CN110343650B

CN110343650B - Recombinant streptomyces tuberculatus for producing amphotericin B and application thereof

Info

Publication number: CN110343650B
Application number: CN201910451258.6A
Authority: CN
Inventors: 柳志强; 郑裕国; 张博; 黄恺; 姜圣贤; 张雨函; 陈燏
Original assignee: Zhejiang University of Technology ZJUT
Current assignee: Zhejiang University of Technology ZJUT
Priority date: 2019-05-28
Filing date: 2019-05-28
Publication date: 2020-12-29
Anticipated expiration: 2039-05-28
Also published as: CN110343650A

Abstract

The invention discloses a recombinant Streptomyces tuberculatus for producing amphotericin B and application thereof, wherein the recombinant Streptomyces tuberculatus is obtained by knocking out competitive branches of amphotericin B in Streptomyces tuberculatus ZJB2016050(Streptomyces nodosus ZJB2016050) and then introducing functional gene tandem sequences shown in SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4 and SEQ ID No. 5; by introducing the functional gene, the supply of the amphotericin B skeleton synthetic precursor is comprehensively improved, the utilization rate of the strain on nutrient substances is improved, and the flow direction of the nutrient substances of a target product is changed. The yield of the AmB is improved by about 20% by knocking out a competition branch, the by-product amphotericin A is reduced by 40%, three precursors of acetyl coenzyme A, malonyl coenzyme A and methylmalonyl coenzyme A are improved by overexpression cascade functional gene verification, the yield of the amphotericin B is greatly improved, and finally the amphotericin B is fermented in a 5L fermentation tank, so that the yield of the amphotericin B can reach 16 g/L.

Description

Recombinant streptomyces tuberculatus for producing amphotericin B and application thereof

(I) technical field

The invention relates to recombinant streptomyces tuberculatus for producing amphotericin B and application thereof.

(II) background of the invention

Amphotericin B (AmB) is a polyene broad-spectrum antifungal antibiotic produced by Streptomyces nodosus (nodosus), and its strain was collected and isolated from soil samples of delta of orinoco family of venezuelan in 1955. It was the first drug to be marketed in 1966 for deep fungal infections, which has been used for nearly half a century. AmB molecular formula C₄₇H₇₃NO₁₇AmB belongs to the group of polyene macrolide antibiotics, has a broad spectrum of fungal resistance, particularly against life-threatening systemic fungal infections such as candida albicans, aspergillus, etc., and also has potent antiviral and antiparasitic properties such as raney virus, leishmania, etc., and currently marketed amphotericin B drugs include injections, tablets, etc. AmB is yellow or orange yellow powder, is tasteless and hygroscopic, and is easy to destroy and lose efficacy under sunlight. Can dissolve DMSO, and is substantially insoluble in water, anhydrous ethanol, chloroform or diethyl ether, and has a pH of less than 1mg/L (pH 6-7). The antifungal mechanism of AmB is: AmB can combine with ergosterol on fungal cell membrane to form micropores on the membrane, so that the permeability of the membrane is changed, and finally, the unregulated loss of important cell contents such as K ions, nucleotides, amino acids and the like is caused to cause cell death. However, AmB also interacts to a lesser extent with cholesterol on mammalian cell membranes, causing certain side effects, particularly nephrotoxicity. Although it has certain side effects, AmB is still the most important antibiotic currently used for the treatment of deep systemic fungal infections in humans. Research into new forms of AmB administration, such as Abelcet, Ambisome liposomal drugs, in the 90s of the 20 th century, has been intensified to increase the efficiency of drug access to the region of action in order to reduce toxicity. The fermentation direction and the research progress of the traditional mutagenesis are also provided, for example, Zhang Bo in 2017 and the like are used for mutagenizing wild streptomyces tubercle, the yield of amphotericin B is improved to 5.02g/L, the fermentation of mutagenic strains is optimized, and the industrialization of the amphotericin B with high yield is finally realized.

There are many ways of modifying microbial metabolism, and common methods include overexpression of functional genes, knockout of competitive branches, heterologous expression of synthetic gene clusters, and the like. The over-expression of functional genes is one of the main means in strain metabolic modification and has quick effect. The main genetic means of Streptomyces nodosus is conjugative transfer, and reference data show that the conjugation rate of the conjugative transfer of the Streptomyces nodosus is lower than that of the streptomyces model, wherein the success rate of integrative or temperature-sensitive plasmids such as pSET152, PKC1139 and the like is lower in operation and success rate. pJTU1278 as an expression plasmid is the only plasmid that is successfully transferred into the laboratory at present.

The amphotericin B backbone is composed mainly of 18 synthetic precursors and one starter unit, consisting of the polyketide synthase module amphA in combination with an acetyl-coa, followed by a stepwise build-up of 15 malonyl-coa and 3 methylmalonyl-coa. Where acetyl-CoA is derived primarily from the glycolytic pathway of glucose, malonyl-CoA is synthesized primarily from acetyl-CoA under the action of acetyl-CoA carboxylase, methylmalonyl-CoA is synthesized from two pathways, one from succinyl-CoA under the action of methylmalonyl isomerase and mutase and one from propionyl-CoA under the action of propionyl-CoA carboxylase. acetyl-CoA is a core substance of biological metabolism, and the metabolic branches in organisms are complex and are one of the main precursors of secondary metabolites.

Streptomyces is a natural treasure house called secondary metabolite of actinomycetes, and streptomyces often has a plurality of secondary metabolite synthesis gene clusters, some of which may be silent gene clusters, and can realize expression under specific stress. Another part may be in a different expression state, and there is also a competitive effect. Within S.nodularis there are 5 PKS type synthetic gene clusters, of which amphotericin B belongs to PKS type I. According to the prediction result of the anti SMASH and the data of the KEGG, the secondary metabolite of PKS5 is found to have a competitive effect on the synthesis of amphotericin B.

Disclosure of the invention

The invention aims to provide recombinant streptomyces tuberculatus for producing amphotericin B (AmB) and application thereof, and the recombinant streptomyces tuberculatus can improve the amount of precursor substances in the streptomyces tuberculatus or improve the utilization rate of the precursor substances and effectively improve the yield of the AmB by expressing functional genes in the streptomyces tuberculatus.

The technical scheme adopted by the invention is as follows:

a recombinant Streptomyces tuberculatus for producing amphotericin B is obtained by knocking out PKS5 gene cluster shown in SEQ ID NO.6 from Streptomyces nodosus ZJB2016050 (i.e. CCTCC NO: M2017426) gene, and introducing acetyl coenzyme A carboxylase 1 gene shown in SEQ ID NO.1, acetyl coenzyme A carboxylase 2 gene shown in SEQ ID NO.2, polyketide synthase PKSamphA gene shown in SEQ ID NO.3, methylmalonyl coenzyme A mutase gene shown in SEQ ID NO.4 and tandem gene of methylmalonyl coenzyme A isomerase gene shown in SEQ ID NO. 5.

Preferably, the recombinant Streptomyces sarcomere is Streptomyces sarcomere ZJB 50-RAAAmm (Streptomyces nodosus ZJB2016050-RAAAmm), and is deposited in China center for type culture Collection with the address: wuhan university, Wuhan, China, zip code 430072, preservation number: CCTCC NO: m2019341, date of deposit 2019, 09/05 month.

The method for introducing the recombinant vector into the host bacteria is an inter-species conjugation transfer method, and the method can be as follows:

knocking out:

1) homologous arm fragments (each 3000bp) on two sides of the gene are knocked out through PCR amplification, and are inserted into a polyclonal locus of pJTU1278 vector plasmid to obtain a recovered vector pJTU 1278-RE;

2) the cloned kana resistance gene is inserted between two homologous arms of pJTU1278-Re to be used as a knockout screening marker, and a recovery vector pJTU1278-DE is obtained.

And (3) overexpression step:

1) inserting acetyl coenzyme A carboxylase 1 gene (acc1) obtained by PCR cloning and a promoter into a polyclonal locus of pJTU1278 vector plasmid to obtain a recombinant vector pJTU1278-acc 1;

2) transforming the recombinant vector obtained in the step 1) into escherichia coli JM109, sequencing the obtained transformant, and introducing the vector which is confirmed to be error-free into donor escherichia coli ET12567/pUZ 8002;

3) inserting acetyl coenzyme A carboxylase 2 gene (acc2), polyketide synthase PKSamphA, methylmalonyl coenzyme A mutase (mcm) and methylmalonyl coenzyme A isomerase (mme) into the constructed plasmid in the order of steps 1) and 2). Finally, the plasmid pJTU1278-acc1-acc2-amphA-mcm-mme is obtained.

4) Transforming the donor bacterium escherichia coli ET12567/pUZ8002/pJTU1278-acc1-acc2-amphA-mcm-mme containing the recombinant vector obtained in the step 3) into a recipient bacterium (namely CCTCC NO: m2017426), obtaining the genetically engineered bacteria with high-yield amphotericin B.

The invention also relates to application of the recombinant streptomyces tuberculatus in preparation of amphotericin B by microbial fermentation.

