invention, uses animal or the cell sample of dog fused interferon of the present invention, have higher survival rate, and the viral load in this sample is lower.

Term " treatment " means, prevention or partial prophylaxis disease, symptom, the patient's condition, and/or the disadvantageous effect of partially or completely curing or alleviating disease, symptom, the patient's condition or cause because of disease.

Term " inhibition " means, and compares, in quality or quantitative minimizing with baseline.For example, in the context of the present invention, suppress copying of virus, refer to baseline and compare, virus replication reduces.In like manner, suppress virus infection, refer to baseline and compare, reduce virus infection.

All technical and scientific terminology described in this specification sheets, unless definition to some extent is in addition all this affiliated field and has the meaning that common skill person can understand jointly.

The present invention is demonstrated and is illustrated with the following examples, but the present invention is not limited by following embodiment.

Accompanying drawing explanation

Fig. 1: be the dog fused interferon that intestinal bacteria were showed (CIFN α 2-IgG Fc) with pET24a-CIFN α 2-IgG Fc plastid with west ink dot method analysis; M: protein molecular weight standard (Protein Marker); The 1st road: with mouse anti 6x His antibody analysis; The 2nd road: with rabbit anti canine IFN antibody analysis; The 3rd road: with rabbit anti canine IgG antibody analysis; The 4th road: with mouse anti canine IFN antibody analysis.

Fig. 2 A: for the transfection of pcDNA3 carrier is to Chinese hamster ovary celI, with after Zeocin antibiotic-screening with the result of IFA analysis; Fig. 2 B: for the plastid transfection with encoding canine fused interferon gene (CIFN α 2-IgG Fc) is to Chinese hamster ovary celI, with after Zeocin antibiotic-screening with the result of IFA analysis.

Fig. 3: be the dog fused interferon that Chinese hamster ovary celI was showed (CIFN α 2-IgG Fc) with pcDNA3-CIFN α 2-IgG Fc plastid with west ink dot method analysis; M: protein molecular weight standard (Protein Marker); The 1st road: with mouse anti canine IFN antibody analysis; The 2nd road: with rabbit anti canine IFN antibody analysis; The 3rd road: with rabbit anti canine IgG antibody analysis; The 4th road: with mouse anti 6x His antibody analysis.

Fig. 4: by analyzing with west ink dot method the antiviral protein that dog fused interferon (CIFN α 2-IgG Fc) is induced; A is with rabbit anti Mx protein antibody detecting antiviral protein Mx albumen; B is α tubulin (α-tubulin) (internal reference group); The 1st road: untreated mdck cell (negative control group); The 2nd road: the mdck cell of processing with interferon inducers polyI:C; The 3rd road: the mdck cell of processing with dog fused interferon (CIFN α 2-IgG Fc).

Fig. 5: for analyze the gene performance amount of dog fused interferon (CIFN α 2-IgG Fc) induction MDCK cell performance antiviral protein Mx albumen with real-time and quantification PCR (real-time PCR).

Fig. 6: for analyze the gene performance amount of dog fused interferon (CIFN α 2-IgG Fc) induction MDCK cell performance antiviral protein PKR albumen with real-time and quantification PCR (real-time PCR).

Fig. 7: for analyze the gene performance amount of dog fused interferon (CIFN α 2-IgG Fc) induction MDCK cell performance antiviral protein OAS albumen with real-time and quantification PCR (real-time PCR).

Embodiment

Embodiment mono-dog interferon alpha 2 genes (CIFN α 2) choosing is grown and the constructing of display carriers

Get 4x10 ⁵individual dog kidney cell (Madin-Darby Canine Kidney, MDCK) be inoculated in 6 porocyte culture plates, cultivate transfection interferon inducers-Poly I:C (polyinosinic:polycytidylic acid after 24 hours, polyI:C) 2 μ g/well, then every 24 hours collecting cells once, and extract total RNA (total RNA) with guanidinium isothiocyanate (guanidine thiocyanate, GTC) method.Then total RNA of extraction is carried out to reverse transcription polymerase chain reaction (reverse polymerase chain reaction, RT-PCR), after first total RNA of 20 μ l extractions being acted on to 3 minutes with 70 ℃, get the total RNA of 15 μ l, 1 μ l forward introduction, the reverse introduction of 1 μ l and 3 μ l distilled water and AMV reverse transcription reagent (AMV RT Kit), adding up to cumulative volume is 20 μ l, after mixing, put into PCR reactor (Applied Biosystems GeneAmp PCRsystem 2400), reaction conditions synthesizes for first within 30 seconds, carrying out cDNA with 42 ℃, then carry out PCR reaction propagation dog interferon alpha 2 gene fragments, with 93 ℃ 30 seconds, 53 ℃ 30 seconds, 72 ℃ are carried out 35 circulations for 1 minute, finally with 72 ℃, within 5 minutes, complete PCR reaction.Wherein, the specificity introduction sequence of dog interferon alpha 2 genes (CIFN α 2) is as follows:

