CN105316383B - A method of improving the oxytetracycline yield of streptomycete by gene disruption - Google Patents
A method of improving the oxytetracycline yield of streptomycete by gene disruption Download PDFInfo
- Publication number
- CN105316383B CN105316383B CN201410373431.2A CN201410373431A CN105316383B CN 105316383 B CN105316383 B CN 105316383B CN 201410373431 A CN201410373431 A CN 201410373431A CN 105316383 B CN105316383 B CN 105316383B
- Authority
- CN
- China
- Prior art keywords
- terramycin
- lsigb
- bacterial strain
- genes
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a kind of methods for the oxytetracycline yield improving streptomycete by gene disruption.It discloses for the first time in terramycin produces bacterial strain, after lowering lsigB genes, the oxytetracycline yield of terramycin production bacterial strain can be significantly increased, the terramycin synthetic quantity of unit thalline can be improved 20% or more.The present invention produces strain improvement for terramycin and provides a new way.
Description
Technical field
The present invention relates to biotechnologies, more particularly it relates to which one kind improving streptomycete by gene disruption
Oxytetracycline yield method.
Background technology
The life cycle of streptomycete is very complicated, can generate a variety of secondary metabolites.These natural products are new drug
It was found that providing abundant precursor resource.Until nineteen ninety-five, by the secondary with antibiotic activity obtained in streptomycete
There are about 7000 kinds for metabolite.The antibiotic that streptomycete generates is used widely in medicine and life science.Strepto-
Bacterium all has weight with its distinctive Development And Differentiation feature and powerful cometabolism ability in terms of basic research and commercial Application
Want status.The synthesis of antibiotic is related to a large amount of regulatory factors, these regulatory factors are by regulating and controlling in antibiotic route of synthesis
The expression quantity of related gene has regulated and controled the yield of antibiotic.This is further using these regulatory factors as target spot progress base
Because of transformation, antibiotic enhanced variant is obtained, to realize that the raising of antibiotic yield provides willing energy.
Streptomyces rimosus (Streptomyce rimosus) is the commercialization of terramycin (oxytetracycline, OTC)
Produce bacterial strain.Terramycin belongs to Tetracyclines broad-spectrum antibiotic, can inhibit former to gram positive bacteria, negative bacterium, mycoplasma, clothing
It is infected caused by body, Richettsia etc., simultaneously can be used for treatment piroplasmosis, eperythrozoonosis.Its mechanism of action is soil
Mycin can be combined reversibly with 30S ribosomal subunits, to inhibit the formation of aminoacyl tRNA ribose composite, be pressed down in this way
The breeding of bacterium is made.Therefore researcher constantly studies S.rimosus using molecular engineering, is changed using recombinant technique
It makes bacterial strain performance, improve antibiotic yield, or non-natural antibiotics are synthetically produced as skeleton.However, in order to improve
The yield of terramycin, this field there is a need to the method that further research improves oxytetracycline yield.
The biosynthesis gene of the secondary metabolite of streptomycete is frequently located in same gene cluster, includes often in gene cluster
One or more approach specific regulatory control genes, they generally regulate and control a kind of antibiotic or several with the synthesis of certain common biologicals
The biosynthesis of the antibiotic of approach.The regulation and control of antibiotic biological synthesis gene cluster are by the transcription regulator positioned at gene cluster
(CSR) regulated and controled on transcriptional level, usually there is single transcription regulator regulation and control and the regulation and control of more transcription regulators.
But it is sufficiently complex in view of the cometabolism regulated and control network of streptomycete, navigate to has oxytetracycline yield really
It the gene of regulating and controlling effect and adjusts the expression of the gene and does not cause the gene of significant impact to be still streptomycete own growth
Difficult.
Invention content
The purpose of the present invention is to provide a kind of methods for the oxytetracycline yield improving streptomycete by gene disruption.
In the first aspect of the present invention, a kind of method producing terramycin is provided, the method includes:
(1) in terramycin produces bacterial strain, the expression of lsigB genes (class sigB genes, like-sigB) is lowered;
(2) bacterial strain prepared by incubation step (1), to produce terramycin.
In a preference, by blocking (be preferably inserted into and block) or lsigB genes are knocked out, it is mould to lower soil
The expression of lsigB genes in element production bacterial strain.
