CN102719388A - Method for improving yield of streptomyces antibiotics and plasmids thereof - Google Patents

Abstract

The invention discloses a method for improving yield of streptomyces antibiotics in the technical field of bio-medicine. The method comprises the following steps of: constructing corresponding integrated expression plasmids pFMetK, pFVgb, pFAdpA, pFMV, pFMA and pFMVA of metK genes and/or vgbS genes and/or adpA-C genes, and transferring the integrated expression plasmids to streptomyces ZYJ-6 so as to improve the yield. Exogenous genes such as regulatory genes and precursor synthesis genes are simultaneously introduced into antibiotic producing strains to increase the yield of the antibiotics.

Description

Improve the method and the plasmid thereof of yield of streptomycete antibiotic

The present invention by number of patent application is: 201110054035.X; Name of patent application is: " improving the method and the plasmid thereof of yield of streptomycete antibiotic "; Patented claim is artificial: Shanghai Communications University, patented claim day is: the patent on March 8th, 2011 is divided an application.

Technical field

What the present invention relates to is the method and the plasmid thereof in a kind of biological medicine technology field, specifically is a kind of method and plasmid thereof that improves yield of streptomycete antibiotic.

Background technology

Along with cytobiology and biotechnology in the mikrobe especially application in microbiotic breeding field, the genetic engineering breeding technology has become main strain improvement means, and is obtaining great success aspect the improvement industrial production bacterial classification.The biotechnology breeding technique has overcome the randomness and the blindness of traditional breeding technology within the specific limits; Can be by understanding to microbial secondary metabolism biological route of synthesis; Utilize genetic engineering technique to make up the microbiotic superior strain, help the industrial production of secondary metabolite.In microbial strains seed selection field, change goal gene over to recipient cell with carrier then in external the connection through genetic engineering technique, make foreign gene stably express heredity in acceptor.Main path includes: 1. through regulatory gene double or the antibiotic efficient that initiatively effluxes of inactivation, raising waits and improves antibiotic output; 2. in host cell, introduce the foreign gene of the supply that increases precursor and cofactor, improve the biosynthesizing amount of active substance; 3. pass through to activate or suppress the activeconstituents or the ratio of shunt metabolism, improve the accumulation of accumulation, reduction or the elimination low activity secondary component of optimum activity component with the change bioactive molecules.

AdpA is a positive regulating factor of overall importance that extensively is present in the streptomycete, is the center transcriptional regulator of A-factor regulated and control network, can activate form differentiation and the required expression of gene of secondary metabolite.In streptomyces coelicolor, muta lead mycillin, antibiosis streptomycete and Avid kyowamycin, AdpA is just regulating melanic biosynthesizing.Also there be not at present the influence of the expression of bibliographical information adpA gene in the antibiotics generated bacterium strain to its microbiotic output.

Vitreoscilla (Vitreoscilla) is the aerobic thread gram negative bacterium of a kind of obligate, and the oxyphorase of the Vitreoscilla of vgb genes encoding has the transmission that the characteristic that combines oxygen can promote oxygen in the microorganism cells, improves the utilization ratio of oxygen.Under the insufficient situation of dissolved oxygen, Vgb expresses the growth that can promote the host to many, proteic secretion, the generation of metabolite and enhancing crushing resistance.

Vitreoscilla hemoglobin gene is incorporated into can increase recombinant protein output and fermented product output in the heterologous host bacterium.Retrieval through to prior art is found; In production of antibiotics; The vgb gene can obviously promote thalli growth and the synthetic (Wen Ying of microbiotic monensin of Chinese cassia tree ground streptomycete; Song Yuan. the expression of Vitreoscilla hemoglobin in Chinese cassia tree ground streptomycete is to its cell growth and the influence of microbiotic synthetic. biotechnology journal, 2001,17 (1): 24-28).The vgb expression of gene makes the output of Oxacyclotetradecane,erythromycin deriv improve 60% (Brunker among the Saccharopolyspora erythraea; P.Genetic engineering of an industrial strain of Saccharopolyspora erythraea for stable expression of the Vitreoscill hemoglobin gene (vhb) .Microbiology 1998,144 (9): 2441-2448).

S-adenosylmethionine (S-adenosylmethionine is called for short SAM), synthetic by Triphosaden and L-methionine(Met) through SAM synthetic enzyme catalyzed reaction.As the important intermediary metabolism substance in the biosynthetic process, SAM synthase gene metK efficiently expresses the generation that can both effectively improve its metabolite in a lot of streptomycetes.In streptomyces coelicolor; SAM synthase gene metK efficiently expresses output (the Okamoto S that can improve actinorhodin greatly; Lezhava A.Enhanced expression of S-Adenosylmethionine synthetase causes overproduction of actinorhodin in Streptomyces coelicolor A3 (2) .J Bacteriol; 2003,185 (2): 601-609); Heterogenous expression S-adenosylmethionine synthase gene can improve output (the Wang Y of Erythromycin A in Saccharopolyspora erythraea; Wang YG.Improved production of erythromycin A by expression of a heterologous gene encoding S-adenosylmethionine synthetase.Appl Microbiol Biotechnol; 2007,75 (4): 837-842); SAM synthase gene metK's efficiently expresses synthetic (the Zhang XC that has promoted RP-9671 among the Streptomyces actuosus; Fen MQ.Overexpression of yeast S-adenosylmethionine synthetase metK in Streptomyces actuosus leads to increased production of nosiheptide.Appl Microbiol Biotechnol; 2008,78 (6): 991-995).