Forward introduction (CIFN α 2/F1):

5’-CG GAATTCATGGCCCTGCCCTGCTCC-3’(SEQID?NO：9)

EcoRI

Reverse introduction (CIFN α 2/R1):

5’-CCG

TTTCCTCCTCCTGAT-3’(SEQ?ID?NO：10)。

XhoI

By PCR reaction product with agar gel electrophoresis (agarose electrophoresis) analysis confirmation product clip size, then with nucleic acid extraction kit (Gel/PCR DNA Fragments Extraction kit, Geneaid company, Taiwan) carry out PCR product purification.Then with support agent box (yT & A Cloning Vector Kit, Yeastern Biotech company, Taiwan) DNA fragmentation of RT-PCR product is grown in choosing, get respectively 8 μ l PCR products, 3 μ l distilled water, 2 μ l yT & A cloning vector, 1 μ l T4 ligase buffer, 1 μ lT4ligase, mix and be placed on 14 ℃ of water baths and carry out conjugation (ligation) 12 hours, turn again shape (transformation) to host e. coli (E.coli), after incubated overnight, pick out the intestinal bacteria with CIFN α 2/yT & A plastid, and carry out sequencing and confirm that the PCR product sequence of propagation is dog interferon alpha 2 genes (CIFN α 2) really, dog interferon alpha 2 gene orders are as shown in SEQ ID No:1, its Amino acid sequence is as shown in SEQ ID No:2.

Then with rapid plasmid extraction agent box (High-Speed Plasmid Mini Kit, Geneaid company, Taiwan) in the above-mentioned intestinal bacteria with CIFN α 2/yT & A plastid, carry out extraction and the purifying of CIFN α 2/yT & A plastid.Again by above-mentioned CIFN α 2/yT & A plastid, display carriers pET24a and display carriers pcDNA3 carry out endonuclease reaction with limiting enzyme EcoRI and XhoI respectively, and with nucleic acid extraction kit (Geneaid company, Taiwan) dog interferon gene (CIFN α 2) and the display carriers of purifying enzyme after cutting, then engage reaction, dog interferon gene (CIFN α 2) is selected respectively to grow and in pET24a carrier and pcDNA3 carrier, form pET24a-CIFN α 2 plastids and pcDNA3-CIFN α 2 plastids, and pET24a-CIFN α 2 plastids and pcDNA3-CIFN α 2 plastids are turned respectively to shape to showing host e. coli (E.coli) and transfection (transfection) to Chinese hamster ovary cell strain (CHO cells), select with the intestinal bacteria of pET24a-CIFN α 2 plastids and with the Chinese hamster ovary cell strain (CHO cells) of pcDNA3-CIFN α 2 plastids.

Embodiment bis-dog immunoglobulin IgG Fc fragment gene choosings are grown

Get fresh dog spleen, and extract total RNA with GTC method.Then total RNA of extraction is carried out to reverse transcription polymerase chain reaction (RT-PCR), after first total RNA of 20 μ l extractions being acted on to 3 minutes with 70 ℃, get the total RNA of 15 μ l, 1 μ l forward introduction, the reverse introduction of 1 μ l and 3 μ l distilled water and AMV reverse transcription reagent (AMV RT Kit), adding up to cumulative volume is 20 μ l, after mixing, put into PCR reactor (Applied Biosystems GeneAmp PCR system 2400), reaction conditions synthesizes for first within 30 seconds, carrying out cDNA with 42 ℃, then carry out PCR reaction propagation dog immunoglobulin IgG Fc fragment gene, with 93 ℃ 30 seconds, 53 ℃ 30 seconds, 72 ℃ are carried out 35 circulations for 1 minute, finally with 72 ℃, within 5 minutes, complete PCR reaction.Wherein, the specificity introduction sequence of dog immunoglobulin IgG Fc fragment gene (Canine IgG Fc) is as follows:

Forward introduction (Canine IgG Fc/F1):

5’-CG GGATCCACTAAAGTAGACAAGCCAGTG-3’(SEQ?ID?NO：11)

BamHI

Reverse introduction (Canine IgG Fc/R1):