Specifically, the application is as follows: inoculating the recombinant streptomyces tuberculatus for producing amphotericin B to a fermentation culture medium, carrying out fermentation culture at 25-30 ℃ and 200-500 rpm to obtain fermentation liquor containing amphotericin B, and separating and purifying the fermentation liquor to obtain amphotericin B; the final concentration of the fermentation medium is as follows: 60-80 g/L of glucose, 5-10 g/L of beef extract, 5-10 g/L of soybean protein powder, 8-12 g/L of cotton seed powder and CaCO ₃ 5～10g/L，KH₂PO₄0.1-0.4 g/L, water as solvent, and pH 7.0.

The fermentation culture is usually carried out in a fermentation tank, the pressure of the fermentation tank is 0.05MPa, and the aeration ratio is 0.08-1.5 vvm.

Preferably, before fermentation culture, the streptomyces tuberculatus producing amphotericin B is subjected to seed culture, and then a seed solution is inoculated to a fermentation medium in an inoculum size of 2-10% by volume concentration, wherein the seed culture is as follows: inoculating recombinant streptomyces tuberculatus producing amphotericin B to a GYM plate, culturing at 28 ℃ for 7 days, taking gray and black spores, eluting surface spores into sterile water by using a cotton stick, filtering washed spore suspension by using an injector containing cotton, centrifuging at 12000rpm for 5min, removing supernatant, adding sterile water into a precipitate for re-suspension, centrifuging at 12000rpm for 5min, re-eluting once, re-suspending with sterile water to serve as spore suspension, inoculating the spore suspension into a seed culture medium, and culturing at 28 ℃ and 220rpm for 46h to obtain seed liquid; the final concentration of the GYM plate is as follows: 4g/L of glucose, 4g/L of yeast powder, 10g/L of malt extract, 2g/L of calcium carbonate, 18g/L of agar and water as a solvent, wherein the pH value is 7.2; the final concentration of the seed liquid culture medium is as follows: 10-20 g/L of peptone, 5-10 g/L of NaCl, 10-15 g/L of glucose, 5-10 g/L of yeast powder and CaCO₃0.5-1 g/L, water as solvent, and pH 7.0.

Compared with the prior art, the invention has the following beneficial effects:

1. over-expressing precursor supply related functional protein on the basis of strain knockout, increasing precursor supply amount and improving the yield of amphotericin B by 20 percent.

2. The utilization rate of the nutrient components of the culture medium in the fermentation process of the strain is improved, and the fermentation period is shortened, so that the risk of bacterial contamination is reduced.

3. Kanamycin has the advantages of low price, wide antimicrobial spectrum and strong bactericidal action, is suitable for industrial use, has strong improvement effect on the total income rate of enterprises, and can reduce the cost by about 2000 yuan per tank by taking a laboratory 5L tank as calculation.

(IV) description of the drawings

FIG. 1 is a map of a replacement restored plasmid constructed in example 1 of the present invention;

FIG. 2 is a map of kan-resistant replacement plasmids constructed in example 1 of the present invention;

FIG. 3 is a diagram showing the construction of functional gene tandem in example 4;

FIG. 4 shows the fermentation results of the recombinant Streptomyces nodosus 5L fermenter in example 7;

FIG. 5 is a standard curve for AmB High Performance Liquid Chromatography (HPLC) detection in example 9.

(V) detailed description of the preferred embodiments

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

example 1: knock-out vector construction

1. Homology arm 1 insertion

Taking the whole genome of streptomyces nodosus ATCC14899 as a template, designing primers TYB1-F and TYB1-R, TYB1-F as a forward primer aiming at the homologous arm 1, TYB1-R as a reverse primer aiming at the homologous arm 1 gene, cloning and amplifying the homologous arm 1 gene from the template, wherein the size of the fragment is about 3000bp, the fragment accords with a target fragment, sequencing analysis shows that the amplified sequence is the same as the target gene sequence, the fragment is cut by endonuclease XbaI and BamHI, the clean-up fragment is reserved, a vector pJTU1278 is also recovered by the same XbaI and BamHI endonuclease digestion glue, the recovered gene fragment is connected with a cut pJTU1278 vector, and the recombined plasmid vector is named as pJTU1278-TYB 1.

Wherein the cloning of the PCR system: add Streptomyces nodosus ATCC14899 whole genome template 1 u L, add 2 x Phanta Max Buffer 25 u L, dNTP (2.5mM)5 u L, TYB1 positive and negative primer each 1 u L, Phanta Max DNA polymerase 1 u L, make up deionized water to 50 u L.

Wherein the cloning PCR procedure: denaturation at 98 ℃ for 10s, annealing at 55-60 ℃ for 15s, and extension at 72 ℃ for 3min for 30 cycles. Finally, extension is carried out for 10min at 72 ℃.

Wherein the connection process is as follows: add 1. mu.L of T4 DNA ligase buffer to the sterilized PCR tube, add 4. mu.L of the recovered DNA fragment and 1. mu.L of the vector DNA, add 1. mu.L of T4 DNA ligase, add ddH₂Mu.l of O3, and reacting at 16 ℃ for 20 hours. The ligation products were transformed into JM109, which was competent for E.coli, and transformants were selected for validation by ampicillin resistance screening.

The primers used were as follows:

2. homology arm 2 insertion

Taking the whole genome of Streptomyces nodosus ATCC14899 as a template, designing primers TYB2-F and TYB2-R, wherein TYB2-F is a forward primer aiming at the homologous arm 2, TYB2-R is a reverse primer aiming at the homologous arm 2 gene, cloning and amplifying the homologous arm 2 gene from the template, wherein the size of the fragment is about 3000bp, the fragment is consistent with a target fragment, sequencing analysis shows that the amplified sequence is the same as the target gene sequence, the fragment is cut by endonuclease HindIII and KpnI, then clear-up fragment is reserved, a vector pJTU1278-TYB1 is recovered by the same endonuclease digestion glue, and the recovered gene fragment is connected with a cut pJTU1278-TYB1 vector to obtain a recombinant plasmid vector named as pJTU1278-TYB1-TYB2, as shown in figure 1.

Wherein the cloning of the PCR system: add Streptomyces nodosus ATCC14899 whole genome template 1 u L, add 2 x Phanta Max Buffer 25 u L, dNTP (2.5mM)5 u L, TYB2 positive and negative primer each 1 u L, Phanta Max DNA polymerase 1 u L, make up deionized water to 50 u L.

The primers used were as follows:

3. resistance selection tag insertion

pET28b is used as a template to design primers kan-F and kan-R, wherein kan-F is a forward primer aiming at the kala resistance gene, kan-R is a reverse primer aiming at the kala resistance gene, the kala resistance gene is cloned and amplified from the template, the size of the fragment is about 900bp, the fragment accords with the target fragment, sequencing analysis shows that the sequence obtained by amplification is the same as the target gene sequence, the fragment is cut by endonuclease HindIII and BamHI, clean-up is reserved, a vector pJTU1278-TYB1-TYB2 is also recovered by the same HindIII and BamHI endonuclease digestion glue, the recovered gene fragment is connected with the cut pJTU1278-TYB1-TYB2 vector, and a recombinant plasmid vector is named as pJTU1278-TYB1-kan-TYB2, as shown in figure 2.

Wherein the cloning of the PCR system: mu.L of Streptomyces nodularis ATCC14899 whole genome template was added, 25. mu.L of 2 XPhanta Max Buffer, 5. mu.L of dNTP (2.5mM), 1. mu.L of each of the kanamycin-resistant gene forward and reverse primers, 1. mu.L of Phanta Max DNA polymerase, and deionized water was added to make up to 50. mu.L.

Wherein the cloning PCR procedure: denaturation at 98 ℃ for 10s, annealing at 55-60 ℃ for 15s, and extension at 72 ℃ for 1min for 30 cycles. Finally, extension is carried out for 10min at 72 ℃.

The primers used were as follows:

example 2: resistant genomic replacement

Recombinant vector pJTU1278-TYB1-kan-TYB2 conjugation transfer transformation recipient bacterium Streptomyces tubercle A) preparation of E.coil ET12567/puz8002 Donor bacterium containing recombinant vector pJTU1278-TYB1-kan-TYB 2:

the constructed recombinant vector pJTU1278-TYB1-kan-TYB2 was introduced into E.coil ET12567/puz8002 Escherichia coli competence, using ampicillin (Amp)⁺50. mu.g/mL), chloramphenicol (Cm)⁺50. mu.g/mL), kanamycin (Kan)⁺50. mu.g/mL), positive transformants were picked and verified by colony PCR with primers upstream and downstream of M13, which demonstrated successful transformation of the recombinant vector pJTU1278-TYB1-kan-TYB2 into E.coil ET12567/puz 8002. The specific operation is as follows:

coli ET12567/puz8002 escherichia coli competent preparation method as follows:

taking E.coil ET12567/puz8002 Escherichia coli liquid from a glycerol freezing tube of the strain, streaking the liquid on an LB plate in a partition way, and culturing at 37 ℃ until a single colony grows out. Single colonies on the plate were picked and transferred to 2-5 mL LB medium at 37 ℃ and cultured overnight at 200 rpm. 200 mu L of overnight-cultured bacterial liquid is added into 20mL LB culture medium at 37 ℃, and cultured at 200rpm until OD600 is 0.4-0.7. The cultured bacterial liquid is transferred to a precooled 50mL centrifuge tube and is kept stand for 10min on ice. Centrifuge at 4 deg.C, 2500 Xg, 5 min. The supernatant was discarded, and 4mL of 0.1mol/L CaCl was added₂And standing for 10min after resuspension on ice. Centrifuge at 4 deg.C, 2500 Xg, 5 min. The supernatant was discarded, and 2mL of 0.1mol/L CaCl was added₂(15% final glycerol) and resuspend the pellet and allow to stand on ice for 30min to obtain E.coil ET12567/puz8002 E.coli competent cells. Subpackaging with 100 μ L/tube, and preserving at-80 deg.C.