But above-mentioned prior art only is the expression of term single gene in the certain micro-organisms bacterial strain, and its influence to meta-bolites still is limited, is still very inadequate for whole metabolic engineering.Complicated adjusting mode and specificity thereof in pathways metabolism that microorganism strains self is complicated and the cell cycle; Determined that it still is not enough that directed change is carried out in certain reaction in its metabolism stream; Biochemistry transformation to the microbial metabolism approach can multistep be carried out, and increases the accumulation of meta-bolites to greatest extent.In recent years, because the development of DNA recombinant technology makes that transforming pathways metabolism with gene engineering becomes possibility.The present invention is according to the deficiency of above-mentioned technology; The method and the plasmid of a brand-new raising yield of streptomycete antibiotic have been designed; A plurality of have extensively positive regulating and controlling effect gene constructed synthetic relevant with microbiotic are expressed on a carrier simultaneously; The plasmid that makes up can be expressed in different streptomycete bacterial strains, effectively improves various antibiotic output.

Summary of the invention

The present invention is directed to the above-mentioned deficiency that prior art exists, a kind of method and plasmid thereof that improves yield of streptomycete antibiotic is provided, introducing comprises that foreign genes such as regulatory gene, precursor synthetic gene are to increase antibiotic output simultaneously in the production of antibiotics bacterial strain.

The present invention realizes through following technical scheme:

The present invention relates to a kind of method that improves yield of streptomycete antibiotic; Through making up corresponding integrative gene expression plasmid pFMetK, pFVgb, pFAdpA, pFMV, pFMA and the pFMVA of metK gene and/or vgbS gene and/or adpA-c gene; And described integrative gene expression plasmid changed among the streptomycete ZYJ-6, realize the raising of output.

Described metK gene is meant the S-adenosylmethionine synthase gene, shown in Seq ID No.1;

Described vgbS gene is meant the Vitreoscilla hemoglobin synthetic gene, shown in Seq ID No.2;

Described adpA-c gene is meant the positive regulator gene of overall importance in the streptomycete, shown in Seq ID No.3;

Described structure comprises any one in following six kinds of modes:

1) contain the structure of streptomyces coelicolor metK gene plasmid: among the pcr amplification streptomyces coelicolor M145 not with the metK gene of original promotor; Concrete steps comprise: at the metK of streptomyces coelicolor gene indoor design primer metKF2/metKR, added a NdeI restriction enzyme site at ATG codon place; The EcoRV site of not inserting pBlueScriptII SK (+) with the metK gene of the 1334bp of original promotor of increasing is made up the clone pJTU2524 of 4292bp; With NdeI and EcoRI promoterless metK gene fragment is downcut to be inserted into from pJTU2524 and contain erythromycin resistance gene strong promoter PermE ^*The pIB139 carrier in, obtain plasmid pFMetK.

The sequence of described primer metKF2/metKR is:

metKF2(5’-CAGGGAGC CATATGTCCCGT-3’)；

metKR(5’-TCGCAAAGGCCACTGACAACA-3’)。

2) contain the structure of Vitreoscilla hemoglobin synthetic gene vgbS plasmid: plasmid pJTU4405 contains the synthetic vgbS of full gene, and length 456bp has introduced NdeI and EcoRI restriction enzyme site respectively at gene vgbS two ends.The plasmid pJTU4405 that has Vitreoscilla vgbS gene with NdeI and EcoRI double digestion.VgbS gene (441bp) insertion is contained erythromycin resistance gene strong promoter PermE ^*The corresponding site of streptomycete integrating vector pIB139, obtain plasmid pFVgb.

3) contain the structure of streptomyces coelicolor adpA-c gene plasmid: the adpA-c gene in the pcr amplification streptomyces coelicolor, concrete steps comprise: design primer adpAc2F/adpAc1R has added a NdeI restriction enzyme site at ATG codon place; The adpA-c amplified fragments of 1556bp is inserted into the EcoRV site of pBlueScriptII SK (+), obtains plasmid pJTU2520; With NdeI and EcoRI adpA-c is downcut the corresponding site that is inserted into the plasmid pIB139 that has the Oxacyclotetradecane,erythromycin deriv promotor from pJTU2520 again, obtain plasmid pFAdpA.

The sequence of described primer adpAc2F/adpAc1R is:

adpAc2F(5’-GGCTTAGC CATATGAGCCAC-3’)；

adpAc1R(5’-CGTTCATGCGGGCCACTTTA-3’)。

4) contain the structure of the plasmid pFMV of metK and two genes of vgbS: vgbS is downcut the corresponding restriction enzyme site that inserts pJTU968 from pJTU4405 with NdeI and EcoRI; The vgbS gene fragment that will have an Oxacyclotetradecane,erythromycin deriv strong promoter with MunI and EcoRI again is inserted into the EcoRI site of pFMetK plasmid, obtains plasmid pFMV.

5) contain the structure of the plasmid pFMA of metK and two genes of adpA-c: adpA-c is downcut the corresponding site that is inserted into the plasmid pJTU968 that has the Oxacyclotetradecane,erythromycin deriv promotor from pJTU2520 with NdeI and EcoRI; The adpA-c gene fragment that will have an Oxacyclotetradecane,erythromycin deriv strong promoter with MunI and EcoRI again is inserted into the EcoRI site of pFMetK plasmid, makes up plasmid pFMA.

6) contain the structure of the plasmid pFMVA of metK, vgbS and adpA-c: the adpA-c that will have the Oxacyclotetradecane,erythromycin deriv promotor with MunI and EcoRI downcuts the EcoRI site that is inserted into pFMV from pJTU2522, obtains plasmid pFMVA.