5’-CCG

CGTTTACCCGGAGAATGGGAGAG-3’(SEQID?NO：12)。

PCR reaction product, with agar gel electrophoresis analysis confirmation product clip size, is then carried out to PCR product purification with nucleic acid extraction kit (Geneaid company, Taiwan).Then with yT & A Cloning Vector Kit (Yeastern Biotech company, Taiwan) DNA fragmentation of RT-PCR product is grown in choosing, get respectively 8 μ lPCR products, 3 μ l distilled water, 2 μ l yT & A cloning vector, 1 μ lT4ligase buffer, 1 μ lT4ligase, mix and be placed on 14 ℃ of water baths and carry out conjugation 12 hours, make the transition again to host e. coli (E.coli), after incubated overnight, pick out the intestinal bacteria with Canine IgG Fc/yT & A plastid, and carry out sequencing and confirm that the PCR product sequence of propagation is dog immunoglobulin IgG Fc fragment gene (Canine IgG Fc) really, dog immunoglobulin IgG Fc fragment gene sequence is as shown in SEQ ID No:3, its Amino acid sequence is as shown in SEQ ID No:4.

Constructing of embodiment tri-dog fused interferons (CIFN α 2-IgG Fc) display carriers

In the present embodiment, by the dog immunoglobulin IgG Fc fragment gene (Canine IgG-Fc) (SEQID No:3) of dog interferon alpha 2 genes (CIFN α 2) (SEQ ID No:1) of embodiment mono-gained and embodiment bis-gained with glycine (Glycine, G) and silk amino acid (Serine, the DNA sequence dna (SEQ ID No:5) of the connexon (linker) S) forming connects, to construct the DNA sequence dna (SEQ ID No:7) of dog fused interferon (CIFN α-IgG Fc).

First, with PCR reaction difference amplification dog interferon alpha 2 genes (CIFN α 2) (SEQ ID No:1) and dog immunoglobulin IgG Fc fragment gene (Canine IgG-Fc) (SEQ ID No:3), and utilize the design of PCR introduction that DNA sequence dna (the SEQ ID No:5) segmentation of the connexon of glycine and silk amino acid composition is together carried out to PCR with dog interferon alpha 2 genes (CIFN α 2) and dog immunoglobulin IgG Fc fragment gene (Canine IgG-Fc) and react amplification.Wherein, the specificity introduction sequence of dog interferon alpha 2 genes (CIFN α 2) is as follows:

Forward introduction (CIFN α 2/F2):

5’-GG

ATGGCCCTGCCCTGCTCC-3’(SEQ?ID?NO：13)

KpnI

Reverse introduction (CIFN α 2-linker/R):

5’-CG GGATCCACCTGAGCCACCTTTCCTCCTCCTGATTCT-3’(SEQ?ID?NO：14)；

BamHI connexon partial sequence

And the specificity introduction sequence of dog immunoglobulin IgG Fc fragment gene is as follows:

Forward introduction (Linker-IgG/F):

5’-CG GGATCCGGTGGAGGCGGAAGCGGCGGTGGAGGATCACCCAAAAGAGAAAATGGA-3’

BamHI connexon partial sequence (SEQ ID NO:15)

Reverse introduction (IgG-Fc/R2):

5’-CCG CGTTTACCCGGAGAATGGGAGAG-3’(SEQ?ID?NO：16)。

XhoI

The plastid DNA (CIFN α 2/yT & A plastid or Canine IgG Fc/yT & A plastid) that adds 0.3ng in PCR reaction tubes, 5 μ l 10x PCR reaction solutions, 8 μ l1.25mM dNTP, 1 μ l50 μ M5 ' rectifies to introduction, 1 μ l 50 μ M3 ' hold reverse introduction, 33 μ l aqua sterilisas, 1 μ l Taq polysaccharase, after mixing, put into PCR reactor (Applied Biosystems GeneAmp PCR system 2400), reaction conditions be first with 94 ℃ 5 minutes by DNA sex change, then with 94 ℃ 30 seconds, 57 ℃ 30 seconds, 72 ℃ are carried out 30 circulations for 30 seconds, finally with 72 ℃, within 5 minutes, complete PCR reaction.

PCR reaction product, with agar gel electrophoresis analysis confirmation product clip size, is then carried out to PCR product purification with nucleic acid extraction kit (Geneaid company, Taiwan).Again PCR product dog interferon alpha 2 genes (CIFN α 2) after purifying are carried out to endonuclease reaction with restriction enzyme KpnI and BamHI, PCR product dog immunoglobulin IgG Fc fragment gene (Canine IgG-Fc) after purifying is carried out to endonuclease reaction with restriction enzyme BamHI and XhoI, and display carriers pcDNA3 is carried out after endonuclease reaction with restriction enzyme KpnI and XhoI, again with nucleic acid extraction kit (Geneaid company, Taiwan) PCR product and the display carriers of purifying enzyme after cutting, then engage reaction, PCR product choosing is grown and in pcDNA3 carrier, formed pcDNA3-CIFN α 2-IgG Fc plastid, and by the transfection of pcDNA3-CIFN α 2-IgG Fc plastid to Chinese hamster ovary cell strain (CHO cells), select the Chinese hamster ovary cell strain (CHO cells) with pcDNA3-CIFN α 2-IgG Fc plastid, and carry out sequencing and confirm that the PCR product sequence of propagation is the DNA sequence dna (SEQ ID No:7) of the present embodiment dog fused interferon (CIFN α 2-IgG Fc) really, and the Amino acid sequence of the present embodiment dog fused interferon (CIFN α 2-IgG Fc) is as shown in SEQ ID No:8.