Preparation of E.coil ET12567/puz8002 Donor bacteria containing the recombinant vector pJTU1278-TYB1-kan-TYB 2:

1 piece of the E.coil ET12567/puz8002 Escherichia coli competent cells was taken, ice-cooled for 5min, 5. mu.L of pJTU1278-TYB1-kan-TYB2 vector plasmid with a concentration of 200 ng/. mu.L was added, ice-cooled for 30min, water bath at 42 ℃ was performed, heat shock was performed for 90s, ice-cooled for 1min was returned, 600. mu.L of LB liquid medium was added, and culture was performed at 37 ℃ and 200rpm for 1 h. mu.L of the solution was pipetted and uniformly applied to Kan + (final concentration 50. mu.g/mL), Cm + (final concentration 50. mu.g/mL), Amp + (final concentration 50. mu.g/mL) resistant LB solid plate, and cultured in an incubator at 37 ℃ for 14 hours. Until a single E.coil ET12567/puz8002 colony containing the recombinant vector pJTU1278-TYB1-kan-TYB2 grows.

M13 validation PCR system: picking single colony, adding 20 microliter of sterile water, carrying out boiling water bath for 5-10 min, and centrifuging at 12000rpm for 1 min. mu.L of the supernatant was used as a template, and 10. mu.L of pfu Buffer, 0.1. mu.L of dNTP (2.5mM), 0.1. mu.L of each of M13 forward and reverse primers, 0.1. mu.L of pfu DNA polymerase, and 10. mu.L of deionized water were added thereto.

M13 validation PCR program: denaturation at 98 ℃ for 10s, annealing at 55-60 ℃ for 15s, and extension at 72 ℃ for 8min for 30 cycles. Finally, extension is carried out for 10min at 72 ℃.

The M13 primers were as follows:

M13(-21)F	TGTAAAACGACGGCCAGT
		M13 R	CAGGAAACAGCTATGAC

the E.coli ET12567/puz8002 into which the pJTU1278-TYB1-Kan-TYB2 plasmid has been introduced is streaked to separate a single colony, cultured at 37 ℃, picked up in a tube containing 5mL of LB medium, and simultaneously Kan is added⁺(final concentration 50. mu.g/mL), Cm⁺(final concentration 50. mu.g/mL), Amp⁺(final concentration 50. mu.g/mL) antibiotic, incubated at 37 ℃ for 14 h. Transfer 500. mu.L into 50mL LB flask while adding Kan⁺(final concentration 50. mu.g/mL), Cm⁺(final concentration 50. mu.g/mL), Amp⁺(final concentration 50. mu.g/mL) resistance, incubation to OD at 37 ℃₆₀₀Is 0.35. The donor was centrifuged through a 50mL centrifuge tube at 4000rpm for 5min, washed twice with 50mL LB medium, resuspended in 5mL LB medium, and stored at 4 ℃ until use.

Wherein the LB culture medium is prepared by the following method: 10g of peptone, 5g of yeast powder, 5g of sodium chloride and tap water, wherein the volume is constant to 1L, the pH is natural, and the sterilization is carried out at 121 ℃ for 20 min.

B) Preparation of recipient bacterium Streptomyces nodosus

Streptomyces nodosus ZJB2016050(CCTCC M2017426) of laboratory strains is inoculated on a GyM plate or slant culture, grown at 28 ℃ for 10d to obtain gray black spores, the surface spores are eluted into 10mL of 2 XYT medium by using a cotton stick, the washed spore suspension is filtered by a syringe containing cotton, 12000rpm of the filtered spores is obtained, the supernatant is removed after centrifugation for 5min, 10mL of 2 XYT medium is added for resuspension, 12000rpm is obtained for 5min for re-elution, and finally 500 μ L of 2 XYT medium is used for resuspension. And thermally shocking the resuspended spores at 50 ℃ for 15-20 min, and keeping the spores at normal temperature for later use.

Wherein the 2 XYT medium is prepared by the following method: 16g of peptone, 10g of yeast powder, 5g of sodium chloride and tap water, wherein the volume is fixed to 1L, the pH is natural, and the sterilization is carried out at 121 ℃ for 20 min.

The preparation method of the GYM solid culture medium comprises the following steps: 4g of glucose, 4g of yeast powder, 10g of malt extract, 2g of calcium carbonate, 18g of agar and tap water with the constant volume of 1L, the pH value of 7.2 and the sterilization at 121 ℃ for 20 min.

C) The process of joining donor and recipient bacteria:

after mixing 500. mu.L of the heat-shocked spore suspension of step B) with 500. mu.L of the donor E.coli suspension of step A), resuspension was performed by centrifugation at 6000rpm for 2min, 800. mu.L of the supernatant was removed, and the pellet was resuspended and spread on a MS solid medium plate containing 10mM magnesium chloride in the remaining supernatant. After culturing at 28 ℃ for 20h, 1mL of aqueous solution containing 0.5mg of napadiramic acid and 0.5mg of thiostrepton antibiotic was applied, and the culture was continued at 28 ℃ for 10 days until transformants appeared.

The transformant was continuously purified 3 times on a solid plate containing naphtholic acid at a final concentration of 50. mu.g/mL and kanamycin-resistant at a final concentration of 50. mu.g/mL until a single colony was obtained, and after PCR verification of the colony of the transformant using 16S RNA upstream and downstream primers (16S-8 and 16S-1541) and M13 upstream and downstream primers (M13(-21) F, M13R), sequencing comparative analysis confirmed that the plasmid (pJTU1278-TYB1-kan-TYB2) had been introduced into the recipient bacterium Streptomyces nodosus ZJB 50, and finally the genetically engineered bacterium that produces AmB, i.e., Streptomyces nodosus pJTU1278-TYB1-kan-TYB2, was obtained. Adding Kan through several rounds of resistance culture⁺(final concentration 50. mu.g/mL) to obtain the final successfully replaced strain Streptomyces nodosus ZJB2016050-De 5.

Wherein the MS solid culture medium is prepared by the following method: 20g of soybean meal, 20g of mannitol, 20g of agar and tap water, wherein the volume is constant to 1L, the pH value is adjusted to 7.2 by sodium hydroxide, and the mixture is sterilized at 121 ℃ for 20 min. Sterile magnesium chloride was added to a final concentration of 10mM before use.

Wherein M13 verifies that the PCR operation is as described in step A).

Wherein the 16sRNA verifies the PCR system: single colonies were picked, 20. mu.L of sterile water was added, and centrifuged at 12000rpm for 1min in a boiling water bath for 30 min. mu.L of the supernatant was used as a template, and 2X Phanta Max Buffer (5. mu.L), dNTP (2.5mM) 0.1. mu.L, 16S forward and reverse primers (0.1. mu.L each), Phanta Max DNA polymerase (0.1. mu.L) and deionized water were added to make up to 10. mu.L.

Among them 16S RNA validation PCR program: denaturation at 98 ℃ for 10s, annealing at 55-60 ℃ for 15s, and extension at 72 ℃ for 1min for 30s for 30 cycles. Finally, extension is carried out for 10min at 72 ℃.