The described carrier pIB139 of step 1) contains erythromycin resistance gene strong promoter PermE ^*The streptomycete integrating vector, be recorded in Wilkinson CJ, Hughes-Thomas ZA, Martin CJ; Bohm I, Mironenko T, Deacon M; Wheatcroft M, Wirtz G, Staunton J; Leadlay PF.Increasing the efficiency of heterologous promoters in actinomycetes.J Mol Microb Biotech, 2002,4 (4): 417-426.The carrier pIB139 that present embodiment relates to is given by doctor Zhu Dongqing.

Step 2) the plasmid pJTU4405 described in is given by doctor Zhu Dongqing; Prepare in the following manner: change the vgb gene codon that frequency of utilization is not high in streptomycete in the streptomycete the highest codon of frequency of utilization; Keep aminoacid sequence constant, produce new gene vgbS.Introduce the restriction enzyme site of NdeI and EcoRI respectively at gene vgbS two ends; Wherein 5 ' end at the vgbS nucleotide sequence adds 7 Nucleotide; Form restriction enzyme NdeI site and protection base; 3 ' end at the vgbS nucleotide sequence adds 8 Nucleotide, forms restriction enzyme EcoRI site and protection base.The full gene of vgbS is synthetic, total length 456bp.The DNA of the vgbS of synthetic 456bp is inserted in the SmaI site of carrier pGH, produces plasmid pJTU4405, and the order-checking proof is synthetic errorless.Wherein gene complete synthesis, insert carrier, sequence verification is accomplished by Shanghai Mei Ji Bioisystech Co., Ltd.

Described changing over to is meant: the plasmid that makes up is changed among the intestinal bacteria ET12567/pUZ8002; Be placed on the culture medium flat plate through the water-bath heat shock and cultivate; Concrete steps comprise: the plasmid that makes up is changed among the intestinal bacteria ET12567/pUZ8002 and chooses transformant and in liquid LB substratum, cultivate the intestinal bacteria ET12567/pUZ8002 that carries transferring plasmid; Having final concentration in this liquid LB substratum is the paraxin of 25 μ g/ μ L, the apramycin of the kantlex of 50 μ g/ μ L and 30 μ g/ μ L.Cultivate after 8 hours for 37 ℃ and collect thalline, it is subsequent use to wash thalline 3 times with fresh LB substratum.The streptomycete spore is suspended in the 5ml TES damping fluid, and this buffer concentration is 0.05mol/L, and the pH value is 8.0.Heat shock 10min in 55 ℃ of water-baths then, be cooled to room temperature after, by 10 ⁸: 10 ⁸Be coated in after the Bacillus coli cells balanced mix on the SFM culture medium flat plate; This culture medium flat plate component is: 2% agarose (m/v), 2% N.F,USP MANNITOL (m/v), 2% soybean cake powder (m/v); Culture plate pH value is 7.2～7.5, is placed on after drying up in 30 ℃ of incubators to cultivate.Cover flat board with the 1ml sterilized water that contains nalidixic acid and apramycin after 12 hours, the final concentration of nalidixic acid is 50ng/mL on the flat board, and apramycin is 30ng/mL, puts 30 ℃ of cultivations and can see transconjugant after 3 days.

Described intestinal bacteria ET12567/pUZ8002 is disclosed in Paget, M.S., Chamberlin; L., Atrih, A.; Foster, S.J., and Buttner; M.J..Evidence that the extracytoplasmic function sigma factor σ E is required for normal cell wall structure in Streptomyces coelicolor A3 (2) .J.Bacteriol, 1999,181:204-211.

Described streptomycete ZYJ-6 is meant: produce the mutant strain of candicidin D single component, prepare in the following manner:

(1) confirms the catalytic activity site of domain KR21 (being present in polyketide synthase FscF) and DH18 (being present in polyketide synthase FscE).

(2) design and make up is respectively applied for homologous recombination vector pJTU573 and the pJTU572 that the catalytic activity site to KR21 and DH18 suddenlys change.

(3) change pJTU573 over to streptomycete FR-008 through conjugal transfer and carry out homologous recombination.

(4), and then choose the KR21 mutant strain through PCR and to the method finishing screen that PCR product enzyme is cut checking and sequence verification at first through thiostrepton resistance replica screening.

(5) same quadrat method changes pJTU572 over to the KR21 mutant strain and carries out homologous recombination, and finishing screen is chosen KR21 and DH18 double-mutant strain ZYJ-6.

The orientation that the present invention relates to is produced the single component FR-008-III of candicidin, and its output is the 120-130% of this component output of wild type strain, and FR-008-III is the composition of tool pharmaceutical use in 3 main ingredients of candicidin.Can the highly purified candicidin active princlple of scale operation through engineering bacillus, so have significant industrial application value.

The engineering strain of the single component FR-008-III of orientation accumulation candicidin that the present invention relates to, double-mutant strain ZYJ-6 wherein is disclosed in Zhou YJ, Li JL; Zhu J, Chen S, Bai LQ; Zhou XF, Wu HM, Deng ZX.Incomplete β-Ketone Processing as a Mechanism for Polyene Structural Variation in the FR-008/Candicidin Complex.Chemistry & Biology; 2008,15:629-638.

Described double-mutant strain ZYJ-6 (streptomycete Streptomyces sp.) has submitted on March 7th, 2008 and has been positioned at the Datun Road, Chaoyang District, Beijing City; Postcode: the common micro-organisms center C GMCC of China Committee for Culture Collection of Microorganisms of 100101 (Chinese institutes of microbiology), its preservation accession designation number is CGMCC NO.2394.

