CN105316383B - A method of improving the oxytetracycline yield of streptomycete by gene disruption - Google Patents

Abstract

The present invention relates to a kind of methods for the oxytetracycline yield improving streptomycete by gene disruption.It discloses for the first time in terramycin produces bacterial strain, after lowering lsigB genes, the oxytetracycline yield of terramycin production bacterial strain can be significantly increased, the terramycin synthetic quantity of unit thalline can be improved 20% or more.The present invention produces strain improvement for terramycin and provides a new way.

Description

A method of improving the oxytetracycline yield of streptomycete by gene disruption

Technical field

The present invention relates to biotechnologies, more particularly it relates to which one kind improving streptomycete by gene disruption Oxytetracycline yield method.

Background technology

The life cycle of streptomycete is very complicated, can generate a variety of secondary metabolites.These natural products are new drug It was found that providing abundant precursor resource.Until nineteen ninety-five, by the secondary with antibiotic activity obtained in streptomycete There are about 7000 kinds for metabolite.The antibiotic that streptomycete generates is used widely in medicine and life science.Strepto- Bacterium all has weight with its distinctive Development And Differentiation feature and powerful cometabolism ability in terms of basic research and commercial Application Want status.The synthesis of antibiotic is related to a large amount of regulatory factors, these regulatory factors are by regulating and controlling in antibiotic route of synthesis The expression quantity of related gene has regulated and controled the yield of antibiotic.This is further using these regulatory factors as target spot progress base Because of transformation, antibiotic enhanced variant is obtained, to realize that the raising of antibiotic yield provides willing energy.

Streptomyces rimosus (Streptomyce rimosus) is the commercialization of terramycin (oxytetracycline, OTC) Produce bacterial strain.Terramycin belongs to Tetracyclines broad-spectrum antibiotic, can inhibit former to gram positive bacteria, negative bacterium, mycoplasma, clothing It is infected caused by body, Richettsia etc., simultaneously can be used for treatment piroplasmosis, eperythrozoonosis.Its mechanism of action is soil Mycin can be combined reversibly with 30S ribosomal subunits, to inhibit the formation of aminoacyl tRNA ribose composite, be pressed down in this way The breeding of bacterium is made.Therefore researcher constantly studies S.rimosus using molecular engineering, is changed using recombinant technique It makes bacterial strain performance, improve antibiotic yield, or non-natural antibiotics are synthetically produced as skeleton.However, in order to improve The yield of terramycin, this field there is a need to the method that further research improves oxytetracycline yield.

The biosynthesis gene of the secondary metabolite of streptomycete is frequently located in same gene cluster, includes often in gene cluster One or more approach specific regulatory control genes, they generally regulate and control a kind of antibiotic or several with the synthesis of certain common biologicals The biosynthesis of the antibiotic of approach.The regulation and control of antibiotic biological synthesis gene cluster are by the transcription regulator positioned at gene cluster (CSR) regulated and controled on transcriptional level, usually there is single transcription regulator regulation and control and the regulation and control of more transcription regulators.

But it is sufficiently complex in view of the cometabolism regulated and control network of streptomycete, navigate to has oxytetracycline yield really It the gene of regulating and controlling effect and adjusts the expression of the gene and does not cause the gene of significant impact to be still streptomycete own growth Difficult.

Invention content

The purpose of the present invention is to provide a kind of methods for the oxytetracycline yield improving streptomycete by gene disruption.

In the first aspect of the present invention, a kind of method producing terramycin is provided, the method includes：

(1) in terramycin produces bacterial strain, the expression of lsigB genes (class sigB genes, like-sigB) is lowered；

(2) bacterial strain prepared by incubation step (1), to produce terramycin.

In a preference, by blocking (be preferably inserted into and block) or lsigB genes are knocked out, it is mould to lower soil The expression of lsigB genes in element production bacterial strain.

In another preferred example, lsigB gene locations are inserted into foreign gene in terramycin produces bacterial strain, to block LsigB genes (preferably, being inserted into foreign gene in 181-680 sections in the gene).