In addition, the template that the pcDNA3-CIFN α 2-IgG Fc plastid of take is PCR reaction, and with following introduction, the present embodiment dog fused interferon (CIFN α 2-IgG Fc) DNA sequence dna is bred:

Forward introduction (CIFN α 2/F1):

5’-CG GAATTCATGGCCCTGCCCTGCTCC-3’(SEQID?NO：9)

EcoRI

Reverse introduction (CIFN α 2-IgG/R):

5’-CCG

TTTACCCGGAGAATGGG-3’(SEQ?ID?NO：17)。

XhoI

PCR reaction conditions be first with 94 ℃ 5 minutes by DNA sex change, then with 94 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃, within 30 seconds, carry out 30 circulations, finally with 72 ℃, within 5 minutes, complete PCR reaction.

Then by PCR reaction product with agar gel electrophoresis analysis confirmation product clip size, then with nucleic acid extraction kit (Geneaid company, Taiwan), carry out PCR product purification.Again the PCR product dog fused interferon after purifying (CIFN α 2-IgG Fc) is carried out to endonuclease reaction with display carriers pET24a with limiting enzyme EcoRI and XhoI, again with nucleic acid extraction kit (Geneaid company, Taiwan) PCR product and the display carriers of purifying enzyme after cutting, then engage reaction, PCR product choosing is grown and in pET24a carrier, formed pET24a-CIFN α 2-IgG Fc plastid, and pET24a-CIFN α 2-IgG Fc plastid is turned to shape to showing in host e. coli BL21, select the e. coli bl21 with pET24a-CIFN α 2-IgG Fc plastid, and carry out sequencing and confirm that the PCR product sequence of propagation is the DNA sequence dna (SEQID No:7) of the present embodiment dog fused interferon (CIFN α 2-IgG Fc) really.

The performance of embodiment tetra-dog fused interferons (CIFN α-IgG Fc) in prokaryotic organism

The resulting pET24a-CIFN α-IgG of embodiment tri-Fc plastid is turned to shape to showing host e. coli BL21.First get the competent cell of 200 μ l and add the resulting pET24a-CIFN α-IgG of 5 μ l embodiment tri-Fc plastid, be placed on ice after 30 minutes, put into immediately again 42 ℃ of water baths and within 1 minute 30 seconds, carry out heat-shocked (heat shock), then put into frozen water, after standing 5 minutes, add 800 μ l LB nutrient solutions, 37 ℃ of water-baths are cultivated 1 hour again.With room temperature 3000xg centrifugal 5 minutes again, remove 600 μ l supernatant liquors, the remaining LB of Bing Jiang lower floor and bacterium piece break up, getting 200 μ l bacterium liquid adds on the LB solid medium that contains 30 μ g/ml kantlex (kanamycin) or 50 μ g/ml penbritins (ampicillin) and smears, after 37 ℃ of incubated overnight, select that single bacterium colony is cultivated and sequencing to confirm to turn shape errorless.

Performance host e. coli BL21 with the resulting pET24a-CIFN α-IgG of embodiment tri-Fc plastid is seeded to the LB culture medium culturing after 12 hours that contains 30 μ g/ml kantlex (kanamycin), the bacterium liquid of getting 1% volume is seeded to the LB nutrient solution cultivation that 250ml contains 30 μ g/ml kantlex (kanamycin), is cultured to bacterial concentration and reaches OD at 37 ℃ _600nmit is 0.6～0.8 o'clock, add 1mM sec.-propyl-β-D-thio-galactose pyran-glucoside (Isopropyl-beta-D-thiogalactopyranoside, IPTG) induction, respectively at

induction

4, 6, within 8 hours, collect bacterium fluid samples, after 8 hours with 13000xg, 4 ℃, centrifugal 10 minutes, remove supernatant liquor, by bacterium piece with 12.5% or 10% sodium laurylsulfonate-polyacrylamide gel electrophoretic analysis (sodium dodecyl sulfate-polyacrylamide gel electrophoresis, SDS-PAGE), and detect with west ink dot method the situation that dog fused interferon (CIFN α 2-IgG Fc) albumen shows.