The invention provides a kind of method and plasmid that improves yield of streptomycete antibiotic; Take the mode on a carrier, expressed simultaneously through 3 genes that antibiotic biosynthesizing had extensive promoter action, utilize conjugal transfer to change over to and efficiently express in the streptomycete to improve antibiotic output.

Description of drawings

Fig. 1 is the design of graphics of expression plasmid.

Fig. 2 is bacterial strain ZYJ-6/pFMetK, ZYJ-6/pFMV, ZYJ-6/pFMA, the PCR of metK gene checking among the ZYJ-6/pFMVA.

Fig. 3 is bacterial strain ZYJ-6/pFVgb, ZYJ-6/pFMV, the PCR of vgbS gene checking in the ZYJ-6/pFMVA bacterial strain.

Fig. 4 is bacterial strain ZYJ-6/pFAdpA, ZYJ-6/pFMA, the PCR of adpA-c gene checking among the ZYJ-6/pFMVA.

Fig. 5 is spectrophotometric analysis bacterial strain ZYJ-6 and ZYJ-6/pFMetK, ZYJ-6/pFVgb, and ZYJ-6/pFAdpA, ZYJ-6/pFMV, ZYJ-6/pFMA, candicidin FR-008-III is in the change of production of different incubation times among the ZYJ-6/pFMVA.

Fig. 6 is the change of production of candicidin FR-008-III among quantitative analysis starting strain ZYJ-6 and the superior strain ZYJ-6/pFMVA.

Embodiment

Elaborate in the face of embodiments of the invention down, present embodiment provided detailed embodiment and concrete operating process, but protection scope of the present invention is not limited to following embodiment being to implement under the prerequisite with technical scheme of the present invention.

Embodiment 1 preparation produces the mutant strain of candicidin D single component

(1) structure of plasmid (be used to change over to the host and with karyomit(e) generation homologous recombination in case the acquisition targeted mutagenesis)

(1) be used for the plasmid construction that the KR21 domain suddenlys change:

Reclaim 3615-bp EcoRI-KpnIDNA fragment behind EcoRI and the KpnI enzymolysis streptomycete FR-008 library coemid pHZ220 as pcr template, primer P1 and the P3 528-bp dna fragmentation that is used for increasing; P4 and the P2 618-bpDNA fragment that is used for increasing.P3 and P4 have the overlapping of 18-bp, introduce mutational site (Y1526F) in this overlapping region, introduce DNA restriction enzyme site (ApoI) simultaneously so that the screening of this sudden change (as shown in Figure 1).Through the second time PCR (primer is P1 and P2; Template is that two PCR products after agarose gel reclaims are respectively got 1/100 and added the PCR system) obtain the 1146-bp dna fragmentation.The 1146-bp dna fragmentation is cloned in T-vector (obtaining plasmid pJTU566) and upward and after confirming correctly through order-checking is become 849-bp SacI-SfiI dna fragmentation by enzymolysis again.849-bp SacI-SfiI dna fragmentation is used to replace 3615-bp EcoRI-KpnIDNA fragment (obtain by reclaiming behind the EcoRI-KpnI enzymolysis pHZ220, and be cloned on the pIJ2925 carrier and obtain plasmid pJTU569) thereby inner corresponding zone obtains plasmid pJTU571.3615-bp EcoRI-KpnI dna fragmentation after the reorganization has comprised targeted mutagenesis site and two arms (being respectively: 1948-bp and 1667-bp) with the exchange of karyomit(e) generation homology that are used for that are distributed in the both sides, mutational site.This 3615-bp DNA recombinant fragment finally is cloned in pHZ1358 (intestinal bacteria-streptomycete shuttle plasmid) BamHI site, thereby obtains being used for the plasmid pJTU573 with karyomit(e) generation homologous recombination.

The PCR reaction:

Primer:

P1，5′-CCGCCTCACCCAACTGCC-3′

P3，5′-GCGACGAAATTTGCCTGGCCG-3′

P4，5′-CCA?GGCAAATTTCGTCGCCGC-3′

P2,5 '-GGGGAG CCGCTGTCGTAGA-3 ' (underscore represent introduce restriction enzyme site ApoI)

The PCR reaction system: 0.1 μ g template DNA, each 50pmol of primer, 4 μ LDMSO, 2 μ LMg2+,

5 μ L dNTP, 5 μ L damping fluids and 1 unit K OD archaeal dna polymerase (TOYOTA) add pure water to 50 μ L.The cycling condition of PCR reaction is: 95 ℃ (5 minutes); 32 95 ℃ of round-robin (30 seconds), 60 ℃ (30 seconds) and 68 ℃ (36 seconds); Be at last 68 ℃ 5 minutes.(annotate: primer is that to take turns the PCR extension time be 66 seconds to second of P1 and P2).

The condition that PCR product end adds A (so that being cloned in T-Vector) base is: 50 μ g PCR products, 5 μ L dATP, 2 TagDNA of unit polysaccharases, 5 μ L damping fluids, 2 μ LMg ²⁺, added pure water to 50 μ L.72 ℃ 20 minutes.