In another preferred example, the foreign gene includes the subelement in pKC1139 plasmids, such as ori T, Ori pSG5、Apr。

In another preferred example, the blocking lsigB genetic methods include：Expression vector, the expression vector are provided In the partial sequence (preferably 181-680 bit sequences) comprising lsigB genes, expression vector is converted into streptomyces rimosus, The recombination streptomyces rimosus of exogenous gene sequence segment is integrated in selection genome.

In another preferred example, terramycin production bacterial strain is streptomycete.

In another preferred example, the cultural method of step (2) includes：Cultivate streptomycete spore to form the thin ball of mycelia, it After be seeded in fermentation medium, 30 ± 2 DEG C (preferably 30 ± 1 DEG C), 220 ± 50rpm (preferably 220 ± 20rpm) fermentation.

In another preferred example, the fermentation medium includes according to w/v：3% glucose, 1% albumen Peptone, 0.07% MOPS, 0.02% calcium chloride, 0.02% sodium nitrate, 0.1% trace element；Wherein, the percentage composition of each component It can float up and down 10%；Preferably float 5%.

In another aspect of this invention, a kind of terramycin production bacterial strain of improvement is provided, in the genome of the bacterial strain LsigB genes are blocked or are knocked.

In a preference, using the partial sequence segment of lsigB genes as homology arm, in terramycin produces bacterial strain LsigB gene locations are inserted into foreign gene, to obtain the bacterial strain that lsigB genes are blocked or are knocked.

In another preferred example, the terramycin production bacterial strain of the improvement is improved by starting strain of streptomycete.

In another aspect of this invention, the purposes that lsigB genes are provided, for producing bacterial strain as improvement terramycin, carrying The target spot of high oxytetracycline yield.

The other aspects of the present invention are apparent to those skilled in the art due to this disclosure 's.

Description of the drawings

The appearance time of Fig. 1, terramycin.

Fig. 2, M4018::LsigB mutative symptom processes.

Fig. 3, amplification obtain lsigB Partial Fragments and lsigB blocked mutants M4018::The verification of lsigB.

(A) PCR obtains the Partial Fragment of lsigB, the part lsigB segments that Lane1,2 are.

(B) pKB plasmid identifications, Lane1：Xba I, BamH I double digestion pKC1139 plasmids, Lane2-4：Double digestion is verified PKB plasmids.

(C)M4018::LsigB mutant strains PCR identifications, wherein Lane 1：Using M4018 genomes as template, Lane 2： PKC1139 plasmids are as template, Lane 3-7：To convert subgenom as template.

The oxytetracycline yield block diagram of Fig. 4, unit thalline.Wherein, ordinate unit：OTC/DCW(mg/g).

Specific implementation mode

The present inventor passes through in-depth study, discloses for the first time in terramycin produces bacterial strain, lower (including block or strike Except) after lsigB genes, the oxytetracycline yield of terramycin production bacterial strain can be significantly increased.The terramycin of unit thalline synthesizes Amount can be improved 20% or more.The present invention produces strain improvement for terramycin and provides a new way.

As used herein, " external source " or " heterologous " refers to two or more pieces nucleic acid or protein from separate sources Relationship between sequence.For example, if the combination of promoter and objective gene sequence is not usually naturally occurring, promoter It is external source for the target gene.Particular sequence for the cell that it is inserted into or is " external source " for organism.

NCBI has been disclosed that the protein sequence of lsigB gene orders and its coding, amino acid sequence can be found in GenBank Accession number：ELQ80095.1(SEQ ID NO:2)(Sig B/F/G subfamily RNA polymerase sigma-28 Subunit), nucleotide sequence such as SEQ ID NO:Shown in 1.Therefore, those skilled in the art are easily obtained the gene.

LsigB genes are lowered in terramycin produces bacterial strain, and a variety of methods known in the art, including gene may be used Silence, gene disruption, gene knockout, gene inhibition etc..These methods are included in the present invention.

For example, interrupter technique can be inserted by the gene based on homologous recombination come the lsigB genes in modifying gene group, So that lsigB genes are blocked；Interferential RNA or GEM 132 can also be designed for lsigB genes to make lsigB Gene expression inhibition or silence.