Albumen on colloid after above-mentioned SDS-PAGE is analyzed is transferred on pvdf membrane, and the pvdf membrane after transfer printing is placed in to sealing damping fluid (blocking buffer, 5%Skim milk is dissolved in TBST) in, under room temperature, act on 1 hour, to remove nonspecific reaction, again with TBST (10mM Tris-HCl pH 8.0, 150mM NaCl, 0.3%Tween 20) clean three times, each 5 minutes, add respectively subsequently mouse-anti 6xHis (mouse anti 6xHis) monoclonal antibody (Invitrogen company, the U.S.), the anti-dog interferon of rabbit (rabbit anti-canine IFN) polyclonal antibody, the anti-dog IgG of rabbit (rabbit anti-canine IgG) polyclonal antibody and mouse-anti dog interferon (mouse anti-canine IFN) polyclonal antibody are as primary antibody detecting dog fused interferon, after adding antibody, under room temperature, act on after 1 hour, with TBST, clean six times, each 5 minutes, add again the mountain sheep anti mouse of mark alkaline phosphatase (AP) (goat anti mouse) antibody (Sigma company, the U.S.) or the goat antirabbit of mark alkaline phosphatase (AP) (goat anti rabbit) antibody (Sigma company, the U.S.), as secondary antibodies, this antibody dilutes 2000 times with the TBST that contains 0.5%skin milk in advance, after the effect of jiggling under room temperature 1 hour, with TBST, clean 6 times, each 5 minutes, adding AP is subject to matter NBT/BCIP (Bio-Rad) colour generation after about 1-2 minute again, outwelling developer rinses and stops color reaction with clear water.

West ink dot method analytical results as shown in Figure 1, intestinal bacteria bacterium piece with dog fused interferon gene can be by mouse-anti 6xHis (mouse anti 6xHis) monoclonal antibody, the anti-dog interferon of rabbit (rabbit anti-canine IFN) polyclonal antibody, the anti-dog IgG of rabbit (rabbit anti-canine IgG) polyclonal antibody and the identification of mouse-anti dog interferon (mouse anti-canine IFN) polyclonal antibody, show that these intestinal bacteria contain dog fused interferon, and the protein molecular weight of the dog fused interferon of the present embodiment is about 51KDa, consistent with west ink dot method analytical results.

The performance of embodiment five dog fused interferons (CIFN α 2-IgG Fc) in eukaryote

By the transfection of the resulting pcDNA3-CIFN α of embodiment tri-2-IgG Fc plastid to Chinese hamster ovary cell strain (CHO cells).Get 3 μ g pcDNA3-CIFN α 2-IgG Fc plastid DNAs and add 15 seconds (mixed liquor A) of concussion in the VP substratum (Invitrogen) of antibiotic-free and serum-free; In addition 6 μ g Lipofectamine reagent (Invitrogen) are added in the VP substratum of antibiotic-free and serum-free (mixed liquid B), under room temperature, act on 5 minutes; Then mixed liquor A is added in mixed liquid B, shake and under room temperature, act on 30 minutes after 15 seconds.Again above-mentioned mixed solution (A+B) is evenly added in the Chinese hamster ovary celI through cultivation overnight, cell is placed in to 37 ℃, 5%CO ₂in incubator, effect, after 6 hours, is removed mixed solution and adds the F12 substratum that contains 10% foetal calf serum (FBS), and cell is placed in to 37 ℃, 5%CO ₂in incubator, continue to cultivate 48 hours.

Then, the Chinese hamster ovary celI with dog fused interferon gene with bleomycin (Zeocin) screening.By through the Chinese hamster ovary celI strain succeeding transfer culture of transfection in 24 porocyte culture plates, with the F12 culture medium culturing that contains 10%FBS, 100Units/ml mycillin (Penicillin), 100Units/ml Streptomycin sulphate (Streptomycin) and 700 μ g/ml bleomycins (Zeocin) to screen.Then after cell being cleaned to twice with phosphate buffered saline buffer (PBS), add 0.125% trypsin Trypsin) digest, after cell sphering, rock angle bottle and make cell detachment, with substratum, cell is broken up to suspension, cell cultures is in 37 ℃, 5%CO ₂incubator, after twice of subculture, wait the cell living approximately surplus during to twenty percent, cell culture medium is replaced to the F12 substratum that contains 50 μ g/ml bleomycins (Zeocin) and 10%FBS, after the original speed of growth of cellular-restoring, with indirect IF staining (Indirect Immunofluorescence Assay, IFA) method and west ink dot method, confirm that cell is whether with dog fused interferon (CIFN-IgG Fc) gene and show this recombinant protein.