(2) be used for the plasmid construction that the DH18 domain suddenlys change:

Two homology exchange arms that are used for DH18 domain avtive spot corresponding encoded base mutation are obtained by pcr amplification respectively.Pcr template is the DNA of streptomycete FR-008 library coemid pHZ220.Amplification 1475-bp dna fragmentation the primer is: DH18P1 and DH18P2; Amplification 1203-bp dna fragmentation the primer is: DH18P3 and DH18P4.Introduce through primer DH18P2 and DH18P3 respectively in the mutational site, introduces restriction enzyme site BsrGI again so that screen mutation (as shown in Figure 1) simultaneously.1475-bp PCR product obtains plasmid pJTU568 after inserting pBluescript II SK (+) EcoRV site, and has carried out sequence verification.1203-bp PCR product cloning and has been carried out sequence verification on T-Vector and obtain plasmid pJTU565.After being inserted into the corresponding site of pJTU568, the 1.2kb BsrGI-KpnI dna fragmentation that obtains from the pJTU565 enzymolysis obtains plasmid pJTU570; Thereby make two homology exchange arms splice in the BsrGI site. this 2.6kb recombinant fragment is cut out from pJTU570 by BamHI again, and then is inserted into pHZ1358 carrier B amHI site again and obtains homologous recombination plasmid pJTU572.

The PCR primer:

DH18P1，5′-GACACGGAGTCCCCCGAGCCCCAGG-3′

DH18P2，5′-CCG?ACGGTGTACACGGCGAGCCAGG-3′

DH18P3，5′-CCTGGCTCGCCGTGTACACCGTCGG-3′

DH18P4,5 '-CGCCCGAGAGCGGACCGAGGAGTTG-3 ' (underscore represent introduce restriction enzyme site BsrGI)

The PCR condition:

1475-bp PCR product (primer is: DH18P1 and DH18P2) is increased by KOD archaeal dna polymerase (TOYOTA).The PCR reaction system is the same.The cycling condition of PCR reaction is: 95 ℃ (5 minutes); 32 95 ℃ of round-robin (30 seconds), 57 ℃ (30 seconds) and 68 ℃ (90 seconds); Be at last 68 ℃ 5 minutes.

1203-bp PCR product (primer is: DH18P3 and DH18P4) is increased by the Tag archaeal dna polymerase.PCR condition: PCR reaction system: 0.1 μ g template DNA, each 40pmol of primer, 3 μ L DMSO, 2 μ L Mg2+, 3 μ L dNTP, 4 μ L damping fluids and 1 Tag of unit archaeal dna polymerase add pure water to 40 μ L.The cycling condition of PCR reaction is: 95 ℃ (5 minutes); 32 95 ℃ of round-robin (30 seconds), 60 ℃ (30 seconds) and 72 ℃ (20 seconds); Be at last 72 ℃ 5 minutes.

(2) change the plasmid that is used for karyomit(e) generation homologous recombination over to the wild-type host:

Change over to respectively among the intestinal bacteria ET12567 (carrying conjugal transfer helper plasmid pUZ8002) through the electric handle pHZ1358 plasmid (pJTU572 or pJTU573) of deriving; So that pJTU572 or pJTU573 in the assistance of helper plasmid pUZ8002, get in the receptor chain mould FR-008 cell through conjugal transfer.The intestinal bacteria that earlier pUZ8002 and plasmid to be transferred are carried in cultivation under suitable microbiotic were collected thalline after 12 hours, and it is subsequent use to wash thalline 3 times with fresh LB substratum.Streptomycete spore as acceptor needs to handle with sprouting in advance through heat shock.With the streptomycete spore be suspended in the TES damping fluid (5ml0.05mol/L, pH8.0) in, heat shock 5min in 50 ℃ of water-baths is cooled to and adds the preparatory germination medium of equal-volume 2 * spore (Difco yeast powder 1%, Difco casamino acids 1%, CaCl after the room temperature ₂0.01mol/L); 37 ℃ of shaking tables (250rpm) are cultivated 2h, and centrifugal collection spore also evenly is suspended in an amount of LB substratum again, are coated in culture plate (2% agarose by after 108: 108 and the Bacillus coli cells balanced mix; 2% N.F,USP MANNITOL; 2% soybean cake powder, pH7.2～7.5) on, carry out bacterium parents conjugal transfer.Cover dull and stereotyped (final concentration: nalidixic acid 50ng/mL with the 1ml sterilized water that contains nalidixic acid (suppressing colibacillary growth) and thiostrepton (change plasmid over to and have this resistance) after 11 hours; Thiostrepton 25ng/mL), put 30 ℃ of cultivations and can see transconjugant after 3 days.

(3) screening mutant strains and checking:

Select single conjugal transfer from wrapper plate and be inoculated into further affirmation resistance on resistance (thiostrepton) flat board; Be transferred to the cultivation that relaxes on the flat board of added with antibiotic (thiostrepton) not again, so through resistant panel and the non-anti-dull and stereotyped experiment screening of xeroxing to the responsive bacterial strain (the alternative strain of mutant strain) of some thiostreptons.Prepare against the total DNA of roguing as pcr template; Primer P1 and P4 are used for the screening of KR21 sudden change, and the PCR product that 1146-bp stems from mutant strain KR21 sudden change can be 528-bp and 618-bp dna fragmentation by the ApoI enzymolysis, can not be by the ApoI enzymolysis and stem from the onesize PCR product of wild-type; Primer DH-test-L and DH-test-R are used for the screening of DH18 sudden change, and the PCR product that 706-bp stems from the DH18 sudden change can be 244-bp and 462-bp dna fragmentation by the BsrGI enzymolysis, can not be by the BsrGI enzymolysis and stem from the PCR product of wild-type.The PCR product that stems from KR21 sudden change and DH18 sudden change is cloned in respectively carries out sequence verification on the T-Vector, thereby has finally proved conclusively the exactness of targeted mutagenesis.