It is a kind of lower lsigB genes method be Gene silence, in a preferred embodiment of the invention, external structure LsigB gene disruption plasmids are built, by the method for homologous recombination, are inserted into terramycin produces strain chromosome lsigB genes Other independent elements, so that the lsigB genes on chromosome are no longer able to the protein of encoding active.When progress gene resistance When disconnected, the selection of independent element, which is that those skilled in the art are readily selected, arrives, such as using some resistant genes.A kind of gene The method for blocking (knockout) see, for example, Genetic Manipulation of Streptomyces:a Laboratory Recorded in Manual.Preferably, in the embodiment of the present invention, the independent element includes the part in pKC1139 plasmids Element, such as ori T, Ori pSG5, Apr.In addition, lsigB genes are carried out missing knockout, it is allowed to lack the pass functioned Key range is also a kind of strategy of feasible down-regulated gene.

In the construction designed for carrying out gene disruption or knockout, at the same include resistance screening gene be it is preferred, To be conducive to subsequently to filter out the bacterial strain that producer is blocked or knocks out.

Based on the new discovery of the present invention, after being inserted into blocking-up method blocking lsigB genes using gene The terramycin of acquisition produces bacterium, which does not express lsigB genes or expression quantity conspicuousness and reduce.The invention further relates to the bacterium The purposes of strain is used for high yield terramycin.

Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention Rather than it limits the scope of the invention.In the following examples, the experimental methods for specific conditions are not specified, usually according to conventional strip Part such as J. Pehanorm Brookers etc. is write, Molecular Cloning:A Laboratory guide, the third edition, Science Press, the condition described in 2002, or According to the normal condition proposed by manufacturer.

I. materials and methods

1, plasmid, bacterial strain and culture medium

In the present invention, the plasmid applied is as shown in table 1.

Table 1, plasmid summarize

Note：Amp^RFor amicillin resistance；Apr^RFor apramycin resistance；Kan^RFor kalamycin resistance.

Table 2, strain summarize

The foundation of pMD19-lsigB plasmids：Using K-lsigBF, K-lsigBR as primer, expand by template of M4018 genomes Increase lsigB to expand to obtain the Partial Fragment of lsigB, and introduce BamHI and Xba I restriction enzyme sites, being inserted into pMD19, (Dalian is precious Raw biology Co., Ltd) BamHI and Xba I sites in, obtain pMD19-lsigB plasmids.

2, culture medium prescription

LB culture mediums (w/V)：Sodium chloride 10%, peptone 10%, yeast powder 5%, deionized water are adjusted after being settled to 1L PH to 7.0.2% agar, 121 DEG C of sterilizing 20min are added in solid medium.

Bran mass (w/V)：Wheat bran 6%, agar 2%.

TSB (Tryptone Soya Broth) culture medium (w/V)：3% Tryptone Broth.

MS solid mediums (w/V)：2% soybean cake powder, 2% mannitol, 2% agar.

Emerson culture mediums (w/V)：0.4% peptone, 0.4% Beef, 0.1% yeast powder, 1% glucose, 0.25% NaCl, 2% agar.

Seed culture medium (w/V)：1% glucose, 1.5% tryptone, 0.05% yeast powder, 0.28% sucrose, 0.01% calcium carbonate.

Natural fermented culture medium (w/V)：3% glucose, 1% peptone, 0.07% MOPS, 0.02% calcium chloride, 0.02% sodium nitrate, 0.1% trace element.Wherein micro- (g/L)：Zinc chloride 0.04, ferric chloride hexahydrate 0.2, two water Close copper chloride 0.01, four chloride hydrate manganese 0.01, ten hydrated sodium borates 0.01, Ammonium Molybdate Tetrahydrate ((NH₄)₆·Mo₇O₄) 0.0124。

3, kit and toolenzyme

Restriction enzyme used in molecular cloning is purchased from Takara biotechnologys (Dalian) Co., Ltd.Plasmid extraction is tried Agent box, plastic recovery kit, fragment purification kit are purchased from love and pursue progress biotechnology (Hangzhou) Co., Ltd.The primer is shown in Table 3.