The primers used were as follows:

16S-8	AGAGTTTGATCCTGGCTCAG
		16S-1541	AAGGAGGTGATCCAGCCGCA
M13(-21)F	TGTAAAACGACGGCCAGT

example 3: knock-out resistance tag reconstitution

Recombinant vector pJTU1278-TYB1-TYB2 conjugately transfers recipient bacterium Streptomyces nodosus ZJB2016050-De5

A) Preparation of E.coil ET12567/puz8002 Donor bacteria containing the recombinant vector pJTU1278-TYB1-TYB 2:

the constructed recombinant vector pJTU1278-TYB1-TYB2 was introduced into E.coil ET12567/puz8002 Escherichia coli competence using ampicillin (Amp)⁺50. mu.g/mL), chloramphenicol (Cm)⁺50. mu.g/mL), kanamycin (Kan)⁺50. mu.g/mL), positive transformants were picked and verified by colony PCR with primers upstream and downstream of M13, which demonstrated successful transformation of the recombinant vector pJTU1278-TYB1-TYB2 into E.coil ET12567/puz 8002. The specific operation is as follows:

coli ET12567/puz8002 escherichia coli competent preparation method as follows:

taking E.coil ET12567/puz8002 Escherichia coli liquid from a glycerol freezing tube of the strain, streaking the liquid on an LB plate in a partition way, and culturing at 37 ℃ until a single colony grows out. Single colonies on the plate were picked and transferred to 2-5 mL LB medium at 37 ℃ and cultured overnight at 200 rpm. 200 mu L of overnight-cultured bacterial liquid is added into 20mL LB culture medium at 37 ℃, and cultured at 200rpm until OD600 is 0.4-0.7. The cultured bacterial liquid is transferred to a precooled 50mL centrifuge tube and is kept stand for 10min on ice. Centrifuge at 4 deg.C, 2500 Xg, 5 min. The supernatant was discarded, and 4mL of 0.1mol/L CaCl was added₂And standing for 10min after resuspension on ice. Centrifuge at 4 deg.C, 2500 Xg, 5 min. The supernatant was discarded, and 2mL of 0.1mol/L CaCl was added₂(15% final glycerol) and resuspend the pellet and allow to stand on ice for 30min to obtain E.coil ET12567/puz8002 E.coli competent cells. Subpackaging 100 mu L/tube stored at-80 ℃.

Preparation of E.coil ET12567/puz8002 Donor bacteria containing the recombinant vector pJTU1278-TYB1-TYB 2:

1 piece of the E.coil ET12567/puz8002 Escherichia coli competent cells are taken, ice-cooled for 5min, 5 uL of pJTU1278-TYB1-TYB2 vector plasmid with the concentration of 200 ng/uL is added, ice-cooled for 30min, and then the mixture is put into a water bath at 42 ℃ and heat shock for 90s and then put back into the ice bath for 1min, 600 uL of LB liquid culture medium is added, and the mixture is cultured for 1h at 37 ℃ and 200 rpm. mu.L of the solution was pipetted and uniformly applied to Kan + (final concentration 50. mu.g/mL), Cm + (final concentration 50. mu.g/mL), Amp + (final concentration 50. mu.g/mL) resistant LB solid plate, and cultured in an incubator at 37 ℃ for 14 hours. Until a single E.coil ET12567/puz8002 colony containing the recombinant vector pJTU1278-TYB1-TYB2 grows.

The M13 primers were as follows:

M13(-21)F	TGTAAAACGACGGCCAGT
		M13 R	CAGGAAACAGCTATGAC

the E.coli ET12567/puz8002 into which the pJTU1278-TYB1-TYB2 plasmid has been introduced is streaked to separate a single colony, cultured at 37 ℃, picked in a tube containing 5mL of LB medium, andwith simultaneous addition of Kan⁺(final concentration 50. mu.g/mL), Cm⁺(final concentration 50. mu.g/mL), Amp⁺(final concentration 50. mu.g/mL) antibiotic, incubated at 37 ℃ for 14 h. Transfer 500. mu.L into 50mL LB flask while adding Kan⁺(final concentration 50. mu.g/mL), Cm⁺(final concentration 50. mu.g/mL), Amp⁺(final concentration 50. mu.g/mL) resistance, incubation to OD at 37 ℃₆₀₀Is 0.35. The donor was centrifuged through a 50mL centrifuge tube at 4000rpm for 5min, washed twice with 50mL LB medium, resuspended in 5mL LB medium, and stored at 4 ℃ until use.

B) Preparation of recipient bacterium Streptomyces nodosus

The laboratory strains of Streptomyces nodosus ZJB2016050-De5 were inoculated on GYM plate or slant culture, grown at 28 ℃ for 10d to obtain gray black spores, surface spores were eluted into 10mL of 2 XYT medium using cotton stick, the washed spore suspension was filtered with a syringe containing cotton, the filtered spores were 12000rpm, centrifuged for 5min, the supernatant was removed, 10mL of 2 XYT medium was added for resuspension, centrifuged at 12000rpm for 5min and re-eluted, and finally resuspended in 500. mu.L of 2 XYT medium. And thermally shocking the resuspended spores at 50 ℃ for 15-20 min, and keeping the spores at normal temperature for later use.

C) The process of joining donor and recipient bacteria:

The transformant was continuously purified 3 times on a solid plate containing naphtholic acid at a final concentration of 50. mu.g/mL and kanamycin-resistant at a final concentration of 50. mu.g/mL until a single colony was obtained, and after PCR verification of the colony of the transformant using 16S RNA upstream and downstream primers (16S-8 and 16S-1541) and M13 upstream and downstream primers (M13(-21) F, M13R), sequencing comparative analysis confirmed that the plasmid (pJTU1278-TYB1-TYB2) had been introduced into the recipient bacterium Streptomyces nodosus ZJB2016050-De5, and finally the genetically engineered bacterium producing AmB, i.e., recombinant Streptomyces tubercle pJTU1278-TYB1-TYB2, was obtained. Through several rounds of resistance culture, adding Kan⁺(final concentration 50. mu.g/mL) to obtain the final successfully replaced strain Streptomyces nodosus ZJB2016050-Re 5.

Wherein M13 verifies that the PCR operation is as described in step A).

Example 4: construction of functional Gene tandem vector

Taking the whole genome of Streptomyces nodosus ATCC14899 as a template, designing primers mcm-F and mcm-R, cloning and amplifying an acetyl-CoA carboxylase 1 gene (acc1), a fragment size of about 1776bp, an acetyl-CoA carboxylase 2 gene (acc2), a fragment size of about 1941bp, a polyketide synthase PKSamphA, a fragment size of about 4239bp, a methylmalonyl-CoA mutase (mcm), a fragment size of about 1737bp, a methylmalonyl-CoA isomerase (mme) fragment size of about 441bp, which are consistent with a target fragment, and according to sequencing analysis, the amplified sequence is identical to the target gene sequence, the nucleotide sequence of the acetyl-CoA carboxylase 1(acc1) gene is shown as SEQ ID No.1, the nucleotide sequence of the acetyl-CoA carboxylase 2 gene (acc2) is shown as SEQ ID No.2, and the nucleotide sequence of the synthase PKhA gene is shown as Samph No.3, the nucleotide sequence of methylmalonyl-CoA mutase (mcm) gene is shown in SEQ ID No.4, and the nucleotide sequence of methylmalonyl-CoA isomerase gene (mme) is shown in SEQ ID No. 5. The fragment is cut by endonuclease BamHI and HindIII, clean-up is reserved, vector pJTU1278 is recovered by the same BamHI and HindIII endonuclease digestion gel, the recovered gene fragment is connected with the cut pJTU1278 vector to obtain a recombinant plasmid vector named as pJTU1278-acc1-acc2-amphA-mcm-mme, and the schematic diagram is shown in figure 3.

Wherein the cloning of the PCR system: add 1. mu.L of genomic template, 2 XPPhanta Max Buffer 25. mu.L of dNTP (2.5mM) 5. mu.L of the corresponding forward and reverse primers, 1. mu.L of each, Phanta Max DNA polymerase 1. mu.L, make up deionized water to 50. mu.L.

Wherein the cloning PCR procedure: denaturation at 98 ℃ for 10s, annealing at 55-60 ℃ for 15s, and extension at 72 ℃ for 2min for 30 cycles. Finally, extension is carried out for 10min at 72 ℃.

Wherein the connection process is as follows: adding 1. mu.L of T4 DNA ligase buffer to a sterilized PCR tube, adding 4. mu.L of the recovered DNA fragment and 1. mu.L of the vector DNA, adding 1. mu.L of T4 DNA ligase, and adding ddH₂O3. mu.L, and reacted at 16 ℃ for 20 hours. The ligation products were transformed into JM109, which was competent for E.coli, and transformants were selected for validation by ampicillin resistance screening.

Example 5: functional gene expression

The constructed recombinant vector pJTU1278-acc1-acc2-amphA-mcm-mme is introduced into E.coil ET12567/puz8002 escherichia coli competence, using ampicillin (Amp)⁺50. mu.g/mL), chloramphenicol (Cm)⁺50. mu.g/mL), kanamycin (Kan)⁺50 mu g/mL), selecting positive transformant, verifying by colony PCR of upstream and downstream primers of M13, and proving that the recombinant vector pJTU1278-acc1-acc2-amphA-mcm-mme was successfully transformed into E.coil ET12567/puz 8002. The specific operation is as follows:

coli ET12567/puz8002 escherichia coli competent preparation method as follows:

E.coil ET12567/puz8002 donor bacteria containing recombinant vector pJTU1278-acc1-acc 2-amphA-mcm-mme:

1 piece of the E.coil ET12567/puz8002 Escherichia coli competent cells are taken, ice-cooled for 5min, 5 uL of pJTU1278-TYB1-TYB2 vector plasmid with the concentration of 200 ng/uL is added, ice-cooled for 30min, and then the mixture is put into a water bath at 42 ℃ and heat shock for 90s and then put back into the ice bath for 1min, 600 uL of LB liquid culture medium is added, and the mixture is cultured for 1h at 37 ℃ and 200 rpm. mu.L of the solution was pipetted and uniformly applied to Kan + (final concentration 50. mu.g/mL), Cm + (final concentration 50. mu.g/mL), Amp + (final concentration 50. mu.g/mL) resistant LB solid plate, and cultured in an incubator at 37 ℃ for 14 hours. Until a single E.coil ET12567/puz8002 colony containing the recombinant vector pJTU1278-acc1-acc2-amphA-mcm-mme grew.