In another preferred example, lsigB gene locations are inserted into foreign gene in terramycin produces bacterial strain, to block
LsigB genes (preferably, being inserted into foreign gene in 181-680 sections in the gene).
In another preferred example, the foreign gene includes the subelement in pKC1139 plasmids, such as ori T,
Ori pSG5、Apr。
In another preferred example, the blocking lsigB genetic methods include:Expression vector, the expression vector are provided
In the partial sequence (preferably 181-680 bit sequences) comprising lsigB genes, expression vector is converted into streptomyces rimosus,
The recombination streptomyces rimosus of exogenous gene sequence segment is integrated in selection genome.
In another preferred example, terramycin production bacterial strain is streptomycete.
In another preferred example, the cultural method of step (2) includes:Cultivate streptomycete spore to form the thin ball of mycelia, it
After be seeded in fermentation medium, 30 ± 2 DEG C (preferably 30 ± 1 DEG C), 220 ± 50rpm (preferably 220 ± 20rpm) fermentation.
In another preferred example, the fermentation medium includes according to w/v:3% glucose, 1% albumen
Peptone, 0.07% MOPS, 0.02% calcium chloride, 0.02% sodium nitrate, 0.1% trace element;Wherein, the percentage composition of each component
It can float up and down 10%;Preferably float 5%.
In another aspect of this invention, a kind of terramycin production bacterial strain of improvement is provided, in the genome of the bacterial strain
LsigB genes are blocked or are knocked.
In a preference, using the partial sequence segment of lsigB genes as homology arm, in terramycin produces bacterial strain
LsigB gene locations are inserted into foreign gene, to obtain the bacterial strain that lsigB genes are blocked or are knocked.
In another preferred example, the terramycin production bacterial strain of the improvement is improved by starting strain of streptomycete.
In another aspect of this invention, the purposes that lsigB genes are provided, for producing bacterial strain as improvement terramycin, carrying
The target spot of high oxytetracycline yield.
The other aspects of the present invention are apparent to those skilled in the art due to this disclosure
's.
Description of the drawings
The appearance time of Fig. 1, terramycin.
Fig. 2, M4018::LsigB mutative symptom processes.
Fig. 3, amplification obtain lsigB Partial Fragments and lsigB blocked mutants M4018::The verification of lsigB.
(A) PCR obtains the Partial Fragment of lsigB, the part lsigB segments that Lane1,2 are.
(B) pKB plasmid identifications, Lane1:Xba I, BamH I double digestion pKC1139 plasmids, Lane2-4:Double digestion is verified
PKB plasmids.
(C)M4018::LsigB mutant strains PCR identifications, wherein Lane 1:Using M4018 genomes as template, Lane 2:
PKC1139 plasmids are as template, Lane 3-7:To convert subgenom as template.
The oxytetracycline yield block diagram of Fig. 4, unit thalline.Wherein, ordinate unit:OTC/DCW(mg/g).
Specific implementation mode
The present inventor passes through in-depth study, discloses for the first time in terramycin produces bacterial strain, lower (including block or strike
Except) after lsigB genes, the oxytetracycline yield of terramycin production bacterial strain can be significantly increased.The terramycin of unit thalline synthesizes
Amount can be improved 20% or more.The present invention produces strain improvement for terramycin and provides a new way.
As used herein, " external source " or " heterologous " refers to two or more pieces nucleic acid or protein from separate sources
Relationship between sequence.For example, if the combination of promoter and objective gene sequence is not usually naturally occurring, promoter
It is external source for the target gene.Particular sequence for the cell that it is inserted into or is " external source " for organism.
NCBI has been disclosed that the protein sequence of lsigB gene orders and its coding, amino acid sequence can be found in GenBank
Accession number:ELQ80095.1(SEQ ID NO:2)(Sig B/F/G subfamily RNA polymerase sigma-28
Subunit), nucleotide sequence such as SEQ ID NO:Shown in 1.Therefore, those skilled in the art are easily obtained the gene.
LsigB genes are lowered in terramycin produces bacterial strain, and a variety of methods known in the art, including gene may be used
Silence, gene disruption, gene knockout, gene inhibition etc..These methods are included in the present invention.
For example, interrupter technique can be inserted by the gene based on homologous recombination come the lsigB genes in modifying gene group,
So that lsigB genes are blocked;Interferential RNA or GEM 132 can also be designed for lsigB genes to make lsigB
Gene expression inhibition or silence.