1. with indirect IF staining (IFA) method, detect the performance that pig is merged recombinant type Interferon, rabbit

The Chinese hamster ovary celI of transfection is seeded in 24 porocyte culture plates to (2 * 10 ⁵cells/well) with containing the F12 culture medium culturing of 10%FBS after 2 days, after cleaning three times with PBS, add 80% acetone (20 ℃), and within standing 30 minutes at 4 ℃, carry out cell and fix, with PBS, clean after three times again, add the rabbitanti canine IgG antibody (300 μ l/well) with 5000 times of PBS dilutions, be placed in 37 ℃ of incubator lucifuges effect 30 minutes, with PBS, clean after three times again, every hole adds 300 μ l with the goat anti rabbit-FITC antibody of 2000 times of PBS dilutions, be placed in the effect of 37 ℃ of incubator lucifuges after 30 minutes, with fluorescence microscope.

Fluorescence microscope result as shown in Figure 2.After bleomycin (Zeocin) screening, the Chinese hamster ovary celI of survival, with dog fused interferon gene, can be observed fluorescence signal (as shown in Figure 2 B) with the analysis of indirect IF staining (IFA) method; The Chinese hamster ovary celI of transfection pcDNA3-CIFN α 2 carriers does not have fluorescence signal (as shown in Figure 2 A).

2. with west ink dot method, detect the performance that pig is merged recombinant type Interferon, rabbit

The testing sequence of west ink dot method is as described in embodiment tetra-, whether the Chinese hamster ovary celI secretory product of detecting transfection with mouse-anti 6xHis (mouse anti 6xHis) monoclonal antibody (Invitrogen company, the U.S.), the anti-dog interferon of rabbit (rabbit anti-canine IFN) polyclonal antibody, the anti-dog IgG of rabbit (rabbit anti-canine IgG) polyclonal antibody and mouse-anti dog interferon (mouse anti-canine IFN) polyclonal antibody as primary antibody respectively contains dog fused interferon (CIFN α 2-IgG Fc); And with the mountain sheep anti mouse of mark alkaline phosphatase (AP) (goat anti mouse) antibody (Sigma company, the U.S.) or the goat antirabbit of mark alkaline phosphatase (AP) (goat anti rabbit) antibody (Sigma company, the U.S.), as secondary antibodies colour generation; Result as shown in Figure 3, Chinese hamster ovary celI secretory product with dog fused interferon gene can be by mouse-anti 6xHi s (mouse anti 6xHis) monoclonal antibody, the anti-dog interferon of rabbit (rabbit anti-canine IFN) polyclonal antibody, the anti-dog IgG of rabbit (rabbit anti-canine IgG) polyclonal antibody and the identification of mouse-anti dog interferon (mouse anti-canine IFN) polyclonal antibody, show that this Chinese hamster ovary celI contains dog fused interferon, and the protein molecular weight of the dog fused interferon of the present embodiment is about 51KDa, consistent with west ink dot method analytical results.

Embodiment six dog fused interferons (CIFN α 2-IgG Fc) inducing cell produces the activation analysis of antiviral protein

1. with dog interferon (CIFN α 2), dog fused interferon (CIFN α 2-IgG Fc) and interferon inducers (polyI:C) induction dog kidney cell (MDCK), produce antiviral protein

First dog kidney cell (MDCK) is planted to (4x10 in 6 porocyte culture plates ⁵cells/well), in 37 ℃, 5%CO ₂under condition, cultivate 24 hours, remove after supernatant nutrient solution, with PBS, clean three times, according to different groups, add respectively 100 μ g dog interferon alphas 2 (Canine IFN α 2), 100 μ g dog fused interferons (CIFN α 2-IgG Fc) and pre-mixed 2.5 μ g polyI:C and lipofectamine 2000 mixed solutions, in 37 ℃, 5%CO ₂under condition, cultivate 1 hour, then mend 0.5%DMEM nutrient solution to 3ml, be then placed in 37 ℃, 5%CO ₂incubator in cultivate, after 24 hours, collect respectively mdck cell gross protein and cell total rna is analyzed (3 repetitions are carried out in each processing).

2. the extraction of dog kidney cell (MDCK) gross protein

The above-mentioned mdck cell of respectively organizing is cleaned three times with PBS, add cell lysis buffer solution (cell lysis buffer, 100 μ l/ holes), and cell cultures dish is placed under room temperature, with vibrator (shaker), with 120rpm, evenly rock, while rocking, every 3-5 minute, with have gentle hands, clap cell cultures dish and make cell detachment, collecting cell agglomerate and solution, at 4 ℃ with 14000xg centrifugal 20 minutes, centrifugal rear supernatant liquor (tenuigenin in albumen) and the lower confluent monolayer cells fragment got respectively, be placed in respectively-20 ℃ standby.And carry out the quantitative of the interior total protein of tenuigenin with Protein Assay test kit (Bio-Rad company).