The M13 primers were as follows:

M13(-21)F	TGTAAAACGACGGCCAGT
		M13 R	CAGGAAACAGCTATGAC

the E.coli ET12567/puz8002 into which the pJTU1278-acc1-acc2-amphA-mcm-mme plasmid has been introduced is streaked to separate a single colony, cultured at 37 ℃, picked into a test tube containing 5mL of LB medium, and simultaneously added with Kan⁺(final concentration 50. mu.g/mL), Cm⁺(final concentration 50. mu.g/mL), Amp⁺(final concentration 50. mu.g/mL) antibiotic, incubated at 37 ℃ for 14 h. Transfer 500. mu.L into 50mL LB flask while adding Kan⁺(final concentration 50. mu.g/mL), Cm⁺(final concentration 50. mu.g/mL), Amp⁺(final concentration 50. mu.g/mL) resistance, incubation to OD at 37 ℃₆₀₀Is 0.35. The donor was centrifuged through a 50mL centrifuge tube at 4000rpm for 5min, washed twice with 50mL LB medium, resuspended in 5mL LB medium, and stored at 4 ℃ until use.

B) Preparation of recipient bacterium Streptomyces nodosus

The laboratory strains of Streptomyces nodosus ZJB2016050-Re5 inoculated on GYM plate or slant culture, growing at 28 deg.C for 10d to obtain gray black spores, eluting surface spores to 10mL of 2 XYT culture medium with a cotton stick, filtering the washed spore suspension with a syringe containing cotton, filtering the filtered spores at 12000rpm, centrifuging for 5min, removing supernatant, adding 10mL of 2 XYT culture medium for resuspension, centrifuging at 12000rpm for 5min, eluting again, and finally resuspending with 500. mu.L of 2 XYT culture medium. And thermally shocking the resuspended spores at 50 ℃ for 15-20 min, and keeping the spores at normal temperature for later use.

C) The process of joining donor and recipient bacteria:

The transformant was continuously purified 3 times on a solid plate containing naphtholic acid at a final concentration of 50. mu.g/mL and kanamycin-resistant at a final concentration of 50. mu.g/mL until a single colony was obtained, and after PCR verification of the colony of the transformant using 16S RNA upstream and downstream primers (16S-8 and 16S-1541) and M13 upstream and downstream primers (M13(-21) F, M13R), sequencing comparative analysis confirmed that the plasmid (pJTU1278-acc1-acc2-amphA-mcm-mme) had been introduced into the recipient bacterium Streptomyces nodosus ZJB2016050-Re5, and finally the genetically engineered bacterium producing AmB, i.e., the recombinant Streptomyces tuberculatus pJTU 1278-B1-TYB 2, was obtained. Through several rounds of resistance culture, adding Kan⁺(final concentration 50. mu.g/mL) to obtain the strain Streptomyces nodosus ZJB2016050-De5-pJTU1278-acc1-acc2-amphA-mcm-mme (namely CCTCC NO: M2019341) which is successfully replaced finally.

Wherein M13 verifies that the PCR operation is as described in step A).

Example 6: shake flask fermentation for producing AmB

(1) Preparation of spore suspension: the AmB-producing recombinant Streptomyces nodosus ZJB2016050-De5-pJTU1278-acc1-acc2-amphA-mcm-mme prepared in example 5 was inoculated into a GYM plate, the plate was cultured at 28 ℃ for 7 days, spores with gray black color were taken, surface spores were eluted into 10mL of sterile water using a cotton swab, the washed spore suspension was filtered by a syringe containing cotton, the filtered spores were centrifuged at 12000rpm for 5min, the supernatant was removed, 10mL of sterile water was added for resuspension, and the filtrate was centrifuged at 12000rpm for 5min and re-eluted once, and 5mL of sterile water was used for resuspension to obtain a spore suspension.

(2) Preparing a seed solution:

inoculating the spore suspension obtained in the step (1) into a seed culture medium, and culturing at 28 ℃ and 220rpm for 46h to obtain a seed solution.

The seed culture medium is prepared by the following method: peptone 20g, NaCl 8g, glucose 15g, yeast powder 10g, CaCO₃1g, adding water to a constant volume of 1L, adjusting the pH value to 7.0, and sterilizing at 121 ℃ for 20 min.

(3) Fermentation culture

The 500mL standard is shaken and filled with 50mL fermentation medium, the seed liquid is inoculated according to the volume concentration of 2 percent during fermentation, and the fermentation culture is carried out for 168 hours at 28 ℃ and 220 rpm.

The fermentation medium comprises the following components: 70g/L of glucose, 8g/L of beef extract, 8g/L of soybean protein powder, 10g/L of cotton seed powder and CaCO₃ 10g/L，KH₂PO₄0.2g/L, the solvent is tap water, the pH is 7.0, and the sterilization is carried out for 20min at the temperature of 121 ℃.

The genetically engineered bacteria are produced by shake flask fermentation and detected according to the method of the embodiment 8, wherein the AmB content in the fermentation liquor obtained by ZJB2016050-De5-pJTU1278-acc1-acc2-amphA-mcm-mme is 7.2 g/L.

Example 7: AmB produced by fermentation in 5L fermentation tank

The AmB-producing genetically engineered bacteria (recombinant Streptomyces nodosus ZJB2016050-De5-pJTU1278-acc1-acc2-amphA-mcm-mme) spore suspension or slant culture prepared in example 5 are inoculated into a seed culture medium and cultured at 28 ℃ and 220rpm for 48h to obtain a seed solution.

Fermentation conditions are as follows: 3L of fermentation liquor is filled in a 5L fermentation tank, the inoculation amount is used for inoculating seed liquor according to the volume concentration of 5%, the fermentation culture is carried out for 100h at the temperature of 28 ℃, the pressure of 0.05MPa, the aeration ratio of 1.2vvm and the rotating speed of 400rpm, and fermentation liquor is obtained.

The fermentation medium of the 5L fermentation tank comprises: 70g/L of glucose, 8g/L of beef extract, 8g/L of soybean protein powder, 10g/L of cotton seed powder and CaCO₃ 10g/L，KH₂PO₄0.2g/L, the solvent is tap water, the pH is 7.0, and the sterilization is carried out for 20min at the temperature of 121 ℃.

Under the same conditions, the recombinant Streptomyces nodosus ZJB2016050 (namely CCTCC NO: M2017426) is used as a control for fermentation culture.

Comparison of the AmB-producing genetically engineered bacteria (recombinant Streptomyces nodosus ZJB2016050-De5-pJTU1278-acc1-acc2-amphA-mcm-mme) prepared in example 5 with the control bacteria (Streptomyces nodosus ZJB2016050) in a 5L tank fermentation. The genetically engineered bacteria are produced by fermentation in a 5L tank, and the AmB content in the fermentation liquor obtained by the genetically engineered bacteria is 16.0g/L as shown in figure 4 according to the detection method of the embodiment 8, while the yield of the reference strain AmB is 13.6 g/L.

Example 8: preparation of AmB finished product

500L of the fermentation broth obtained in example 7 was taken. Filtering the fermentation liquid with plate frame to obtain wet mycelium, oven drying to obtain dry mycelium weight of 8.1kg, adding the oven dried mycelium into extraction tank, adding 70L methanol, cooling to 4 deg.C, adjusting pH to 3.0 with hydrochloric acid, stabilizing for one hour, and filtering to obtain filtrate. And (3) putting the filtrate into a crystallizing tank, adding 10L of purified water, adjusting the pH to 6.0 by using alkali liquor, heating to 25 ℃, preserving the temperature for one hour, completing crystallization, and standing for layering. Filtering to obtain solid (namely AmB crystal powder), continuously adding methanol for washing, removing impurities, finally drying and crushing to obtain an AmB crude product, wherein the yield of the crude product is 14.6g/L and the product purity is over 94 percent by detecting the crude product through the liquid chromatography described in the embodiment 8.

Example 9: HPLC detection method of AmB

Taking the fermentation liquor prepared by the method of example 5, and mixing the fermentation liquor: DMSO is 1: mixing the mixture with DMSO at the volume ratio of 9, extracting at room temperature for 20-30 minutes, centrifuging at 12000rpm for 5min, taking supernatant, filtering with 0.45 mu m organic filter membrane, and detecting by High Performance Liquid Chromatography (HPLC).