KR21 mutant strain PCR screening conditions:

Primer: P1 and P4.

The PCR reaction system: 0.05 μ g template DNA, each 20pmol of primer, 1 μ L DMSO, 1 μ L Mg2+,

2 μ L dNTP, 2 μ L damping fluids and 0.5 Tag of unit archaeal dna polymerase add pure water to 20 μ L.The cycling condition of PCR reaction is: 95 ℃ (5 minutes); 32 95 ℃ of round-robin (30 seconds), 60 ℃ (30 seconds) and 72 ℃ (22 seconds); Be at last 72 ℃ 5 minutes.

DH18 mutant strain PCR screening conditions:

Primer: DH-test-L, 5 '-GCTCTACCGTCCGCTTCGCC-3 '

DH-test-R，5′-CTGTGTCCAGGTGGCGTCCG-3′

The PCR reaction conditions: 64 ℃ of renaturation, to extend 15 seconds. all the other screen with the KR21 mutant strain.

(4) acquisition of double-mutant strain (ZYJ-6)

Change homologous recombination plasmid pJTU573 in the streptomycete FR-008 cell over to through conjugal transfer earlier homologous recombination takes place, screen and obtain the KR21 mutant strain.Change plasmid pJTU572 in the KR21 mutant strain cell over to and through homologous recombination DH18 is suddenlyd change, final screening obtains KR21 and the two mutant strain ZYJ-6 of DH18.

(5) fermentation culture of mutant strain

Dull and stereotyped fermentation [2% agarose, 2% N.F,USP MANNITOL, 2% soybean cake powder (boil boil after-filtration remove slag), pH7.2～7.5], spore inoculating, 30 ℃, 6 days.

(6) separation of antibiotics purifying:

Scrape the plate spore of making even, after the weighing with 10 times of volumes methanol ultrasonic extractions 3 times.Heavily be dissolved in little volume methyl alcohol behind 40 ℃ of rotations of combining extraction liquid evaporate to dryness ,-20 ℃ keep in Dark Place in order to detecting behind the 0.25uM membrane filtration.

(7) LC-MS detects tunning:

HPLC-mass spectrometry (LC-MS) detected result shows that mutant strain ZYJ-6 only produces FR-008-III (Candicidin D), and no longer accumulates original component: FR-008-V and FR-008-VI.The HPLC detected result is as shown in Figure 2.

LC-MS carries out on the Agilent of Agilent company 1100series LC/MSD Trap system.The high-pressure liquid phase working conditions is: pillar (agilent Eclipse XDB-C18,4.6 * 250mm); Flow velocity 0.6ml/min; Moving phase: the warm and fine 55%5.5mM NH4AC of 45% second (pH 4.5); Detect wavelength: 380nm; Column temperature: 25 ℃.

Mass spectrum working conditions: negative ion mode; Drying air stream: 10l/min; Atomizer pressure: 50psi; Dry temperature: 350 ℃; Bombarding voltage: 1.0-1.8V.

Embodiment 2

Change homologous recombination plasmid pJTU572 in the streptomycete FR-008 cell over to through conjugal transfer earlier homologous recombination takes place, screen and obtain the DH18 mutant strain.Change plasmid pJTU573 in the DH18 mutant strain cell over to and through homologous recombination KR21 is suddenlyd change, final screening obtains KR21 and the two mutant strain ZYJ-6 of DH18.

The raising of embodiment 3 yield of streptomycete antibiotic

Step 1, the structure of expression plasmid.

The expression vector pIB139 that present embodiment relates to is one and contains erythromycin resistance gene strong promoter PermE ^*The streptomycete integrating vector, can get into streptomycete through two parent's conjugal transfers between intestinal bacteria and the streptomycete, take place to be incorporated on the karyomit(e) of streptomycete after the locus specificity reorganization, along with karyomit(e) duplicates and heredity together.Fig. 1 all expression plasmid design of graphics for relating in the present embodiment.

Step 2 changes plasmid over to the screening and the checking of streptomycete host and conjugal transfer

The plasmid that makes up is changed among the intestinal bacteria ET12567/pUZ8002; Choose transformant and in liquid LB substratum, cultivate the intestinal bacteria ET12567/pUZ8002 that carries transferring plasmid; Having final concentration in this liquid LB substratum is the paraxin of 25 μ g/ μ L, the apramycin of the kantlex of 50 μ g/ μ L and 30 μ g/ μ L.Cultivate after 8 hours for 37 ℃ and collect thalline, it is subsequent use to wash thalline 3 times with fresh LB substratum.The streptomycete spore is suspended in the 5ml TES damping fluid, and this buffer concentration is 0.05mol/L, and the pH value is 8.0.Heat shock 10min in 55 ℃ of water-baths then, be cooled to room temperature after, by 10 ⁸: 10 ⁸Be coated in after the Bacillus coli cells balanced mix on the SFM culture medium flat plate; This culture medium flat plate component is: 2% agarose (m/v), 2% N.F,USP MANNITOL (m/v), 2% soybean cake powder (m/v); Culture plate pH value is 7.2～7.5, is placed on after drying up in 30 ℃ of incubators to cultivate.Cover flat board with the 1ml sterilized water that contains nalidixic acid and apramycin after 12 hours, the final concentration of nalidixic acid is 50ng/mL on the flat board, and apramycin is 30ng/mL, puts 30 ℃ of cultivations and can see transconjugant after 3 days.