Table 3, primer

4, cultural method

(1) preparation of S.rimosus M4018 spore suspension

Spore after dipping activation with aseptic cotton carrier is coated on MS tablets, and 30 DEG C are cultivated 5-7 days.It is to be formed a large amount of greyish white When color spore, collects in spore to sterile water, filter and be diluted to suitable multiple, be coated on Emerson ' s tablets and count. Spore suspension known to spore number is obtained in this way.

(2) natural fermented culture medium fermentation

Second order fermentation is as follows：First with 1 × 10⁶It is natural that the inoculum concentration of S.rimosus M4018 spore/mL is inoculated into 50mL In seed culture medium, 30 DEG C, 220rpm, 24~30h is cultivated.After forming the thin ball of a large amount of mycelia, extremely with 10% inoculum concentration In the natural fermented culture mediums of 100mL, 30 DEG C, 220rpm ferments 7 days, timing sampling.

5, determination method

(1) measurement of streptomyces rimosus dry cell weight

During the fermentation, the zymotic fluid of certain volume is periodically taken, then 6000rpm centrifuges 15min, and supernatant is set In -20 DEG C of preservations, for the measurement of subsequent experimental.In 95 DEG C of baking ovens, after drying sediment fraction to constant weight, weigh.

(2) in fermentation process terramycin concentration HPLC assay methods

This, which is measured, uses Kromasil C18 chromatographic columns (4.6 × 200mm, 5 μm), 35 DEG C, Detection wavelength 350nm of column temperature, Time 10min, liquid inlet volume are 10 μ L.

(3) preparation of mobile phase

Wherein phosphoric acid need to be dissolved in mixing in ultra-pure water by 0.2M phosphate buffers, and using vacuum filtration pumping filter.

(4) preparation of product is marked

It prepares 10000U and marks product solution, with 0.01M hydrochloric acids to 1000U, each of standard curve is drawn in -20 DEG C of preservations A mark product concentration is respectively 0U, 20U, 40U, 60U, 80U, 100U.The appearance time of terramycin is 3.7min (Fig. 1) after testing, When measuring the content of terramycin using this method, the range of linearity is 0~100mg/L, and correlation R²=0.9998, terramycin For the rate of recovery 98% or more, detection time is very short.So in conclusion this method is suitable for rapidly and accurately measuring terramycin.

(5) acidification of sample

Terramycin forms salt and is attached to mycelium, is discharged after acidification.Take zymotic fluid 1mL, the 9M hydrochloric acid of 30 μ L of addition or so It is acidified, adjusts pH to 1.5~1.7, vibrate mixing, after placing 5min, 12000rpm centrifuges 5min, takes supernatant, will be upper It is transferred to clearly in another EP pipe, -20 DEG C of preservations.When measurement, zymotic fluid generally requires dilution, and the OTC concentration in sample should not More than 100U, with 0.22 μm of membrane filtration sample, HPLC is measured.

Embodiment

The structure of embodiment 1, recombinant plasmid pKC Δs sig

1, include the extraction of streptomyces rimosus genomic DNA：First, by streptomyces rimosus (Streptomyces RimosusSRI05 it) is seeded in trypticase soy broth (TSB), 30 DEG C of 220rpm cultivate 30h.Secondly, centrifugation is received Collect mycelium, with sterile water washing mycelium.Then lysozyme fracturing cell walls are used, isolating protein is removed with phenol-chloroform extracting Equal impurity.Finally genomic DNA is obtained with isopropanol precipitating.

2, PCR reactions being carried out using following primer using M4018 genomes as template, amplification obtains the Partial Fragment of lsigB, It is named as KB segments, specially lsigB gene internals 181bp to 680bp, the DNA fragmentation of total 500bp：

K-lsig BF：CGCGGATCCAACCTGCCATTGGTGCGCTACGCG (underscore is the sites BamHI) (SEQ ID NO:7)；

K-lsig BR：CTAGTCTAGATTGGCCAGCAGGGGCTTGAGGGACT (underscore is the sites XbaII) (SEQ ID NO:8)。

3, recombinant plasmid and strain construction：It is used for after the KB segments that PCR amplification obtains are connected to pMD-19 business plasmids Sequencing, through company's sequencing result be analysis be it is consistent with the KB segments of design.Obtained KB segments is bis- through BamHI and Xba I It is purified after digestion, by pKC1139 plasmids (being obtained from University of Strathclyde, Glasgow, UK), same BamHI It is purified with after Xba I double digestions, the two is connected, structure is about the recombinant plasmid pKC1139-lsigB (pKC Δ sig) of 7kb.