It is a kind of lower lsigB genes method be Gene silence, in a preferred embodiment of the invention, external structure
LsigB gene disruption plasmids are built, by the method for homologous recombination, are inserted into terramycin produces strain chromosome lsigB genes
Other independent elements, so that the lsigB genes on chromosome are no longer able to the protein of encoding active.When progress gene resistance
When disconnected, the selection of independent element, which is that those skilled in the art are readily selected, arrives, such as using some resistant genes.A kind of gene
The method for blocking (knockout) see, for example, Genetic Manipulation of Streptomyces:a Laboratory
Recorded in Manual.Preferably, in the embodiment of the present invention, the independent element includes the part in pKC1139 plasmids
Element, such as ori T, Ori pSG5, Apr.In addition, lsigB genes are carried out missing knockout, it is allowed to lack the pass functioned
Key range is also a kind of strategy of feasible down-regulated gene.
In the construction designed for carrying out gene disruption or knockout, at the same include resistance screening gene be it is preferred,
To be conducive to subsequently to filter out the bacterial strain that producer is blocked or knocks out.
Based on the new discovery of the present invention, after being inserted into blocking-up method blocking lsigB genes using gene
The terramycin of acquisition produces bacterium, which does not express lsigB genes or expression quantity conspicuousness and reduce.The invention further relates to the bacterium
The purposes of strain is used for high yield terramycin.
Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention
Rather than it limits the scope of the invention.In the following examples, the experimental methods for specific conditions are not specified, usually according to conventional strip
Part such as J. Pehanorm Brookers etc. is write, Molecular Cloning:A Laboratory guide, the third edition, Science Press, the condition described in 2002, or
According to the normal condition proposed by manufacturer.
I. materials and methods
1, plasmid, bacterial strain and culture medium
In the present invention, the plasmid applied is as shown in table 1.
Table 1, plasmid summarize
Note:AmpRFor amicillin resistance;AprRFor apramycin resistance;KanRFor kalamycin resistance.
Table 2, strain summarize
The foundation of pMD19-lsigB plasmids:Using K-lsigBF, K-lsigBR as primer, expand by template of M4018 genomes
Increase lsigB to expand to obtain the Partial Fragment of lsigB, and introduce BamHI and Xba I restriction enzyme sites, being inserted into pMD19, (Dalian is precious
Raw biology Co., Ltd) BamHI and Xba I sites in, obtain pMD19-lsigB plasmids.
2, culture medium prescription
LB culture mediums (w/V):Sodium chloride 10%, peptone 10%, yeast powder 5%, deionized water are adjusted after being settled to 1L
PH to 7.0.2% agar, 121 DEG C of sterilizing 20min are added in solid medium.
Bran mass (w/V):Wheat bran 6%, agar 2%.
TSB (Tryptone Soya Broth) culture medium (w/V):3% Tryptone Broth.
MS solid mediums (w/V):2% soybean cake powder, 2% mannitol, 2% agar.
Emerson culture mediums (w/V):0.4% peptone, 0.4% Beef, 0.1% yeast powder, 1% glucose,
0.25% NaCl, 2% agar.
Seed culture medium (w/V):1% glucose, 1.5% tryptone, 0.05% yeast powder, 0.28% sucrose,
0.01% calcium carbonate.
Natural fermented culture medium (w/V):3% glucose, 1% peptone, 0.07% MOPS, 0.02% calcium chloride,
0.02% sodium nitrate, 0.1% trace element.Wherein micro- (g/L):Zinc chloride 0.04, ferric chloride hexahydrate 0.2, two water
Close copper chloride 0.01, four chloride hydrate manganese 0.01, ten hydrated sodium borates 0.01, Ammonium Molybdate Tetrahydrate ((NH4)6·Mo7O4)
0.0124。
3, kit and toolenzyme
Restriction enzyme used in molecular cloning is purchased from Takara biotechnologys (Dalian) Co., Ltd.Plasmid extraction is tried
Agent box, plastic recovery kit, fragment purification kit are purchased from love and pursue progress biotechnology (Hangzhou) Co., Ltd.The primer is shown in
Table 3.