Select single conjugal transfer from wrapper plate and be inoculated into further affirmation resistance on the apramycin resistant panel.With total DNA of alternative bacterial strain as pcr template, pFMetK, pFMA; PFMV contains the metK gene in four plasmids of pFMVA, and plasmid is through transforming the ZYJ-6/pFMetK that obtains; ZYJ-6/pFMV; The primer that ZYJ-6/pFMA, ZYJ-6/pFMVA bacterial strain use the PCR checking to use is metKTF/metKTR, and the PCR product is the 986bp (see figure 2).1 is marker among Fig. 2, and 2,3,4,5 are respectively bacterial strain ZYJ-6/pFMetK, and ZYJ-6/pFMV, ZYJ-6/pFMA, the karyomit(e) of ZYJ-6/pFMVA are that template can increase and obtains the 986bp amplified band.PFVgb, pFMV contains the vgbS gene in three plasmids of pFMVA, and plasmid is through transforming the ZYJ-6/pFVgb that obtains, and the primer that ZYJ-6/pFMV, ZYJ-6/pFMVA bacterial strain use the PCR checking to use is vgbTF/vgbTR, and the PCR product is the 436bp (see figure 3).1 is marker among Fig. 3, and 2,3,4 are respectively bacterial strain ZYJ-6/pFVgb, and ZYJ-6/pFMV, the karyomit(e) of ZYJ-6/pFMVA are that template can increase and obtains the 436bp amplified band.PFAdpA, pFMA contains the adpA gene in three plasmids of pFMVA, and plasmid is through transforming the ZYJ-6/pFAdpA that obtains, and the primer that ZYJ-6/pFMA, ZYJ6-/pFMVA bacterial strain use the PCR checking to use is adpATF/adpATR, and the PCR product is the 620bp (see figure 4).1 is marker among Fig. 4, and 2,3,4 are respectively bacterial strain ZYJ-6/pFAdpA, and ZYJ-6/pFMA, the karyomit(e) of ZYJ-6/pFMVA are that template can increase and obtains the 620bp amplified band.

Primer sequence:

metKTF：5′GAACAGACCCACGGGCTCGG 3′

metKTR：5′TGTCCCGTCGCCTGTTCACC 3′

vgbTF：5′GTGGACCAGCAGACCATCAA?3′

vgbTR：5′ACTCGACCGCCTGGGCGTAC?3′

adpATF：5′CGCAGGGACTGGAGGCGATC?3′

adpATR：5′CACCCGCTGGGTGATCAGCC?3′

The PCR reaction system: 0.1 μ g template DNA, each 50pmol of primer, 4 μ L DMSO, 4 μ L dNTP, 5 μ L PCR damping fluids and 1 Tag of unit archaeal dna polymerase, this polysaccharase is Japanese TOYOBO Company products, adds pure water to 50 μ L.The cycling condition of PCR reaction is: 94 ℃, and 5min; 94 ℃, 30s; 57 ℃, 30s; 72 ℃, 80s (30 circulations); 72 ℃ are extended 5min, and 4 ℃ are finished reaction.

Step 3, strain fermentation and antibiotic extraction and detection.

With the ZYJ-6/pFMetK of starting strain ZYJ-6 and acquisition, ZYJ-6/pFVgb, ZYJ-6/pFAdpA, ZYJ-6/pFMV, ZYJ-6/pFMA, six bacterial strains of ZYJ-6/pFMVA carry out liquid fermenting and microbiotic successively and detect.With bacterial strain ZYJ-6 as the host, with the output of FR-008III component as examination criteria.

At first, cultivated 3 days for 30 ℃ bacterial strain activation on the SFM flat board.Be seeded in then among the 25ml liquid nutrient medium TSBY (10.3% sucrose), wherein the preparation method of liquid nutrient medium TSBY is: Tryptones (TSB) 30g, and Difco yeast powder 5g, sucrose 340g (34%) or 103g (10.3%) are settled to 1000ml, the packing sterilization.30 ℃ of shaking tables were cultivated 24 hours, and sampling is centrifugal, receives thalline, and dry weight is claimed in oven dry, confirms the difference of cell density between each bacterial classification, adjusts to unanimity.Be inoculated among the 50ml liquid nutrient medium YEME by about 1/100 volume ratio, 30 ℃ of shaking tables were cultivated 84 hours.Wherein the preparation method of liquid nutrient medium YEME is: get Difco yeast powder 3g, and Difco peptone 5g, Oxoid malt meal 3g, sucrose 103g, glucose 10g is settled to 1000ml then, sterilizes, and adds the aseptic 2.5M MgCl of 2ml before the use ₂6H ₂O solution.

Get fermented liquid in the different culture time and carry out antibiotic extraction and detection.Respectively at 36h, 48h, 60h; 72h and 84h get fermented liquid; The propyl carbinol that adds 2 times of volumes then, oscillation extraction, centrifuging and taking supernatant; Triplicate; Microbiotic in the bacterium liquid is extracted, combining extraction liquid, at wavelength 380nm place with spectrophotometer detects

; Simultaneously with antibiotic mutant strain HJ-5 (the Yirong Zhang of not producing of streptomycete FR-008; Linquan Bai and Zixin Deng.Functional characterization of the first two actinomycete 4-amino-4-deoxychorismate lyase genes.Microbiology, 2009, fermented liquid 155:2450-2459) is as blank.The experiment triplicate.