Then recombinant plasmid pKC1139-lsigB (pKC Δ sig) is converted into bacillus coli DH 5 alpha competent cell, conversion Product is coated with the LB tablets containing 50 μ g/mL of apramycin, 37 DEG C of stationary culture 12h, the single bacterium colony grown on picking tablet Into the LB liquid medium of the 50 μ g/mL containing apramycin, 37 DEG C of 220rpm cultivate 12h, plasmid are extracted, using restricted interior After enzyme cutting digestion, 0.8% agarose gel electrophoresis of loading, the screening correct plasmid of endonuclease bamhi size is recombinant vector pKC Δsig。

The demethylation of recombinant vector pKC Δs sig：The Escherichia coli ET12567/pUZ8002 of conservation is activated to containing 34 μ g/ml chloramphenicol (chloroamphenicol), on the LB tablets of 25 μ g/ml kanamycins (kanamycin), 37 DEG C of cultures 12h, then in picking but bacterium colony to 3ml LB liquid mediums (antibiotic content is same as above), 37 DEG C, 220rpm cultivates 12h, and makes Standby ET12567 competent cells.

Recombinant plasmid pKC Δs sig is transformed into ET12567/pUZ8002 competent cells, is needed in the LB tablets of coating Containing 34 μ g/mL chloramphenicol (Chloroamphenicol), 25 μ g/mL kanamycins (Kanamycin) and 25 μ g/mL A Pu Mycin (Apramycin) is drawn, after picking but bacterium colony, is accessed in LB liquid medium, 37 DEG C, 220rpm cultivates 12h.Extract matter Grain carries out double digestion verification, to obtain the recombinant plasmid pKC Δs sig of demethylation.

The screening and identification of embodiment 2, mutant strain

After pKC Δ sig plasmids enter intracellular, only when on recombinant plasmid homology arm exchanged with genome, make weight After on group plasmid integration to genome, resistant gene can just give expression to Apr resistances.PKC1139 is Thermo-sensitive plasmid simultaneously, The plasmid can not replicate when temperature is higher, and free plasmid can be lost, and the sequence on plasmid can be made by Homo~logous exchange Plasmid integration is on chromosome, to which resistant gene is expressed.So screening transformant under 37 DEG C of condition of culture, at this moment What can be grown in resistant panel is the recombinant bacterium that recombination occurs and exchanges (pKC Δ sig), and weight is further identified by PCR Group bacterium.Detailed process is as follows：

The Conjugative tiansfer of streptomyces rimosus：Escherichia coli ET12567-pKC Δs sig is seeded to 3mL liquid LB and (contains 50 μ G/mL apramycins, 25 μ g/mL chloramphenicol, 25 μ g/mL kanamycins) culture medium, 37 DEG C, 220rpm, shaken cultivation is overnight. Overnight bacterium solution is inoculated into 30mL liquid LB (antibiotic content is same as above) culture medium by 1% inoculum concentration, 37 DEG C, 220rpm, is trained Support OD₆₀₀In 0.3-0.5 or so.6000rpm, 4 DEG C of centrifugation 10min, collects thalline, with fresh not antibiotic of 30mL After liquid LB washing, liquid is removed, 2-3 times.Thalline is suspended in the not antibiotic liquid LB of 2.5mL, is turned as combining Donor in shifting.Prepare streptomyces rimosus spore suspension (being suspended in sterile water) known to concentration.40 DEG C of culture spores are outstanding The TSB, 250rpm, 37 DEG C of 0.5mL is added in supernatant liquid 10min after being cooled to room temperature, cultivate 2-3h, which is to tie Close the receptor in transfer.Respectively take receptor and donor by bacterium amount 10⁸:10⁸Oscillation is uniformly mixed, and gained mixed liquor is centrifuged 10000rpm, 2min are coated on MS tablets (MgCl containing 10mM₂), 28 DEG C, cultivate 16-18h.It is removed with sterile washing tablet Escherichia coli, and the mixed liquor of apramycin (Apramycin) and acidum nalidixicum (Nalidixic acid) is added, 28 DEG C of cultures 3-5d.Pass through 3 secondary cultures in the resistant panel containing 500 μ g/mL of 50 μ g/mL of acidum nalidixicum and apramycin, it is thoroughly clear Except donor Escherichia coli ET12567, streptomycete DNA is extracted after picking single bacterium colony, recombinant bacterium is verified by expanding Apr resistance fragments Strain.