3. the extraction of the total RNA of dog kidney cell (MDCK)

With the total RNA of nucleic acid extraction kit (Nucleic Acid Extraction Kit I, FAVORGEN company) extraction mdck cell.First add 570 μ lVNE buffer cell mass is broken up and be placed in room temperature effect 10 minutes, add again 570 μ l99.9% ethanol, with vibrator (vortex), evenly mix, then the complete liquid of room temperature effect is added in VNE column, with 8000xg centrifugal 1 minute, remove the liquid in sleeve pipe, add 400 μ lW1 buffer, with 8000xg centrifugal 1 minute, remove sleeve pipe liquid, add 600 μ l Wash buffer, with 8000xg centrifugal 1 minute, remove sleeve pipe liquid, again add 600 μ l Wash buffer, with 8000xg centrifugal 1 minute, remove after sleeve pipe liquid again with 13000xg centrifugal 3 minutes, remove sleeve pipe liquid, and add 50 μ lRNase free water back dissolving RNA, and with 13000xg after centrifugal 3 minutes, RNA is placed in-20 ℃ standby.

4. with west ink dot method, analyze the performance of antiviral protein

The testing sequence of west ink dot method is as described in embodiment tetra-; With 0.05%TBST, dilute respectively the anti-Mx albumen of rabbit (rabbit anti Mx1) antibody (the GeneTex company of 500 times, the U.S.) as one-level antibody, and to be marked with goat antirabbit (goat anti rabbit-HRP) antibody (with 0.05%TBST configuration) (the KPL company of horseradish peroxidase (HRP), the U.S.) as secondary antibody, detect respectively in the mdck cell of processing with dog fused interferon (CIFN α 2-IgG Fc) and the interferon inducers (polyI:C) of Chinese hamster ovary celI performance, whether contain antiviral protein Mx albumen.

Result as shown in Figure 4, in the dog fused interferon (CIFN α 2-IgG Fc) showing with Chinese hamster ovary celI and the mdck cell of processing with interferon inducers (polyI:C), all contain Mx albumen, and in the mdck cell of untreated fish group, there is no the generation of Mx albumen, show the generation (as shown in Figure 4 A) that mdck cell can inducing anti-disease toxalbumin-Mx albumen after the processing of dog fused interferon of the present invention.

5. with real-time and quantification PCR (real-time RT-PCR), analyze the gene performance amount of antiviral protein

With QuantiFast SYBR Green RT-PCR Handbook kit (QIAGEN company, Holland) the above-mentioned total RNA (20ng) extracting is carried out to real-time RT-PCR, to analyze the gene performance amount of antiviral protein (Mx albumen, PKR albumen, OAS albumen).First total RNA of above-mentioned extraction is diluted to 5ng/ μ l, then sequentially add 12.5 μ l 2x QuantiFast SYBR Green RT-PCR Master Mix, 1 μ l forward introduction, the reverse introduction of 1 μ l, QuantiFast RT Mix, template ribonucleic acid and RNase-free water, carry out real-time RT-PCR reaction; The specificity introduction sequence of each antiviral protein is as follows:

Mx albumen forward introduction (Mx real-time/F):

5’-ATGAGCCATGACGAGGTTTC-3’(SEQ?ID?NO：18)

The reverse introduction of Mx albumen (Mx real-time/R):

5’-TTCAGGAGCCAGCTGTAGGT-3’(SEQ?ID?NO：19)

PKR albumen forward introduction (PKR real-time/F):

5’-TGAGCAATGCCAGATACAGTG-3’(SEQ?ID?NO：20)

The reverse introduction of PKR albumen (PKR real-time/R):

5’-CCATATCCACCTGAGCCAAT-3’(SEQ?ID?NO：21)

OAS albumen forward introduction (OAS real-time/F):

5’-AGCTCGAGAAACGAGGACAG-3’(SEQ?ID?NO：22)

The reverse introduction of OAS albumen (OAS real-time/R):

5’-ACTTCAGGGTTGGGTCTGTG-3’(SEQ?ID?NO：23)

Separately with the performance amount of house-keeping gene (housekeeping gene) Actin muscle (actin) as a control group:

Actin albumen forward introduction (Actin real-time/F):

5’-GCGCAAGTACTCTGTGTGGAT-3’(SEQ?ID?NO：24)

The reverse introduction of Actin albumen (Actin real-time/R):

5’-GTCGTACTCCTGCTTGCTGAT-3’(SEQ?ID?NO：25)

Real-time RT-PCR reaction conditions is: 50 ℃ of reverse transcription reactions (Reverse transcription) 10 minutes, then carry out 95 ℃ of PCR initial steps 5 minutes, 95 ℃ of sex change (Denaturation) 10 seconds, bind/extend (annealing/extension) 60 ℃ 30 seconds, after totally 35 circulations, complete reaction, the experimental result following formula of substitution is calculated, and analyzes with Sigmastat software.Formula is as follows:

2 ^-ΔΔCt＝2 ^{-{(CT?gene?of?interest-CT?internal?control)-(CT?gene?of?interest-CT?internal?control)}}

The real-time RT-PCR result of each antiviral protein respectively as shown in Figures 5 to 7.