Fig. 5 is six bacterial strain ZYJ-6/pFMetK of bacterial strain ZYJ-6 and structure, ZYJ-6/pFVgb, ZYJ-6/pFAdpA, ZYJ-6/pFMV, ZYJ-6/pFMA, the volume analysis of the candicidin that ZYJ-6/pFMVA produces.Six bacterial strains carry out parallel fermentation simultaneously with starting strain and detect, and the result shows that the first five bacterial strain makes the output of candicidin improve 90% (pFMetK), 130% (pFVgb), 80% (pFAdpA), 130% (pFMV), 150% (pFMA) (see figure 5) successively; The expression of integrative plasmid pFMVA in ZYJ-6 that Fig. 6 representes three genes output of candicidin the most at last improved 2.1 times, and output is brought up to 1301ug/ml (ZYJ-6/pFMVA) from 424ug/ml (ZYJ-6).

Claims (10)

1. a method that improves yield of streptomycete antibiotic is characterized in that, through making up the integrative gene expression plasmid pFAdpA of adpA-c gene, and described integrative gene expression plasmid is changed among the streptomycete ZYJ-6, realizes the raising of output.

2. the method for raising yield of streptomycete antibiotic according to claim 1 is characterized in that, described adpA-c gene is meant the positive regulator gene of overall importance in the mould, shown in Seq ID No.3.

3. the method for raising yield of streptomycete antibiotic according to claim 1 is characterized in that, described structure comprises: the structure that contains streptomyces coelicolor adpA-c gene plasmid.

4. the method for raising yield of streptomycete antibiotic according to claim 1 is characterized in that, described changing over to is meant: the plasmid that makes up is changed among the intestinal bacteria ET12567/pUZ8002, be placed on the culture medium flat plate through the water-bath heat shock and cultivate.

5. according to the method for claim 1 or 4 described raising yield of streptomycete antibiotic, it is characterized in that described changing over to is meant:

1) changes over to the plasmid that makes up among the intestinal bacteria ET12567/pUZ8002 and choose transformant and in liquid LB substratum, cultivate the intestinal bacteria ET12567/pUZ8002 that carries transferring plasmid; Having final concentration in this liquid LB substratum is the paraxin of 25 μ g/ μ L; The apramycin of the kantlex of 50 μ g/ μ L and 30 μ g/ μ L; Cultivate after 8 hours for 37 ℃ and collect thalline, it is subsequent use to wash thalline 3 times with fresh LB substratum, and the streptomycete spore is suspended in the 5ml TES damping fluid; This buffer concentration is 0.05mol/L, and the pH value is 8.0;

2) heat shock 10min in 55 ℃ of water-baths then, be cooled to room temperature after, by 10 ⁸: 10 ⁸Be coated in after the Bacillus coli cells balanced mix on the SFM culture medium flat plate; This culture medium flat plate component is: 2% agarose (m/v), 2% N.F,USP MANNITOL (m/v), 2% soybean cake powder (m/v); Culture plate pH value is 7.2～7.5, is placed on after drying up in 30 ℃ of incubators to cultivate 12 hours;

3) cover flat board with the 1ml sterilized water that contains nalidixic acid and apramycin, the final concentration of nalidixic acid is 50ng/mL on the flat board, and apramycin is 30ng/mL, puts 30 ℃ of cultivations and can see transconjugant after 3 days.

6. according to the method for claim 1 or 3 described raising yield of streptomycete antibiotic; It is characterized in that; Described structure is meant: the adpA-c gene in the pcr amplification streptomyces coelicolor; Concrete steps comprise: design primer adpAc2F/adpAc1R has added a NdeI restriction enzyme site at ATG codon place; The adpA-c amplified fragments of 1556bp is inserted into the EcoRV site of pBlueScriptIISK (+), obtains plasmid pJTU2520; With NdeI and EcoRI adpA-c is downcut the corresponding site that is inserted into the plasmid pIB139 that has the Oxacyclotetradecane,erythromycin deriv promotor from pJTU2520 again, obtain plasmid pFAdpA.

7. the method for raising yield of streptomycete antibiotic according to claim 6 is characterized in that, the sequence of described primer adpAc2F/adpAc1R is:

adpAc2F(5’-GGCTTAGC CATATGAGCCAC-3’)；

adpAc1R?(5’-CGTTCATGCGGGCCACTTTA-3’)。

8. the method for raising yield of streptomycete antibiotic according to claim 1 is characterized in that, described streptomycete ZYJ-6 is meant: the mutant strain that produces candicidin D single component.

9. according to the method for claim 1 or 8 described raising yield of streptomycete antibiotic, it is characterized in that described streptomycete ZYJ-6 prepares in the following manner:

(1) the catalytic activity site of confirming to be present in the domain KR21 of polyketide synthase FscF and being present in the DH1 of polyketide synthase FscE;

(2) design and make up is respectively applied for homologous recombination vector pJTU573 and the pJTU572 that the catalytic activity site to KR21 and DH18 suddenlys change;

(3) change pJTU573 over to streptomycete FR-008 through conjugal transfer and carry out homologous recombination;

(4), and then choose the KR21 mutant strain through PCR and to the method finishing screen that PCR product enzyme is cut checking and sequence verification at first through thiostrepton resistance replica screening;

(5) same quadrat method changes pJTU572 over to the KR21 mutant strain and carries out homologous recombination, and finishing screen is chosen KR21 and DH18 double-mutant strain ZYJ-6.

10. according to the method for the described raising yield of streptomycete antibiotic of above-mentioned arbitrary claim, it is characterized in that said streptomycete ZYJ-6 is preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center, the preservation accession designation number is CGMCC NO.2394.

Images