Table 3, primer
4, cultural method
(1) preparation of S.rimosus M4018 spore suspension
Spore after dipping activation with aseptic cotton carrier is coated on MS tablets, and 30 DEG C are cultivated 5-7 days.It is to be formed a large amount of greyish white
When color spore, collects in spore to sterile water, filter and be diluted to suitable multiple, be coated on Emerson ' s tablets and count.
Spore suspension known to spore number is obtained in this way.
(2) natural fermented culture medium fermentation
Second order fermentation is as follows:First with 1 × 106It is natural that the inoculum concentration of S.rimosus M4018 spore/mL is inoculated into 50mL
In seed culture medium, 30 DEG C, 220rpm, 24~30h is cultivated.After forming the thin ball of a large amount of mycelia, extremely with 10% inoculum concentration
In the natural fermented culture mediums of 100mL, 30 DEG C, 220rpm ferments 7 days, timing sampling.
5, determination method
(1) measurement of streptomyces rimosus dry cell weight
During the fermentation, the zymotic fluid of certain volume is periodically taken, then 6000rpm centrifuges 15min, and supernatant is set
In -20 DEG C of preservations, for the measurement of subsequent experimental.In 95 DEG C of baking ovens, after drying sediment fraction to constant weight, weigh.
(2) in fermentation process terramycin concentration HPLC assay methods
This, which is measured, uses Kromasil C18 chromatographic columns (4.6 × 200mm, 5 μm), 35 DEG C, Detection wavelength 350nm of column temperature,
Time 10min, liquid inlet volume are 10 μ L.
(3) preparation of mobile phase
Wherein phosphoric acid need to be dissolved in mixing in ultra-pure water by 0.2M phosphate buffers, and using vacuum filtration pumping filter.
(4) preparation of product is marked
It prepares 10000U and marks product solution, with 0.01M hydrochloric acids to 1000U, each of standard curve is drawn in -20 DEG C of preservations
A mark product concentration is respectively 0U, 20U, 40U, 60U, 80U, 100U.The appearance time of terramycin is 3.7min (Fig. 1) after testing,
When measuring the content of terramycin using this method, the range of linearity is 0~100mg/L, and correlation R2=0.9998, terramycin
For the rate of recovery 98% or more, detection time is very short.So in conclusion this method is suitable for rapidly and accurately measuring terramycin.
(5) acidification of sample
Terramycin forms salt and is attached to mycelium, is discharged after acidification.Take zymotic fluid 1mL, the 9M hydrochloric acid of 30 μ L of addition or so
It is acidified, adjusts pH to 1.5~1.7, vibrate mixing, after placing 5min, 12000rpm centrifuges 5min, takes supernatant, will be upper
It is transferred to clearly in another EP pipe, -20 DEG C of preservations.When measurement, zymotic fluid generally requires dilution, and the OTC concentration in sample should not
More than 100U, with 0.22 μm of membrane filtration sample, HPLC is measured.
Embodiment
The structure of embodiment 1, recombinant plasmid pKC Δs sig
1, include the extraction of streptomyces rimosus genomic DNA:First, by streptomyces rimosus (Streptomyces
RimosusSRI05 it) is seeded in trypticase soy broth (TSB), 30 DEG C of 220rpm cultivate 30h.Secondly, centrifugation is received
Collect mycelium, with sterile water washing mycelium.Then lysozyme fracturing cell walls are used, isolating protein is removed with phenol-chloroform extracting
Equal impurity.Finally genomic DNA is obtained with isopropanol precipitating.
2, PCR reactions being carried out using following primer using M4018 genomes as template, amplification obtains the Partial Fragment of lsigB,
It is named as KB segments, specially lsigB gene internals 181bp to 680bp, the DNA fragmentation of total 500bp:
K-lsig BF:CGCGGATCCAACCTGCCATTGGTGCGCTACGCG (underscore is the sites BamHI) (SEQ ID
NO:7);
K-lsig BR:CTAGTCTAGATTGGCCAGCAGGGGCTTGAGGGACT (underscore is the sites XbaII) (SEQ
ID NO:8)。
3, recombinant plasmid and strain construction:It is used for after the KB segments that PCR amplification obtains are connected to pMD-19 business plasmids
Sequencing, through company's sequencing result be analysis be it is consistent with the KB segments of design.Obtained KB segments is bis- through BamHI and Xba I
It is purified after digestion, by pKC1139 plasmids (being obtained from University of Strathclyde, Glasgow, UK), same BamHI
It is purified with after Xba I double digestions, the two is connected, structure is about the recombinant plasmid pKC1139-lsigB (pKC Δ sig) of 7kb.