The primer that PCR is used when verifying is as follows：

Sense primer AprF：TGCAATACGAATGGCGAAAAG(SEQ ID NO:9)；

Downstream primer AprR：TCGGCCCAGTTGACCCAGGG(SEQ ID NO:10)；

By recombinant bacterial strain, that is, M4018 of above-mentioned acquisition::LsigB deletion mutations strain and control strain M4018 are seeded to and shake Bottle, fermentation, passes through efficient liquid phase-mass spectrometry Performance in Oxytetracycline Fermentation Broth biological value.

Thalli growth and terramycin fermentation situation in embodiment 3, fermentation process

In the fermentation process of S.rimosus M4018,6ml zymotic fluids are sampled per 12h, wherein 5ml is for measuring thalline Dry weight, 1ml measure oxytetracycline yield for HPLC, observe thalli growth situation and produce the situation of terramycin.

The oxytetracycline yield of comparative unit thalline is visible (Fig. 4), compared to control strain M4018, Δ lsigB unit thalline Terramycin synthetic quantity improve about 23.2%.

To sum up, block lsigB that there is significant positive regulating and controlling effect to the synthesis of terramycin.

All references mentioned in the present invention is incorporated herein by reference, independent just as each document It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can To be made various changes or modifications to the present invention, such equivalent forms equally fall within model defined by the application the appended claims It encloses.

Claims (9)

1. a kind of method producing terramycin, which is characterized in that the method includes：

(1) in terramycin produces bacterial strain, the expression of lsigB genes is lowered；Wherein, terramycin production bacterial strain is cracking Streptomycete；

(2) bacterial strain prepared by incubation step (1), to produce terramycin.

2. the method as described in claim 1, which is characterized in that by blocking or knocking out lsigB genes, to lower terramycin Produce the expression of lsigB genes in bacterial strain.

3. the method as described in claim 1, which is characterized in that lsigB gene locations are inserted into outer in terramycin produces bacterial strain Source gene, to block lsigB genes.

4. the method as described in claim 1, which is characterized in that the terramycin production bacterial strain is S.rimosus M4018.

5. method as claimed in claim 4, which is characterized in that the cultural method of step (2) includes：

Streptomyces rimosus spore is cultivated to form the thin ball of mycelia, is seeded in fermentation medium later, 30 ± 2 DEG C, 220 ± 50rpm ferments.

6. method as claimed in claim 5, which is characterized in that the fermentation medium includes according to w/v：3% Glucose, 1% peptone, 0.07%MOPS, 0.02% calcium chloride, 0.02% sodium nitrate, 0.1% trace element.

7. a kind of terramycin of improvement produces bacterial strain, it is streptomyces rimosus that the terramycin, which produces bacterial strain, which is characterized in that institute LsigB genes are blocked or are knocked in the genome for the bacterial strain stated.

8. bacterial strain as claimed in claim 7, which is characterized in that using the partial sequence segment of lsigB genes as homology arm, Terramycin produces lsigB gene locations in bacterial strain and is inserted into foreign gene, to obtain the bacterium that lsigB genes are blocked or are knocked Strain.

The purposes of 9.lsigB genes, which is characterized in that for producing bacterial strain as improvement terramycin, improving oxytetracycline yield Target spot；Wherein, terramycin production bacterial strain is streptomyces rimosus.