The detection method comprises the following steps: the chromatographic column is C18 column (150 × 4.6mm), the column temperature is 25 deg.C, the flow rate is 1mL/min, the sample volume is 20 μ L, the chromatographic retention time is 30min, and the detection wavelength is 405 nm. The peak time of AmB was 26.9 min.

The preparation method of the mobile phase comprises the following steps: 1.1g EDTA-Na₂And 4.1g of sodium acetate, and distilled water are added to the mixture to reach the constant volume of 1L, 900mL of the solution is taken to be mixed with 700mL of acetonitrile and 400mL of methanol, and the pH value of acetic acid is adjusted to 5.0;

AmB yield calculation method: AmB standards were purchased from Sigma, DMSO was used to prepare AmB standards at different concentrations (0mg/L, 200mg/L, 400mg/L, 800mg/L, 1000mg/L), peak areas of the standards were measured by HPLC, and a standard curve was calculated as Y ═ 0.0123X +2539.9, R, from the peak areas and the concentrations of the AmB standards²0.999 (where Y is the concentration of AmB and X is the peak area). A peak area can be obtained by detecting an AmB sample with unknown concentration through HPLC, the concentration is obtained by substituting the peak area into the standard curve formula, and the result of the standard curve is shown in FIG. 5.

Sequence listing

<110> Zhejiang industrial university

<120> recombinant streptomyces tuberculatus with high yield of amphotericin B and application thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1776