Then recombinant plasmid pKC1139-lsigB (pKC Δ sig) is converted into bacillus coli DH 5 alpha competent cell, conversion
Product is coated with the LB tablets containing 50 μ g/mL of apramycin, 37 DEG C of stationary culture 12h, the single bacterium colony grown on picking tablet
Into the LB liquid medium of the 50 μ g/mL containing apramycin, 37 DEG C of 220rpm cultivate 12h, plasmid are extracted, using restricted interior
After enzyme cutting digestion, 0.8% agarose gel electrophoresis of loading, the screening correct plasmid of endonuclease bamhi size is recombinant vector pKC
Δsig。
The demethylation of recombinant vector pKC Δs sig:The Escherichia coli ET12567/pUZ8002 of conservation is activated to containing
34 μ g/ml chloramphenicol (chloroamphenicol), on the LB tablets of 25 μ g/ml kanamycins (kanamycin), 37 DEG C of cultures
12h, then in picking but bacterium colony to 3ml LB liquid mediums (antibiotic content is same as above), 37 DEG C, 220rpm cultivates 12h, and makes
Standby ET12567 competent cells.
Recombinant plasmid pKC Δs sig is transformed into ET12567/pUZ8002 competent cells, is needed in the LB tablets of coating
Containing 34 μ g/mL chloramphenicol (Chloroamphenicol), 25 μ g/mL kanamycins (Kanamycin) and 25 μ g/mL A Pu
Mycin (Apramycin) is drawn, after picking but bacterium colony, is accessed in LB liquid medium, 37 DEG C, 220rpm cultivates 12h.Extract matter
Grain carries out double digestion verification, to obtain the recombinant plasmid pKC Δs sig of demethylation.
The screening and identification of embodiment 2, mutant strain
After pKC Δ sig plasmids enter intracellular, only when on recombinant plasmid homology arm exchanged with genome, make weight
After on group plasmid integration to genome, resistant gene can just give expression to Apr resistances.PKC1139 is Thermo-sensitive plasmid simultaneously,
The plasmid can not replicate when temperature is higher, and free plasmid can be lost, and the sequence on plasmid can be made by Homo~logous exchange
Plasmid integration is on chromosome, to which resistant gene is expressed.So screening transformant under 37 DEG C of condition of culture, at this moment
What can be grown in resistant panel is the recombinant bacterium that recombination occurs and exchanges (pKC Δ sig), and weight is further identified by PCR
Group bacterium.Detailed process is as follows:
The Conjugative tiansfer of streptomyces rimosus:Escherichia coli ET12567-pKC Δs sig is seeded to 3mL liquid LB and (contains 50 μ
G/mL apramycins, 25 μ g/mL chloramphenicol, 25 μ g/mL kanamycins) culture medium, 37 DEG C, 220rpm, shaken cultivation is overnight.
Overnight bacterium solution is inoculated into 30mL liquid LB (antibiotic content is same as above) culture medium by 1% inoculum concentration, 37 DEG C, 220rpm, is trained
Support OD600In 0.3-0.5 or so.6000rpm, 4 DEG C of centrifugation 10min, collects thalline, with fresh not antibiotic of 30mL
After liquid LB washing, liquid is removed, 2-3 times.Thalline is suspended in the not antibiotic liquid LB of 2.5mL, is turned as combining
Donor in shifting.Prepare streptomyces rimosus spore suspension (being suspended in sterile water) known to concentration.40 DEG C of culture spores are outstanding
The TSB, 250rpm, 37 DEG C of 0.5mL is added in supernatant liquid 10min after being cooled to room temperature, cultivate 2-3h, which is to tie
Close the receptor in transfer.Respectively take receptor and donor by bacterium amount 108:108Oscillation is uniformly mixed, and gained mixed liquor is centrifuged
10000rpm, 2min are coated on MS tablets (MgCl containing 10mM2), 28 DEG C, cultivate 16-18h.It is removed with sterile washing tablet
Escherichia coli, and the mixed liquor of apramycin (Apramycin) and acidum nalidixicum (Nalidixic acid) is added, 28 DEG C of cultures
3-5d.Pass through 3 secondary cultures in the resistant panel containing 500 μ g/mL of 50 μ g/mL of acidum nalidixicum and apramycin, it is thoroughly clear
Except donor Escherichia coli ET12567, streptomycete DNA is extracted after picking single bacterium colony, recombinant bacterium is verified by expanding Apr resistance fragments
Strain.