As shown in Figure 5, with 20ng intestinal bacteria, show respectively the dog interferon alpha 2 (CIFN α 2) of purifying, the dog fused interferon (CIFN α 2-IgGFc) of dog fused interferon (CIFN α 2-IgG Fc) and Chinese hamster ovary celI performance purifying was processed mdck cell after 24 hours, dog fused interferon (CIFN α 2-IgG Fc) the Mx protein gene performance amount that treatment group was induced with Chinese hamster ovary celI performance purifying is the highest, for 7.9 times of the Mx protein gene performance amount of dog interferon alpha 2 (the CIFN α 2) treatment group with intestinal bacteria performances purifying, and 41 times (p < 0.05) that are about the Mx protein gene performance amount of untreated fish group (negative control group).

As shown in Figure 6, with the dog fused interferon (CIFN α 2-IgGFc) of dog interferon alpha 2 (CIFN α 2), dog fused interferon (CIFN α 2-IgG Fc) and the Chinese hamster ovary celI performance purifying of 20ng intestinal bacteria performances purifying, process mdck cell after 24 hours respectively, the PKR protein gene performance amount being induced with dog interferon alpha 2 (the CIFN α 2) treatment group of intestinal bacteria performance purifying is the highest; And compared to the PKR protein gene performance amount of untreated fish group (negative control group), with the dog fused interferon (CIFN α 2-IgG Fc) of intestinal bacteria performance purifying, still have the gene performance (p < 0.05) of induction PKR albumen in the mdck cell that the dog fused interferon (CIFN α 2-IgG Fc) of Chinese hamster ovary celI performance purifying and interferon inducers polyI:C process.

As shown in Figure 7, with the dog fused interferon (CIFN α 2-IgGFc) of dog interferon alpha 2 (CIFN α 2), dog fused interferon (CIFN α 2-IgG Fc) and the Chinese hamster ovary celI performance purifying of 20ng intestinal bacteria performances purifying, process mdck cell after 24 hours respectively, the OAS protein gene performance amount being induced with dog fused interferon (the CIFN α 2-IgG Fc) treatment group of Chinese hamster ovary celI performance purifying is the highest; And compared to the OAS protein gene performance amount of untreated fish group (negative control group), in the mdck cell of processing with dog interferon alpha 2 (CIFN α 2), dog fused interferon (CIFN α 2-IgG Fc) and the interferon inducers polyI:C of intestinal bacteria performance purifying, still have the gene performance (p < 0.05) of induction OAS albumen.

From above-described embodiment, dog fused interferon provided by the present invention can induce canine cells to produce the performance of antiviral protein, and then reaches antiviral effect.

Above-listed detailed description illustrates for one of the present invention possible embodiments, and only this embodiment is not in order to limit the scope of the claims of the present invention, all do not depart from skill spirit of the present invention institute for it equivalence implement or change, all should be contained in the scope of the claims of this case.

Claims

1. a dog fused interferon, comprises a dog interferon and a dog immunoglobulin Fc segments.

2. dog fused interferon as claimed in claim 1, is characterized in that, this dog interferon and this dog immunoglobulin Fc segments are connected by a connexon.

3. dog fused interferon as claimed in claim 1 or 2, is characterized in that, this dog interferon has the sequence as shown in SEQ ID No:2.

4. dog fused interferon as claimed in claim 1 or 2, is characterized in that, this dog immunoglobulin Fc segments has the sequence as shown in SEQ ID No:4.

5. dog fused interferon as claimed in claim 2, is characterized in that, this connexon has the sequence as shown in SEQ ID No:6.

6. dog fused interferon as claimed in claim 2, is characterized in that, this dog fused interferon has the sequence as shown in SEQ ID No:8.

7. the polynucleotide of coding dog fused interferon as claimed in claim 1.

As claimed in claim 7 more than Nucleotide, it is characterized in that, these polynucleotide have the sequence as shown in SEQ ID No:7.

9. a dog fused interferon as claimed in claim 1 purposes in preparation dog antiviral.