<212> DNA

<213> Streptomyces nodosus

<400> 1

tcagtccttg atctcgcaga tcgcggcgcc ggaggagagg gaggcgccga cctccgcggt 60

caggcccttg atcgtgccgg ctcggtgcgc gttgagcggc tgctccatct tcatggcctc 120

caggacgacg accaggtcgc cctcctggac ctcctggccc tcctcgaccg cgaccttcac 180

gatcgtgccc tgcatcgggg aggccagggt gtcgccggag accgagggac cggacttctt 240

cgccgcgcgc cgcttcggct tggcgcccgc cgccagaccc gtacgggcca gcgacatacc 300

gagcgacgcg ggcagcgaca cctcgagacg cttgccgccg acctcgacca cgaccgtctc 360

acggcccgcc gggtcctcct cggcctccgc gtccgcggcc gccgcgaacg gcttgatctc 420

gttgacgaac tcggtctcga tccagcgggt gtggaccgtg aaggggccct cggagccggt 480

cagttcgggc gcgaacgcgg tgtccctgac caccgcgcgg tggaacggga tcgccgtggc 540

catcccctcg acctggaact cgtccagggc gcgggcggcc cgctccagag cctccttgcg 600

ggtgcggccc gtcacgatca gcttggccag cagggagtcc cacgccgggc cgatgaccga 660

acccgactcc acacccgcgt ccagccgcac accggggccg gacggcggag cgaacgcggt 720

caccgtgccg ggggcgggca ggaagccccg gcccgggtcc tcgccgttga tccggaactc 780

gaaggaatgg ccgcgcagtt cggggtcgtc atagcccagt tcctcgccgt cggcgatacg 840

gaacatctca cggaccaggt cgatgccggc gacctcctcg gtgaccgggt gctcgacctg 900

gagccgggtg ttgacctcca ggaaggagat cgtcccgtcg ttgccgacca ggaactccac 960

cgtgcccgcg cccacatagc cggcctcctt gaggatggcc ttggacgccg agtacagctc 1020

ggcgacctgc ccgtccgaca ggaacggcgc gggggcctcc tcgaccagct tctggtggcg 1080

ccgctgcagc gagcagtcac gggtggagac caccacgacg ttgccgtgcc ggtcggccag 1140

gcactgtgtc tccacgtgcc ggggccggtc cagatagcgc tccacgaagc actcgccacg 1200

gccgaaggcg gcgaccgcct cacggaccgc cgactcgtac agctcgggga tctcctccag 1260

ggtgcgggcc accttcagac cgcgcccgcc accgccgaag gcggccttga tcgcgatcgg 1320

caggccgtgc tcctcggcga aggtgacgac ctcgtcggcg ccggacaccg ggtcgggcgt 1380

accggcgacc aggggggcac ccgcgcgctg cgcgatgtgc cgggccgcga ccttgtcacc 1440

gagatcgcgg atggcctgcg gcggcgggcc gatccagatc agaccggcgt ccaggacggc 1500

ctgggcgaag tcggcgttct cggagaggaa accgtagccg gggtggatgg cgtccgcgcc 1560

ggaatccttg gccgcctgaa ggaccttgtc gatgtccagg taactggtgg cgggcgtgtc 1620

tcctcccagg gcgaacgcct cgtccgcggc gcggacgtgc agggcgtccc ggtccgggtc 1680

ggcgtagacg gccacgctcg cgatcccggc gtcacgacag gcccgggcga cacggacagc 1740

gatttcgcca cggttggcga tcaacacctt gcgcac 1776

<210> 2

<211> 1941

<212> DNA

<213> Streptomyces nodosus

<400> 2

atgtttgaca cggtgctcgt ggccaaccgg ggcgagatcg cggtccgggt cgtccgcacc 60

ctgcgcgcgc tcggggtgcg ttcggtggcc gtcttctccg acgcggacgc cgacgcccgg 120

cacgtccggg aggccgacac ggcggtacgg atcggaccgg cgcccgcagc cgagagctat 180

ctgtccgtcg agcggctcct cgcggcggcg gcccgcaccg gcgcccaggc ggtgcacccg 240

ggatacggct tcctcgcgga gaacgccgcc ttcgcgaagg cgtgcgcgga ggcggggctg 300

gtcttcatcg ggccgcccgc cgaggcgatc tccctcatgg gcgacaagat ccgcgccaag 360

gagacggtgc gggcggccgg ggtgccggtc gtcccgggct ccgacggcag cgggctgacg 420

gacgagcagc tggccgaggc ggcccacacc atcggcatgc cggtgctgct gaagccgagc 480

gccggcgggg gcggcaaggg catgcggctg gtgcgggagc cggagcggct ggccgaggag 540

atcgccgcgg cccgccgtga ggcccgcgcc tccttcggcg acgacacgct cctggtcgag 600

cgctggatcg accggccccg gcatatcgag atccaggtcc tggccgactc ccacgggaac 660

gtggtgcatc tgggcgagcg cgagtgctcc ctccagcgcc gccaccagaa gctcatcgag 720

gaggcgccca gtgtgttcct cgacgaggcc acccgtgcgg cgatgggcga ggcggcggtc 780

caggcggccc gctcctgcgg ctaccggggc gcgggcacgg tggagttcat cgtcccgggc 840

aacgacccct ccgcctatta cttcatggag atgaacaccc gcctccaggt ggaacacccg 900

gtcaccgagc tggtcaccgg cctggacctg gtggaatggc agctgcgggt ggcggcgggc 960

gagccgctgt ccttcgggca ggacgacatc acgctcaccg ggcacgccgt ggaggcgcgg 1020

atctgcgccg aggaccccgc ccgcggcttc ctcccctccg gcggcacggt gctcgcgctg 1080

cacgaaccgg ggggcgacgg cctccgcacc gactcgggcc tgtccgaggg caccgaggtc 1140

ggcagcctct acgacccgat gctgtccaag gtcatcgccc acggccccga ccgggcgacc 1200

gcgctgcgca gactgcgcgc ggccctcggg gagaccgtca ccctgggcgt ggggaccaac 1260

gccggttttc tgcgccggct gctggcccat cccgcggtcg tggcgggcga actggacacc 1320

gggctggtgg aacgcgaggc ggacggcctc atcccggagg gggtgccgga ggaggtgtac 1380

gaggccgccg ccgccgtgcg cctggacgca ctgcggcccc ggggcgaggg ctggaccgac 1440

ccgttctcgg tgccggacgg ctggcgcctc ggcggcgagc ccgcgcccct gtccttcccc 1500

ctgcgggtgt ccgaaccggt ggagtactcc ccccggggca cccacacggt caccgaggac 1560

cgggtgtccg tggtgctgga cggggtgcgg cacaccttcc accgcgccgc cgactggctc 1620

ggccgggacg gcgacgcctg gcaggtgcgc gaccatgacc cggtcgccgc ctcgctcacc 1680

ggcgccgccc gagccggcac cgactcgctg accgcgccca tgcccggcac ggtcaccgtg 1740

gtgaaggtcg ccgtcgggga cgaggtggcc gcagggcaga gcctgctggt ggtcgaggcg 1800

atgaagatgg agcacgtcat ctccgcgccg cacgccggga ccgtcgccga actcgacgtc 1860

accccgggca ccacggtggt catggaccag gtgctggccg tgatcacccc gcacgaggag 1920

cacacggagg cggagcgatg a 1941

<210> 3

<211> 4239

<212> DNA

<213> Streptomyces nodosus

<400> 3

atgacgatcg gagccaacga cgatccggta gtggtcgtcg gaatggcctg ccgcttcccg 60

ggaggcgtcg aggggcccga ggacctgtgg gagctggtcc gcgacggccg cgacgccacc 120

gggccgttcc ccggcgaccg cggctgggac ctggccgccc tgaccggcga cgggccggac 180

cacagcgtga cccaccgagg cggattcctc gccgcggccg ccgacttcga cgccggcttc 240

ttcgggatgt cgccccgcga ggccgtctcc accgacccgc agcagcggct cgtcctggag 300

acctcctggg aggccctgga acacgccggc atcgacccgc acaccctgcg gggcacccgc 360

accggcgtct tcgtcggcac caacggccag gactacgcga ccgtcaccaa cgcctcccgc 420

gaggacctca ccgggcacgc cctcaccggt ctgtcgccga gcatcgcctc cgggaggctc 480

gcctacttcc tcggcctcga agggcccgcc gtcaccctcg acacggcgtc ctcctcgtcc 540

ctggtcgccc tccactacgc gctgcgctcg ctcaggtcgg gggagtgcac caccgcgctg 600

gccggcggcg tcaccgtgat gtccacaccg gtcgggttca tcgcctacac ccggcagggc 660

ggactcgccg ccgacggccg ctgcaaggtc ttctccgacg acgccgacgg caccacctgg 720

gcggagggcg ccggcatgat cgtgctggag cgcctgtcca ccgcccgcgc cgccgggcac 780

cgggtgctcg ccgtgctgcg cggctccgcc gtcaaccagg acggcgcctc cgacggtctc 840

accgccccca gcggaccggc ccaggaacga ctcgtccgcg aggccctcgc cgacgccgga 900

ctcggacccg ccgacatcga cctcgtcgag gcccacggca ccggcacccg gctcggcgac 960

cccatcgagg cccgggccct gctcgccacc tacggccagg accgcgacgg cggacagccg 1020

ctgcgcctcg gctccctgaa gtccaacatc gggcacgccc aggcagccgc cggcatcggc 1080

ggactcatca aggccgtcca ggcgctgcgc cacggcctga tgccggagac cctgaacctc 1140

tccacgccca cccggcacgt cgactggtcg gccggcgccg tcgaactcct caccgaggcc 1200

ctgccctggc ccggcaccgg ccgcccgcgc cgggccgccg tctcctcctt cggcatcagt 1260

ggcaccaacg cgcatgtcat cgtggaggaa gccccgacga ccgaccccgc cgccgcggtc 1320

cccgccgggc ccgcccaccg ggacgtggcc tcggccgccg actccgccgc gcggcccgct 1380

gccctcgccg gggagcccgc cgacacctct gctcccgccg ctgtcgacgc cggcccggcc 1440

gaccgcccgg tcacccccgc cgctcggctc gccgccctcg tgcccgcggc cgacgccgtc 1500

gcgtggccgg tgtccggggc ctccccggag gctctcgacg cgcaggtcga gcggctcacc 1560

tccttcgtcc gggaccaccc cggcgccgat ccgctggaca tcggtcactc gctggccacc 1620

gggcgggcgg cgttgcggca ccgtgcggtg ctggtgccgt ccggtgacgg tgtcgtggag 1680

atcgcccgcg gtgaggccgc cccccgcacc accgccgtcc tcttctccgg acagggctcc 1740

cagcggctcg gcatgggccg tgaactcgcc gcccgcttcc cggtcttcgc gaaggccctg 1800

gacaccgtcc tggccgccct cgacccccaa ctcgagcgtc cggtgcggtc cgtgatgtgg 1860

ggcgaggacc ccgccgaact cgaccgcacc gggtggaccc agcccgcgct gttcgccttc 1920

gaggtcgccc tgtaccggct cgccgagtcc ttcgggctgc gccccgacgc cgtcggcggc 1980

cactccgtcg gcgagatcgc cgccgcgcac atcgccggag tgctctcgct ggaggacgcc 2040

gcgcgtctgg tcgccgcccg cgccaccctg atgcaggccc tgcccgaggg cggcgccatg 2100

tccgccgtcg aggcctccga ggacgaggtg ctcccgctgc tcgacggcga tgtctcgctc 2160

gccgccgtca acggccccac cgcggtcgtc gtctccggcg ccgaggacgc cgtggagcgc 2220

gtctccgccc acttcgctgc ccaaggccgc cgcaccagcc gcctcgcggt ctcgcacgcc 2280

ttccactcgc cgctgatgga gccgatgctc gacgccttcc gggacgtcgt cgccggactc 2340

accttccatg agccgacgct gccggtgatg tccaacctca ccggtgaact tgccggtgcc 2400

gagatcgcca cccccgagta ctgggtgcgg catgtgcgcg gtaccgtccg cttcgccgac 2460

ggcgtgacgg ccctgcggga acacggcacc gacctgctgg tcgaactggg ccccggcagc 2520

gtcctgaccg ccctcgcccg caccgtcctc ggcccggaca ccccgggcgc ccctgtcgac 2580

gtggtgccca ccctccgcaa ggaccagccc gaggagaggg ctctcaccgc cgcgctcggc 2640

cggctccatg tcctcggcgc gaccgtcgac tggtccgccc tctacaccgg caccggagcc 2700

cgccgcaccg acctgccgac gtacgccttc cagcacgcgc ggtactggcc cgccccgggc 2760

cggcccggca ccggtaccgc gggcggcggg catccgctgc tcggcccggc cgtggaactc 2820

gccgacggcg gcacggtgtc gggcgccaca ctgtccgtcg ccacccaccc ctggctcgcc 2880

gaccatgtcg tcgccgggcg cgtcctgctg cccgccgccg tgctcgtgga actcgccgta 2940

cgcgcgggtg acgacaccgg atgcgacgtc ctgcacgaac tcgccctcgt cgaggcgccg 3000

gtcctggagg ccggcgacac cctggacctc caggtccggg tcggctccgc cgacgaggcc 3060

ggccggcgca ccctcaccgt ccactcccgt cccggcaact cccccgccga gccctggacc 3120

cagcgggccg gcggcctgct cggcaccgcg ccccgcaccg cggcggcccc cgacacctcc 3180