The primer that PCR is used when verifying is as follows:
Sense primer AprF:TGCAATACGAATGGCGAAAAG(SEQ ID NO:9);
Downstream primer AprR:TCGGCCCAGTTGACCCAGGG(SEQ ID NO:10);
By recombinant bacterial strain, that is, M4018 of above-mentioned acquisition::LsigB deletion mutations strain and control strain M4018 are seeded to and shake
Bottle, fermentation, passes through efficient liquid phase-mass spectrometry Performance in Oxytetracycline Fermentation Broth biological value.
Thalli growth and terramycin fermentation situation in embodiment 3, fermentation process
In the fermentation process of S.rimosus M4018,6ml zymotic fluids are sampled per 12h, wherein 5ml is for measuring thalline
Dry weight, 1ml measure oxytetracycline yield for HPLC, observe thalli growth situation and produce the situation of terramycin.
The oxytetracycline yield of comparative unit thalline is visible (Fig. 4), compared to control strain M4018, Δ lsigB unit thalline
Terramycin synthetic quantity improve about 23.2%.
To sum up, block lsigB that there is significant positive regulating and controlling effect to the synthesis of terramycin.
All references mentioned in the present invention is incorporated herein by reference, independent just as each document
It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can
To be made various changes or modifications to the present invention, such equivalent forms equally fall within model defined by the application the appended claims
It encloses.
Claims (9)
1. a kind of method producing terramycin, which is characterized in that the method includes:
(1) in terramycin produces bacterial strain, the expression of lsigB genes is lowered;Wherein, terramycin production bacterial strain is cracking
Streptomycete;
(2) bacterial strain prepared by incubation step (1), to produce terramycin.
2. the method as described in claim 1, which is characterized in that by blocking or knocking out lsigB genes, to lower terramycin
Produce the expression of lsigB genes in bacterial strain.
3. the method as described in claim 1, which is characterized in that lsigB gene locations are inserted into outer in terramycin produces bacterial strain
Source gene, to block lsigB genes.
4. the method as described in claim 1, which is characterized in that the terramycin production bacterial strain is S.rimosus M4018.
5. method as claimed in claim 4, which is characterized in that the cultural method of step (2) includes:
Streptomyces rimosus spore is cultivated to form the thin ball of mycelia, is seeded in fermentation medium later, 30 ± 2 DEG C, 220 ±
50rpm ferments.
6. method as claimed in claim 5, which is characterized in that the fermentation medium includes according to w/v:3%
Glucose, 1% peptone, 0.07%MOPS, 0.02% calcium chloride, 0.02% sodium nitrate, 0.1% trace element.
7. a kind of terramycin of improvement produces bacterial strain, it is streptomyces rimosus that the terramycin, which produces bacterial strain, which is characterized in that institute
LsigB genes are blocked or are knocked in the genome for the bacterial strain stated.
8. bacterial strain as claimed in claim 7, which is characterized in that using the partial sequence segment of lsigB genes as homology arm,
Terramycin produces lsigB gene locations in bacterial strain and is inserted into foreign gene, to obtain the bacterium that lsigB genes are blocked or are knocked
Strain.