ttcgccgtcg cctggccccc gccgggcgcc gaacccctcg acctcgggga ccactacgag 3240

cggctcgtcg acgacggctt cgacctcggc cccgccttcc gcggtctgcg caccgcctgg 3300

cgccacgacg gcgcgttcct cgccgaggtc gaactcccgg ccggcaccac cgacgacccc 3360

ggcgcctacg gagtgcaccc cgcgctcctc gacgccgccc ggcacgccgc cctcaccacc 3420

accggcacac tcccggtcgc ctggcacggg gtgcggctgc acgccgtcgg cgccaccgcc 3480

ctgcgggtgc ggatccactc cgccgacgac ggtgccctga ccctgaccgc cgccgatgtc 3540

accggcgccc cggtgttcac cgccgaggcc gtcgtcgtac ggcagctcac cgagcaggag 3600

cgcaccgccc cccggccgct cacacgcgcc tggcaccagg acaccgcgac cccgcgccgc 3660

acccggcccg tcgccgcggc ccccggcgcc gccgccgagc cgtccgcctc ctcggcgccg 3720

gacagcttcg ccgccgaggc cgcggccctg gcccccgccg agcgtgaacg ccggctcatc 3780

ggcctggtac ggacccaggc ggcggcggtc ctcggccatc agggcccgga cgcggtcgga 3840

ccccgcgcgg tcttcaagga gctgggcttc gactcgctgg ccggcgtgga actcagtgac 3900

cgcctcaccg cgctcaccgg actgcggctg ccggccaccc tcgtcttcaa cttccccacc 3960

cccgagctcg ccgcccggcg tatcggggaa ctcctcgtcg tatccggctc ctcaccgcag 4020

ggatcgtgcg acgacgaact caccaggttc gaggccgtcg tgcagaccct gtcggccgac 4080

gaccccggac gccaggccgt cgccgaccgc ctggacgcac tcgtcgcctc gctccggcgg 4140

aattccgccc cgcaggagaa cttctccgac gaggacatcg aatcggtgtc ggtcgacaga 4200

ctgctcgaca tcatcgatga agagttcgaa atctcctag 4239

<210> 4

<211> 1737

<212> DNA

<213> Streptomyces nodosus

<400> 4

atggacgctg acgccatcgc ggagggccgc cgacgctggc aggcccgtta tgacgccgca 60

cgcacgcgtg aggcggccgg gggctccgag gcgaaacccc cgaggagctg gacgcgcacc 120

acgctctccg gcgaccccgt ggagcccgtg tacgggcccc ggcccaccga cagctacgag 180

ggcttcgagc ggatcggctg gccgggcgag taccccttca cccgcggtct gtatccgacc 240

ggctaccggg gccggagctg gaccgtccgc cagttcgccg ggttcgggaa cgccgagcag 300

accaatgagc gcttcaaggc gatcctggag gccggcggcg gaggcctgag cgtcgccttc 360

gacatgccga cgctgatggg ccgcgactcc gacgatccgc gctccctggg cgaggtcggg 420

cactgcgggg tggcgatcga ctcggcggcc gacatggagg tcctgttcca ggacatccag 480

ctgggtgagg ttacgacctc gatgacgatc agcggtccgg ccgtccccgt cttctgcatg 540

tatctggtcg ccgccgagcg gcagggcgtc gacccggccg tgctcaacgg cacgctccag 600

accgacatct tcaaggagta catcgcccag aaggagtggc tcttccggcc cgagccgcat 660

ctgcgtctga tcggcgacct gatggagcac tgcacggccg gcatccccgc ctacaagccg 720

ctgtccgtct ccggctacca catccgtgag gcgggcgcga cggccgcaca ggagctggcg 780

tacaccctgg cggacggctt cggatatgtg gagctggggc tcagccgcgg gctcgacgtg 840

gatgtcttcg ccccggggct gtccttcttc ttcgacgcgc atgtcgactt cttcgaggag 900

atcgccaagt tccgggccgc gcgccgcatc tgggcgcgct ggatgcgcga ggtgtacggc 960

gcgcggagcg acaaggcgca gtggctgcgc ttccacaccc agaccgccgg ggtctcgctg 1020

accgcccagc agccgtacaa caacgtggtg cgtacggcgg tggaggcgct ggcggcggtg 1080

ctgggcggga ccaactcgct gcacaccaac gcactggacg agacgctggc gctgccgagc 1140

gaacaggcgg cggagatcgc gctgcgcacc cagcaggtgc tgatggagga gaccggggtc 1200

gcccatgtcg cggacccgct gggcggttcg tggtacgtcg agcagctgac ggaccggatc 1260

gaggcggacg cggagaagat cttcgagcag atcaaggagc ggggactgcg ggcgcatccg 1320

gacggtcggc acccgatcgg cccgatgacc tccggcattc tgcgggggat cgaggacggc 1380

tggttcacgg gcgagatcgc ggagtccgcc ttccgctatc agcaggccct ggagaagggc 1440

gacaagcacg tggtgggcgt caatgtccac accggatcgg tcaccgggga cctggagatc 1500

ctgcgggtcg gccacgaggt ggagcgggag caggtgcggg tgctcgcggc gcgccgggcg 1560

gcgcgggacg agaccgcggt gcgtacggcg ctcgacggca tgctggcggc ggcacgcgac 1620

ggcaccgaca tgatcggccc catgctggac gcggtgcgcg cggaggcgac gctcggcgag 1680

atctgcgggg cgctgcggga cgagtggggg atctacacgg agccgccggg cttctga 1737

<210> 5

<211> 441

<212> DNA

<213> Streptomyces nodosus

<400> 5

atgctgacgc gaatcgacca catcgggatc gcctgcttcg acctggagaa gaccgtcgag 60

ttctacacct cgacctacgg cttctccgtg ttccacaccg agatcaacga ggaacagggc 120

gtccgcgagg ccatgctgaa gatcaatgac acgggcgacg gcggggcctc ctacctccag 180

ctgctggaac ccgtccgcga ggactccgcc gtggcgaagt ggctcgccaa gaacggggag 240

ggcgtacatc acatcgcctt cggcacggcg gacgtcgacg gggacgcgga ggccgtccgg 300

gacaagggcg tgcgcgtgct gtacgacgag ccacgacggg gttccatggg gtcccggatc 360

acctttctgc accccaagga ttgtcacgga gttctcacag aactggtcac atccgcggcc 420

gttgagtcac ctgagcactg a 441

<210> 6

<211> 1227

<212> DNA

<213> Streptomyces nodosus

<400> 6

atgaacgggt ccggcgtccg ggtcgccgtc accgggctgg gcgtcgtcgc ccccaacggc 60

ctgggcgcgg aggcctactg gacggcgacc cgcaagggaa ccagcggcat cggccgcatc 120

tcgcggttcg tccccgacgg gtatccggcc caactggccg gggagatcga gggattcgcc 180

gcggcggagt atctgccggg ccggctgctg ccgcagaccg accggatgac acagctcgcc 240

ctcgtggcag cggactgggc gttcgaggac gccgcggtgc gtcccgggga actgcccgag 300

ttcgagatgg gcgtgatcac ggccagttcc tcgggcggct tcgagttcgg ccagcgggag 360

ttgcaggccc tgtggagcca gggaagccgg tacgtcagcg cgtatcagtc gttcgcctgg 420

ttctacgccg tcaacagcgg ccagatctcc atccgcaacg gcatgcgagg cccgagcggc 480

gtggtcgtca gcgaccaggc cggcggactc gacgcggtcg cccaggcgcg gcgccagatc 540

cgcaagggca cccggctggt gatgtcaggg gccgtggacg cctcgatctg cccctggggc 600

tgggtcgccc agatggcgag caaccggctg agcaccagga ccgacccgga gcgggcgtat 660

ctgcccttcg atgccgcggc gaacggccac gtggccggcg agggcggcgc cctgctcgtc 720

ctggaggaac tggagcaggc ccgagcccgg ggcgcgaagc agatctacgg cgagatcgcc 780

gggtacggct ccacgctcga cccccgcccg ggcagcgagc gtcccgcggg tctgcgcaag 840

gcgatcgaac tggcgctggc cgatgccggg gccacgccgg gcgagatcga cgtggtgttc 900

gccgacgcgg ccgccatccc cgagctggac cggatcgagg ccgcggcgat caacgaggtg 960

ttcggagccg gggcggtgcc ggtgacggcg cccaagacga tgaccgggcg gctctactcg 1020

ggagcggctc ccctggacct ggccgccgcg ttcctcgcca tgcgggacgg ggtgatcccg 1080

ccgtccatcg gcgtcacgcc ctcccccgag cacggcctcg acctggtcgt cgaccaggag 1140

cggaccgcca cagtgcgctc cgccctggtg atcgcccgcg gccacggcgg tttcaactcc 1200

gcaatcgtgg tgcgctccgc cgcatag 1227

Claims

1. Recombinant streptomyces tuberculatus (A) for producing amphotericin BStreptomyces nodosus) And wherein the recombinant Streptomyces nodosus consists of the accession number: CCTCC NO: m2017426 Streptomyces tuberculatus ZJB2016050 knocks out PKS5 gene cluster shown in SEQ ID NO.6, and then introduces acetyl coenzyme A carboxylase 1 gene shown in SEQ ID NO.1, acetyl coenzyme A carboxylase 2 gene shown in SEQ ID NO.2, polyketide synthase PKSamphA gene shown in SEQ ID NO.3, methylmalonyl coenzyme A mutase gene shown in SEQ ID NO.4 and methylmalonyl coenzyme A isomerase gene shown in SEQ ID NO. 5.

2. Use of the recombinant Streptomyces tuberculosus according to claim 1 for the microbial fermentation production of amphotericin B.

3. The use according to claim 2, characterized in that the use is: inoculating the recombinant streptomyces tuberculatus for producing amphotericin B to a fermentation culture medium, carrying out fermentation culture at 25-30 ℃ and 200-500 rpm to obtain fermentation liquor containing amphotericin B, and separating and purifying the fermentation liquor to obtain amphotericin B; the final concentration of the fermentation medium is as follows: 60-80 g/L of glucose, 5-10 g/L of beef extract, 5-10 g/L of soybean protein powder, 8-12 g/L of cotton seed powder and CaCO₃ 5～10g/L，KH₂PO₄0.1-0.4 g/L, water as solvent, and pH 7.0.

4. The use according to claim 3, characterized in that the fermentation is carried out in a fermenter at a pressure of 0.05MPa and an aeration ratio of 0.08 to 1.5 vvm.

5. The application of claim 3, wherein the recombinant streptomyces tuberculatus producing amphotericin B is subjected to seed culture before fermentation culture, and then a seed solution is inoculated to a fermentation medium in an inoculum size of 2-10% by volume concentration, and the seed culture is as follows: inoculating recombinant streptomyces tuberculatus producing amphotericin B to a GYM plate, culturing at 28 ℃ for 7 days, taking gray and black spores, eluting surface spores into sterile water by using a cotton stick, filtering washed spore suspension by using an injector containing cotton, centrifuging at 12000rpm for 5min, removing supernatant, adding sterile water into a precipitate for re-suspension, centrifuging at 12000rpm for 5min, re-eluting once, re-suspending with sterile water to serve as spore suspension, inoculating the spore suspension into a seed culture medium, and culturing at 28 ℃ and 220rpm for 46h to obtain seed liquid; the final concentration of the GYM plate is as follows: 4g/L of glucose, 4g/L of yeast powder, 10g/L of malt extract, 2g/L of calcium carbonate, 18g/L of agar and water as a solvent, wherein the pH value is 7.2; the final concentration of the seed liquid culture medium is as follows: 10-20 g/L of peptone, 5-10 g/L of NaCl, 10-15 g/L of glucose, 5-10 g/L of yeast powder and CaCO₃0.5-1 g/L, water as solvent, and pH 7.0.