The purposes of 9.lsigB genes, which is characterized in that for producing bacterial strain as improvement terramycin, improving oxytetracycline yield
Target spot;Wherein, terramycin production bacterial strain is streptomyces rimosus.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410373431.2A CN105316383B (en) | 2014-07-31 | 2014-07-31 | A method of improving the oxytetracycline yield of streptomycete by gene disruption |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410373431.2A CN105316383B (en) | 2014-07-31 | 2014-07-31 | A method of improving the oxytetracycline yield of streptomycete by gene disruption |
Publications (2)
Publication Number | Publication Date |
---|---|
CN105316383A CN105316383A (en) | 2016-02-10 |
CN105316383B true CN105316383B (en) | 2018-10-16 |
Family
ID=55244701
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410373431.2A Active CN105316383B (en) | 2014-07-31 | 2014-07-31 | A method of improving the oxytetracycline yield of streptomycete by gene disruption |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN105316383B (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108424946B (en) * | 2018-01-30 | 2021-10-15 | 华东理工大学 | Method for improving terramycin yield based on afsQ1Q2-like two-component regulation system |
CN108424945B (en) * | 2018-01-30 | 2021-10-15 | 华东理工大学 | Method for improving terramycin yield based on rapA1A2-like dual-component regulation system |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102757975A (en) * | 2011-04-27 | 2012-10-31 | 华东理工大学 | Method for increasing oxytetracycline yield of streptomyces rimosus |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE102009036414B4 (en) * | 2009-08-06 | 2017-11-02 | Erbe Elektromedizin Gmbh | Supply device for at least one medical instrument and method for configuring a corresponding supply device |
-
2014
- 2014-07-31 CN CN201410373431.2A patent/CN105316383B/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102757975A (en) * | 2011-04-27 | 2012-10-31 | 华东理工大学 | Method for increasing oxytetracycline yield of streptomyces rimosus |
Non-Patent Citations (1)
Title |
---|
"龟裂链霉菌中选择性σ 因子lsigB 在大肠杆菌中的异源表达及功能验证";曹楠等;《食品工业科技》;20140729;第36卷(第3期);全文 * |
Also Published As
Publication number | Publication date |
---|---|
CN105316383A (en) | 2016-02-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN107502585A (en) | One plant of bacillus licheniformis engineering bacteria for efficiently synthesizing poly- γ glutamic acid | |
CN103468625B (en) | Gene disruption mutant of streptomyces bingchenggensis as well as preparation method and application thereof | |
CN102181470B (en) | Method for improving yield of Streptomyces antibiotics and plasmid thereof | |
CN103131716A (en) | Biosynthetic gene cluster of salinomycin and application thereof | |
CN105420154A (en) | Double knockout recombinant rhodococcus as well as construction method and application thereof | |
CN104974974A (en) | Saccharopolyspora spinosa high-pleocidin-yield engineering strain and application thereof | |
CN105316383B (en) | A method of improving the oxytetracycline yield of streptomycete by gene disruption | |
CN112899210B (en) | Method for improving validamycin fermentation level by enhancing positive regulatory protein gene expression | |
CN102703495A (en) | Method for improving yield of streptomycete antibiotic and plasmid thereof | |
CN110484481A (en) | A method of lincomycin yield is improved by transformation Str. lincolnensis SLCG_3128 gene | |
CN102719388A (en) | Method for improving yield of streptomyces antibiotics and plasmids thereof | |
CN109136253A (en) | A method of yield of erythrocin is improved by the red mould SACE_5754 gene approach of the more spores of sugar | |
CN103361345B (en) | The biosynthetic method of the biological components and parts strengthening secondary metabolite of restructuring regulation and control | |
CN110106191A (en) | Artificial synthesized Vitreoscilla hemoglobin gene and corresponding engineered strain and application | |
CN110423790B (en) | Metabolic engineering method for directionally producing high yield antifungal tetramycin B | |
CN106554932B (en) | Genencor engineering bacterium for producing gentamicin B and construction method thereof | |
CN105821053B (en) | Utilize method terramycin positive regulating gene building recombinant bacterium and improve oxytetracycline yield | |
CN111139208B (en) | High-yield engineering bacterium for producing ivermectin and preparation method and application thereof | |
CN111139207B (en) | Brevibacillus brevis gene recombinant strain and preparation method and application thereof | |
CN106520821B (en) | Suitable for the t7 rna polymerase expression cassette PhT7 and its expression vector of streptomycete and application | |
CN109182240A (en) | The B. licheniformis strain and construction method of knockout phoP gene and application | |
CN104046635A (en) | Application and usage method of nfiS gene for specific response of adversity signal | |
CN110066741A (en) | It is a kind of to optimize the mutant strain construction method that orientation improves filamentous fungi metabolism yield by form | |
CN103865946B (en) | Method based on metabolic regulation high yield oxytetracycline | |
CN113755517B (en) | Construction method and application of SLCG _5407 gene modified streptomyces lincolnensis |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |